• Aucun résultat trouvé

Lentiviral Vectors That Express UGT1A1 in Liver and Contain Mir-142 Target Sequences Normalize Hyperbilirubinemia in Gunn Rats

N/A
N/A
Protected

Academic year: 2022

Partager "Lentiviral Vectors That Express UGT1A1 in Liver and Contain Mir-142 Target Sequences Normalize Hyperbilirubinemia in Gunn Rats"

Copied!
11
0
0

Texte intégral

(1)

Lentiviral Vectors That Express UGT1A1 in Liver and Contain miR-142 Target Sequences Normalize Hyperbilirubinemia in Gunn Rats

FRANÇOISE SCHMITT,*,‡ SÉVERINE REMY,§ ANNE DARIEL,*,‡MAUDE FLAGEUL,* VIRGINIE PICHARD,*

SÉBASTIEN BONI,* CLAIRE USAL,§ANNE MYARA, SOPHIE LAPLANCHE, IGNACIO ANEGON,§PHILIPPE LABRUNE,*

GUILLAUME PODEVIN,*,‡ NICOLAS FERRY,* and TUAN HUY NGUYEN*

*INSERM Unité 948,Service de Chirurgie Pédiatrique, and§INSERM Unité 643, CHU Hôtel Dieu, Nantes, France;Service de Biologie, Groupe Hospitalier Saint Joseph, Paris, France; andService de Pédiatrie, Hôpital Antoine Béclère, Clamart, France

See editorial on page 726.

BACKGROUND & AIMS:Crigler–Najjar type 1 (CN-I) is an inherited liver disease caused by an absence of bilirubin–

uridine 5=-diphosphate–glucuronosyltransferase (UGT1A1) activity. It results in life-threatening levels of unconjugated bilirubin, and therapeutic options are limited. We used adult Gunn rats (an animal model of the disease) to evalu- ate the efficiency of lentiviral-based gene therapy to express UGT1A1 in liver.METHODS:Gunn rats were given intra- portal injections of VSVG-pseudotyped lentiviral vectors that encode UGT1A1 under the control of a liver-specific transthyretin promoter (mTTR.hUGT1A1); this vector does not contain target sequences for miR-142, a microRNA that is expressed specifically in hemato- poietic cells. Rats were also injected with the vector mTTR.hUGT1A1.142T, which contains 4 copies of the miR-142 target sequences; its messenger RNA should be degraded in antigen-presenting cells. Bilirubinemia was monitored, and the presence of transduced hepatocytes was analyzed by quantitative polymerase chain reaction.

Vector expression was tested in vitro in rat hematopoietic cells.RESULTS:In Gunn rats, bilirubin levels normalized 2 weeks after administration of mTTR.hUGT1A1. However, hy- perbilirubinemia resumed 8 weeks after vector administration, concomitant with the induction of an immune response. In contrast, in rats injected with mTTR-UGT1A1.142T, bilirubin levels normalized for up to 6 months and transduced cells were not eliminated.CONCLUSIONS: Lentiviral vectors that ex- press UGT1A1 reduce hyperbilirubinemia in immuno- competent Gunn rats for at least 6 months. The immune response against virally expressed UGT1A1 can be circum- vented by inclusion of miR-142 target sequences, which reduce vector expression in antigen-presenting cells. This lentiviral-based gene therapy approach might be devel- oped to treat patients with CN-I.

Keywords: Crigler–Najjar Syndrome; Gene Transfer; Len- tivirus; MicroRNA.

C

rigler–Najjar disease type I (CN-I) is a rare recessive inherited metabolic disorder characterized by very high levels of circulating unconjugated bilirubin. It causes life-threatening neurotoxic injury, which can ultimately lead to fatal encephalopathy, and the only curative alternative is liver transplantation. This genetic disease is an attractive candidate for gene therapy for a number of reasons. First, the molecular defect is well characterized. CN-I results from the complete absence of hepatic activity of bilirubin– uri- dine 5=-diphosphate– glucuronosyltransferase (UGT1A1), the enzyme responsible for conjugation of a bilirubin moi- ety to 1 or 2 molecules of glucuronic acid. After conjuga- tion, the hydrophobic bilirubin molecule is rendered water soluble and can be excreted via the bile. In patients with CN-I, nonconjugated bilirubin remains in the serum. It concentrates in organs with high lipid content such as the brain, leading to lesions described as kernicterus. The sec- ond reason why CN-I is attractive for gene therapy is that during the course of the disease the histology of the liver remains completely normal. The morbidity of CN-I is ex- clusively related to extrahepatic deposition of nonconju- gated bilirubin. The normality of liver architecture main- tains the accessibility of hepatocytes to blood-borne gene transfer vectors and thus preserves the efficiency of in vivo gene therapy. A third reason is the availability of a model of the disease, the Gunn rat, that mimics the human pathol- ogy and facilitates preclinical evaluation of various vector systems and delivery strategies to correct the disease. Finally, because CN-I is a severe disease that can only be completely cured by liver transplantation, it deserves the exploration of new therapeutic strategies such as gene therapy. Of note, there is no need for a complete and full restoration of UGT1A1 activity in patients with CN-1 to reach a valuable

Abbreviations used in this paper:APC, antigen-presenting cells; CN-I, Crigler–Najjar type 1; FACS, fluorescence-activated cell sorter; GFP, green fluorescent protein; miRNA, microRNA; MOI, multiplicity of in- fection; PGK, phosphoglycerate kinase; qPCR, quantitative polymer- ase chain reaction; Treg, regulatory CD4T cell; TU, transducing units;

UGT1A1, bilirubin– uridine 5=-diphosphate– glucuronosyltransferase.

©2010 by the AGA Institute 0016-5085/$36.00 doi:10.1053/j.gastro.2010.05.008

BASIC–LIVER, PANCREAS,AND BILIARYTRACT

(2)

clinical result, and restoration of only 5% to 10% of enzyme activity is enough to maintain bilirubin levels below the neurotoxic threshold without using phototherapy. For all these reasons, CN-I is a paradigm for gene therapy for liver genetic diseases, and many previous studies have focused on gene delivery to the Gunn rat to correct the disease pheno- type.1Complete and sustained correction was achieved in vivo using gutless adenoviral vectors delivered to the adult animals or using retroviral vectors delivered to the new- born.2– 4Ex vivo gene therapy using autologous hepatocytes transduced with lentiviral vectors also achieved significant levels of correction or liver repopulation.5These experimen- tal strategies are, however, difficult to translate to the clinics.

The easiest gene therapy protocol for CN-I would entail a single administration of a gene transfer vector via a mini- mally invasive route with ensuing complete and definitive cure with no adverse effects. We previously showed that retroviral vectors could achieve this goal when delivered to newborn Gunn rats.2,3However, because diagnosis is usu- ally delayed up to 4 to 8 weeks of age, gene therapy for patients with CN-I at birth is not achievable. Moreover, the immaturity of the immune system at birth in rodents does not fully compare with the human situation. Our previous attempts to treat adult Gunn rats with retroviral vectors failed because an immune response directed against the corrected hepatocytes was triggered after vector delivery.6 Long-term survival of transduced hepatocytes in adult rats can only be achieved by using a pharmacologic manipula- tion of the host immune system.7

Therefore, we sought to improve the design of our vec- tors to thwart the induction of immune response while maintaining a full transduction capacity in hepatocytes. To this end, we took advantage of the cell-specific expression pattern of some microRNA (miRNA) as previously de- scribed.8In this setting, an miRNA target sequence for the miR-142-3p (miR-142) is placed downstream of the thera- peutic complementary DNA (cDNA). The miR-142 is spe- cifically expressed in cells of the hematopoietic lineage, including antigen-presenting cells (APCs). After administra- tion to mice, expression in APC is turned off because the miR-142 present in the cell will bind to its target sequence in the messenger RNA (mRNA) encoding the transgene.

This will result in degradation of the mRNA if the target sequences are perfectly matched to the miR-142 sequence.

In the present report, we show that addition of 4 copies of the miR-142 target sequences (miR-142T) to the cDNA encoding UGT1A1 allowed escape from the immune re- sponse and resulted in complete and definitive correction of Gunn rats after lentivirus delivery to adult animals with no induction of a cytotoxic immune response.

Materials and Methods Cell Culture and Transduction

HeLa and 293T cells were cultured in Dulbecco’s modified Eagle medium and NR8383 cells in Ham’s F12

medium containing 10% fetal bovine serum, glutamine, and antibiotics. Cells were transduced at 5 ⫻ 104cells/

well (HeLa) or 1 ⫻105cells/mL (NR8383) for 24 hours and cultured for 7 days before fluorescence-activated cell sorter (FACS) analysis.

Bone marrow cells were isolated from tibias and fe- murs of Gunn rats and cultured in X-vivo medium (Cam- brex, Paris, France) in the presence of 5 ng/mL hepato- cyte growth factor (R&D Systems, Lille, France) as described.9They were transduced the day of cell isolation for 16 hours and cultured for 7 days before FACS anal- ysis. Bone marrow– derived dendritic cells were obtained and cultured as described.10They were transduced on day 3 at 1⫻106cells/mL for 4 hours and cultured for 5 days before FACS analysis.

Animals and Vector Administration

Animals were housed at the animal facilities of Nantes University Medical School and received humane care according to the guidelines of the French Ministère de l’Agriculture. Male Gunn j/j rats weighed 140 to 160 g (6 to 7 weeks old) and were maintained under a 12-hour light cycle and fed ad libitum. All viral vectors from a same vector batch were injected intraportally using a 30-gauge syringe at a dose of 1.5⫻107transducing units (TU)/g. All procedures were performed under isoflurane general anesthesia (3% vol/vol in air).

Lentiviral Vectors

The self-inactivating mTTR.hUGT1A1 was previ- ously described and contained the human UGT1A1 cDNA under control of the liver-specific transthyretin mTTR promoter.3In the mTTR.hUGT1A1.142T vector, 4 copies of perfectly matched miR-142 target sequences11 (kindly provided by Dr Luigi Naldini) were added down- stream of the expression cassette in mTTR.hUGT1A1 vec- tor. The pCCL.sin.cPPT.PGK.GFP.WPRE (PGK.GFP) and pCCL.sin.cPPT.PGK.GFP.WPRE.142T (PGK.GFP.142T) ex- pressing green fluorescent protein (GFP) under the con- trol of phosphoglycerate kinase (PGK) promoter were previously described.8

Vectors were produced by transient transfection into 293T cells as described.12 Vector titers were determined on HeLa cells by real-time quantitative polymerase chain reaction (qPCR) on an ABI Prism 7000 using SYBR green (MesaGreen qPCR MasterMix; Eurogentec, Angers, France) and primers specific for vector (GAG-F, GGAGCTAGAACGATTCGCAGTTA; GAG-R, GGTTG- TAGCTGTCCCAGTATTTGTC) and for␤-actin.13Vector titers were routinely 5⫻ 109 TU/mL.

Liver Function Tests

Blood was drawn from the retro-orbital sinus.

Serum total bilirubin and alanine and aspartate amino- transferase levels were measured at the Routine Biochem- istry Department of Nantes University Hospital. The

BASIC–LIVER,PANCREAS,ANDBILIARYTRACT

(3)

presence of bilirubin conjugates in bile and UGT1A1 activity on liver homogenates were assessed using alka- line methanolysis and by the diazotation method, respec- tively.14

Vector Copy Number Quantification

High-molecular-weight DNA was subjected to amplification by qPCR on an ABI Prism 7000 using SYBR green (Eurogentec) and primers specific for vector (GAG-F and GAG-R) and for the rat HPRT (HPRT-F, GCGAAAGTGGAAAAGCCAAGT; HPRT-R, GCCACAT- CAACAGGACTCTTGTAG). A standard curve was con- structed by using dilutions in rat genomic DNA of a lentiviral plasmid.

Histology and Immunohistochemistry

The presence of GFP-positive hepatocytes was as- sessed by immunohistochemistry on formalin-fixed/par- affin-embedded sections using monoclonal mouse anti- GFP antibody (Clontech, Saint-Germain-en-Laye, France) and diaminobenzidine staining as described.3 The per- centage of GFP-positive cells was calculated in at least 10 fields at 40⫻ magnification.

Antibody Detection

The detection of antibodies directed to UGT1A1 in rat serum was performed by indirect enzyme-linked immunosorbent assay as described.6 Titrations of sera were performed at 5 weeks and 6 months postinjection in rats that had been injected with mTTR.hUGT1A1 and mTTR.hUGT1A1.142T, respectively. Titrations of sera from an uninjected Gunn rat and from a Gunn rat injected with oncoretroviral vector encoding hUGT1A1 were used as a negative and positive control, respectively.

Values of optical density at 405 nm were subtracted with those from the negative control. Significance threshold (0.5 OD) was defined as twice the OD obtained with serum from naive Gunn rats.6

Analysis of GFP-Specific T-Cell Response Quantitative analysis of CD8CD25 and CD4 CD25T cells was performed in splenocytes from Spra- gue–Dawley rats (6 weeks of age) 24 days after intraportal vein injection of PGK.GFP.142T (n ⫽ 4) of PGK.GFP (n ⫽ 4) vectors at a vector dose of 0.5 ⫻107 TU/g.

Isolated splenocytes from naive and vector-injected rats were cultured for 4 days in RPMI 1640 medium supple- mented with 10% fetal calf serum, glutamine, antibiotics, 10 mmol/L HEPES, 1 mmol/L sodium pyruvate, nones- sential amino acids, and 50 mmol/L 2-mercaptoethanol at a cell density of 2⫻106cells/mL and in the presence of 5␮g/mL recombinant GFP. They were restimulated or not with anti-CD3 (5 ␮g/mL) plus anti-CD28 (2.6 ␮g/

mL) monoclonal antibodies for 6 hours. Harvested cells were labeled with fluorochrome-conjugated anti-TCR (Alexa 647), anti-CD4 (PECy7), anti-CD8 (PE), and anti-

CD25 (fluorescein isothiocyanate) monoclonal antibod- ies (BD Pharmingen, Le Pont-De-Claix, France) before FACS analysis (FACS LSRII; Becton Dickinson, Le Pont- De-Claix, France).

Statistical Analysis

Statistical analysis was performed using the Mann–

Whitney test to compare quantitative data.

Results

In a first set of experiments, we evaluated the efficiency of lentiviral vectors carrying the human UGT1A1 cDNA under control of a liver-specific mTTR promoter (mTTR.hUGT1A1) to correct serum bilirubin level in adult Gunn rats. Lentiviral vectors were injected at a unique dose (2.2 ⫾ 0.1 ⫻ 109 TU per animal) corresponding to a multiplicity of infection (MOI) of 2, assuming that liver weight represents 5% of the body weight and that 1 g of liver contains 1 ⫻ 108 hepato- cytes.15,16 Serum bilirubin level was recorded thereafter and showed a significant decrease that almost reached normalization 2 weeks later (mean serum bilirubin level, 27⫾3.5␮mol/L) (Figure 1). However, the correction was transient and hyperbilirubinemia increased thereafter to reach levels of uninjected controls 8 weeks postinjection.

This pattern is reminiscent of our previous results ob- tained with oncoretroviral vectors that could correct se- rum bilirubin level only transiently because of an im- mune response directed to the therapeutic protein.6 We then evaluated the immunologic status of injected ani- mals. As shown in Figure 2A, all injected animals had significant levels of anti-UGT1A1 antibodies at 5 weeks

Figure 1. Time course of serum bilirubin levels in treated animals.

Gunn rats received lentiviral vector encoding hUGT1A1 under the con- trol of the mTTR liver-specific promoter carrying or not miR-142 target sequences at a dose of 1.5107TU/g per animal. Eachvalueplotted represents the meanSD for uninjected rat controls (n4,closed circles), mTTR.hUGT1A1-injected rats (n3,closed squares), and mTTR.hUGT1A1.142T rats (n5,open squares). Control rats devel- oped severe hyperbilirubinemia.*P.05 injected vs control animals.

BASIC–LIVER, PANCREAS,AND BILIARYTRACT

(4)

after gene delivery, showing that lentivirally expressed hUGT1A1 is immunogenic. Moreover, real-time PCR showed that the vector genome was detected at a low residual level at 6 months postinjection when hyperbil- irubinemia had resumed (⬍0.001 vector copy per haploid genome). This low residual presence of transgene copies could correspond to nonparenchymal cells, such as en- dothelial cells, transduced but in which mTTR promoter is inactive.11These results strongly suggested that adult animals were able to mount an immune response to the therapeutic proteins, resulting in a clearance of cells expressing hUGT1A1.

This induction of an immune response was likely to be the result of infection of APCs by lentiviral vectors and by off-target transgene expression in APCs despite the use of a liver-specific promoter.11 This was confirmed in vitro using GFP as a reporter gene driven by the mTTR pro- moter in lentiviral vectors. Using this vector, we detected up to 2.5% of GFP-expressing cells after transduction of NR8383 rat macrophage cells (Supplementary Figure 1A). A similar off-target GFP expression was observed in Gunn rat bone marrow– derived dendritic cells (Supple- mentary Figure 1B), although the GFP expression was about 6-fold lower than that obtained with a PGK-GFP lentiviral vector, in which GFP expression is driven by the ubiquitous PGK promoter (mean of fluorescence of 173⫾55 vs 1014⫾503 for mTTR and PGK, respectively;

P ⫽ .05; n ⫽ 3). This low level of transgene expression may be sufficient to elicit an immune response against the transgene product. Overall, these results clearly show that, as suggested by others, the use of a tissue-specific promoter in lentiviral vectors is not able to blunt com- pletely the expression of the transgene in APCs, resulting in an immune clearance of the transduced cells.8

To circumvent more tightly the immune response, we constructed a lentiviral vector containing the miR-142T

to induce degradation of the mRNA in APCs. We first evaluated the efficiency of the miR-142T in rat APCs infected with vectors carrying GFP under the control of the PGK promoter (PGK.GFP.142T). As shown inFigure 3AandB, the proportion of GFP-positive cells was dras- tically reduced after infection with PGK.GFP.142T vec- tors at an MOI of 1. At a higher MOI, some cells ex- pressed GFP but still at a lower level than in the absence of the miR-142T. We then evaluated the potency of the miR-142T to repress GFP expression in Gunn rat den- dritic cells. At an MOI of 20, 42%⫾7.5% of rat dendritic cells readily expressed GFP after incubation with PGK- GFP vector (Figure 3C). After incubation with PGK.- GFP.142T vector, the peak of highly positive GFP cells was no longer present.

We then determined the ability of the miR-142T to hamper in vivo a cellular immune response against a transgene product delivered to the rat liver using lentivi- ral vector. After injection of PGK.GFP.142T or PGK vec- tors, splenocytes were isolated at 24 days postinjection.

T-cell activation was measured following exposure to recombinant GFP protein by FACS analyses of the CD25 activation marker. Some GFP-stimulated T lymphocytes were also restimulated with anti-CD3 and anti-CD28 antibodies to increase the sensitivity of the assay. As shown in Figure 3D, increased activation of CD8 and CD4 T lymphocytes was detected in rats injected with PGK-GFP vector. By contrast, a significant decrease in the proportion of activated T cells was detected in PGK.GFP.142T-injected rats. Interestingly, we observed that CD4 and CD8 T lymphocytes isolated from PGK.GFP.142T-injected rats were resistant to stimula- tion with anti-CD3 and anti-CD28, as compared with those isolated from PGK.GFP-injected and naive rats.

Thus, these results showed the cross-species efficiency of the miR-142 in vitro and in vivo for repressing lenti-

Figure 2. Detection of hUGT1A1 antibodies by enzyme-linked immunosorbent assay. Antibodies against hUGT1A1 were detected by enzyme- linked immunosorbent assay in serum of (A) mTTR.hUGT1A1-injected and (B) mTTR.hUGT1A1.142T-injected rats (closed squares). Titrations of sera from a Gunn rat injected with oncoretroviral vector encoding hUGT1A1 were used as a positive control (open squares). Eachplotrepresents an individual animal. Results are expressed as arbitrary OD values with a significance threshold of 0.5 at dilutions greater than 1:400. Administration of mTTR.hUGT1A1.142T vector did not lead to formation of hUGT1A1 antibodies except in one animal (#138).

BASIC–LIVER,PANCREAS,ANDBILIARYTRACT

(5)

viral gene expression from hematopoietic lineages and for down-regulating a cellular immune response against GFP, respectively. This prompted us to explore the same miR-142T for treating Gunn rats in the long-term.

A cohort of adult Gunn rats was injected with mTTR- hUGT1A1 vector harboring miR-142T. As shown inFig-

ure 1, serum bilirubin level was normalized (2.8⫾ 1.9

␮mol/L) as early as 1 week after lentivirus delivery and remained stable for up to 6 months (end of the study). At 6 months, we checked by high-performance liquid chro- matography that bilirubin conjugates were present in the bile (Table 1), indicating that correction was actually due

Figure 3. Effect of addition of target sequences to miR-142 in vector backbone on transgene expression level in rat hematopoietic cells. Rat hematopoietic cells were transduced with PGK.GFP.142T (PGK-mirT) and PGK.GFP (PGK) lentiviral vectors. (A) Gunn rat bone marrow and (B) NR8383 cells were transduced at an MOI of 1 or 10. The percentage of GFP-positive cells is indicated in thelower right corner of each plot. Control infections were conducted with medium only (mock). (C) Gunn rat dendritic cells were transduced at an MOI of 20 (left panel). The percentage of transduction (meanSD, n3) and mean intensity of fluorescence (eachplotrepresents an individual animal) are shown in themiddleandright panels, respectively. (D) T-cell response to GFP in rats injected with PGK.GFP.142T or PGK.GFP vectors. Splenocytes were isolated from naive and vector-injected rats and cultured in the presence of recombinant GFP for 4 days following restimulation or not with CD3/CD28 antibodies before FACS analysis to determine the proportion of activated CD8and CD4T cells. Eachplotcorresponds to one experimental animal.

BASIC–LIVER, PANCREAS,AND BILIARYTRACT

(6)

to bilirubin conjugation. In untreated Gunn rats, there were no bilirubin conjugates due to the absence of UGT1A1 (100% unconjugated bilirubin). We also evalu- ated UGT1A1 activity in liver homogenates (Table 1). The values obtained corresponded to 44% to 372% of the activity in the normal liver and confirmed liver transduc- tion and hUGT1A1 protein expression. We evaluated by qPCR the amount of vector genome present in the liver.

The results shown inFigure 4 demonstrate the stability of the vector content in the liver between 1 month and 6 months postinjection. The results also showed that the number of 0.22 vector copy/haploid genome was suffi- cient to cure the Gunn rat. Of note, the rat with the lowest vector copy number in the liver at the time the rats were killed (#92) was also the one with the higher amount of unconjugated bilirubin in the bile. Unfortu- nately, antibodies directed against human UGT1A1 did not allow detection of transduced cells by immunohisto- chemistry, as has been also observed by others.17–19 Therefore, to evaluate the in situ frequency and distribu- tion of transduced hepatocytes in Gunn rats, we injected vectors encoding GFP under the mTTR promoter and performed immunohistochemical detection of GFP. As shown in Figure 5, hepatocytes were massively trans- duced at a mean frequency of 47.67% ⫾ 6.6% at day 9

after vector delivery. qPCR analysis of genomic DNA in transduced liver revealed 0.22 to 0.66 (0.41⫾0.23) vector copy/haploid genome. These values are similar to those obtained for mTTR.UGT1A1.142T-injected animals.

Transduced hepatocytes were equally distributed be- tween the liver lobes with a preferential localization in liver periportal areas. Of note, we did not detect GFP- expressing nonparenchymal cells in the GFP-immuno- stained liver sections.

We evaluated the presence of anti-hUGT1A1antibodies in the serum of treated animals. hUGT1A1 antibodies were absent in all animals except one (#138) (Figure 2B), as compared with all animals receiving the vector lacking the miR-142T. It is noteworthy that the presence of antibodies at a high titer in rat #138 did not impair the therapeutic effect of the lentiviral vector. This may indi- cate that UGT1A1 expression, which is a microsomal protein, was not affected by the presence of circulating antibodies. Unfortunately, our repeated attempts to set up an assay in the Gunn rats to directly evaluate a cellular immune response were unsuccessful.

In all animals, the liver histology remained normal.

The overall architecture of the parenchyma was unmod- ified as compared with controls (Supplementary Figure 2). Similarly, transaminase levels remained in the normal range at all time points. Finally, we analyzed by qPCR the vector biodistribution. We observed that most of the transduction occurred in the liver. A lower transduction level was also found in the spleen (representing 5% of the value found in the liver) in all animals, as well as in the lung and intestine for some animals and in the testis for one animal (#138) (Supplementary Table 1).

Discussion

CN-I is a paradigm for gene therapy for liver inherited diseases, and Gunn rats have long been used as a valuable tool to evaluate gene transfer strategies using a panel of gene transfer vectors. Gene therapy strategies for the Gunn rat should circumvent immune response to achieve permanent correction of the genetic defect. Pre- vious studies have shown that adeno-associated viral (AAV) or gutted adenoviral vectors could achieve this goal. However, only partial correction was achieved with AAV vectors and serum bilirubin level gradually increased after gene delivery.18 AAV vectors are known to induce Table 1. Assessment of Bilirubin Metabolism

Rat no. UGT1A1 activity (U/L)

Bile derivatives (%)

Unconjugated Monoconjugates Diconjugates

91 18.37 5.82 40.47 45.9

92 25.85 20.96 57.03 13.1

93 15.36 1.36 40.38 54.09

138 26.1 2.34 35.25 58.98

140 130.28 1.52 21.97 70.13

Figure 4. Follow-up of vector genome content in the liver after hUGT1A1 gene transfer in cured Gunn rats. Genomic DNA was isolated from liver samples at 1 and 6 months after administration of mTTR.hUGT1A1.miR-142T vectors. The number of vector copies per haploid genome (C/G) was determined by qPCR. Eachplotrepresents an individual animal.

BASIC–LIVER,PANCREAS,ANDBILIARYTRACT

(7)

immune tolerance after gene delivery to the liver and are not able to infect APCs.20,21However, the absence of AAV vector integration may result in disappearance of the correction. Gutted adenoviral vectors were shown to cor- rect completely the disease for the life of the animals.4A high vector dose was required for efficient hepatocyte transduction, which is still questionable for a clinical application because of the risk of acute toxic response to adenoviral capsids.22In addition, the vector copy number was not evaluated and therefore a vector loss over time cannot be excluded.4 Indeed, similar to AAV vectors, gutted adenoviral vectors do not integrate in the genome of the corrected cell and the correction may be lost when hepatocyte division is activated (eg, during acute hepati- tis or during liver growth). It is therefore tempting to speculate that retroviral vectors will be able to maintain a constant level of correction whatever the subsequent replication of corrected hepatocytes. Along this line, we previously showed that concanavalin A–induced hepatitis or partial hepatectomy did not decrease correction level in Gunn rats and the number of transduced hepatocytes when using lentiviral vectors to ferry the transgene.23,24 Retroviral integration increases the potential risk of vec- tor genotoxicity, which was observed after transduction of hematopoietic stem cells.25–27 However, no liver tu- mors were reported after injection of human immuno- deficiency virus 1– derived lentiviral vector by us and others,23,28 in contrast to a non– human immunodefi- ciency virus— based vector such as EIAV.29Our previous studies showed that one of the main issues regarding transgene delivery to the liver using retroviral vectors is the induction of an immune response that is likely trig- gered by infection of APCs.6 Alternatively, we cannot exclude that cross-presentation of the therapeutic pro- tein engulfed by APCs by the major histocompatibility complex class I pathway can also trigger a cytotoxic or humoral immune response. Indeed, viral supernatants, especially when concentrated by ultracentrifugation, are contaminated by cell debris, including the therapeutic

protein that is expressed after transfection of the pack- aging cells. We previously showed that both pathways were accountable for the induction of an immune re- sponse after in vivo delivery of␤-galactosidase retroviral vectors to hepatocytes.30 Gene transfer to immune in- competent newborns is an alternative to circumvent im- mune response, but this approach is unlikely to be clin- ically relevant for treating CN-I due to the delay in diagnosis of CN-I. Modification of the vector design is the most promising strategy to circumvent the immune response for future clinical application, particularly by exploiting the endogenous miRNA-mediated posttran- scriptional pathway to induce degradation of vector-de- rived mRNA in APCs. In a seminal report, Brown et al observed strong expression of GFP limited to hepatocytes and endothelial cells after intravenous injection of PGK.GFP.142T vectors in adult mice.8 In contrast, in mice that received PGK.GFP vectors, GFP expression was also detected in Kupffer cells and in splenocytes.

GFP expression was only sustained in mice receiving PGK.GFP.142T vectors. This miR-142–regulated lentivi- ral vector strategy was then successfully used to stably treat hemophilic mice.11 Annoni et al recently showed that systemic injection of miR-142–regulated lentiviral vectors recruited and expanded regulatory CD4 T cells (Tregs) in the liver with generation of GFP-specific Tregs.31 These Tregs were responsible for maintaining immunologic tolerance to GFP antigen in injected mice.

In the present study, we extended this initial observa- tion to another species and to another inherited liver disease using the same miR-142 target sequences.8 We demonstrated in vitro a strong repression of lentiviral gene expression in rat hematopoietic cells. We observed decreased GFP-specific T cell response in rats following injection of PGK.GFP.142T, as compared with PGK.GFP- injected rats. Interestingly, we also observed that CD4T lymphocytes and CD8 T lymphocytes isolated from PGK.GFP.142T-injected rats did not respond to stimula- tion with anti-CD3 and anti-CD28, in contrast to those

Figure 5. Transduction efficacy in the rat liver after intraportal administration of lentiviral vectors. Gunn rats received lentiviral vector encoding GFP under the control of the mTTR promoter at a dose of 1.5107TU/g (n3) and were killed at day 9 postinjection. (A) The presence of GFP-positive hepatocytes in the liver was detected by immunohistochemistry. Hematoxylin counterstained. Original magnification 220. (B) The number of vector copies/haploid genome (C/G) was determined by qPCR. The percentage of GFP-positive hepatocytes is also indicated for each animal.

BASIC–LIVER, PANCREAS,AND BILIARYTRACT

(8)

isolated from PGK.GFP-injected and naive rats. This sug- gested (although did not prove definitely) the presence of Tregs in PGK.GFP.142T-injected rats, as was shown in mice.31We next showed that the miR-142–regulated len- tiviral strategy was also valid for the delivery of a thera- peutic gene in a rat model of a human liver genetic disease. We achieved a complete and stable correction of hyperbilirubinemia in the Gunn rat injected with mTTR.UGT1A1.142T. In contrast, correction was only transient in Gunn rats injected with mTTR.hUGT1A1 vec- tor. The most likely explanation for the loss of therapeutic effect is a cytotoxic immune response against hUGT1A1 resulting in immune clearance of transduced hepatocytes.

This hypothesis is strengthened by the appearance of anti- bodies to hUGT1A1 in all mTTR.hUGT1A1-injected ani- mals. Unfortunately, we were not able to directly detect the presence of hUGT1A1-specific T cells in injected Gunn rats.

However, our results with GFP as a surrogate marker strongly suggest an identical mechanism. We also observed that all but one rat treated with mTTR.UGT1A1.142T did not develop antibodies to UGT1A1. The presence of anti- bodies in the mTTR.UGT1A1.142T-injected rats did not preclude a sustained and complete correction, as also reported by others.32This is probably due to the fact that UGT1A1 is an intracellular protein located in the micro- somal compartment and may be out of reach of circulat- ing antibodies.

Using miRNA target sequences to regulate the speci- ficity of transgene expression in various cell populations does not modify the endogenous amount of miRNAs when few copies of the target sequence are present. This is indeed the case for miR-142, for which saturation of endogenous level was only achieved with 10 copies of a lentiviral vector carrying the miR-142T under control of a strong ubiquitous SFFV promoter.33 Because it is un- likely that in vivo delivery of lentiviral vector may achieve such a high level of transduction, we believe that using endogenous miRNA regulation may be of clinical rele- vance for future application of lentiviral vectors for the treatment of liver genetic diseases. This might be decisive progress toward clinical trials in patients with CN-I using our designed miR-142–regulated lentiviral vector. We are now currently validating this strategy in nonhuman pri- mates before considering a clinical application.

Supplementary Material

Note: To access the supplementary material accompanying this article, visit the online version of Gastroenterology at www.gastrojournal.org, and at doi:

10.1053/j.gastro.2010.05.008.

References

1. Nguyen TH, Ferry N. Gene therapy for liver enzyme deficiencies:

what have we learned from models for Crigler-Najjar and tyrosine- mia. Expert Rev Gastroenterol Hepatol 2007;1:155–177.

2. Bellodi-Privato M, Aubert D, Pichard V, et al. Successful gene therapy of the Gunn rat by in vivo neonatal hepatic gene transfer using murine oncoretroviral vectors. Hepatology 2005;42:431–

438.

3. Nguyen TH, Bellodi-Privato M, Aubert D, et al. Therapeutic lenti- virus-mediated neonatal in vivo gene therapy in hyperbiliru- binemic Gunn rats. Mol Ther 2005;12:852– 859.

4. Toietta G, Mane VP, Norona WS, et al. Lifelong elimination of hyperbilirubinemia in the Gunn rat with a single injection of helper- dependent adenoviral vector. Proc Natl Acad Sci U S A 2005;102:

3930 –3935.

5. Nguyen TH, Mainot S, Lainas P, et al. Ex vivo liver-directed gene therapy for the treatment of metabolic diseases: advances in hepatocyte transplantation and retroviral vectors. Curr Gene Ther 2009;9:136 –149.

6. Aubert D, Menoret S, Chiari E, et al. Cytotoxic immune response blunts long-term transgene expression after efficient retroviral- mediated hepatic gene transfer in rat. Mol Ther 2002;5:388 – 396.

7. Puppi J, Guillonneau C, Pichard V, et al. Long term transgene expression by hepatocytes transduced with retroviral vectors re- quires induction of immune tolerance to the transgene. J Hepatol 2004;41:222–228.

8. Brown BD, Venneri MA, Zingale A, et al. Endogenous microRNA regulation suppresses transgene expression in hematopoietic lineages and enables stable gene transfer. Nat Med 2006;12:

585–591.

9. Wulf-Goldenberg A, Eckert K, Fichtner I. Cytokine-pretreatment of CD34() cord blood stem cells in vitro reduces long-term cell engraftment in NOD/SCID mice. Eur J Cell Biol 2008;87:69 – 80.

10. Peche H, Trinite B, Martinet B, et al. Prolongation of heart allo- graft survival by immature dendritic cells generated from recipi- ent type bone marrow progenitors. Am J Transplant 2005;5:255–

267.

11. Brown BD, Cantore A, Annoni A, et al. A microRNA-regulated lentiviral vector mediates stable correction of hemophilia B mice.

Blood 2007;110:4144 – 4152.

12. Bovia F, Salmon P, Matthes T, et al. Efficient transduction of primary human B lymphocytes and nondividing myeloma B cells with HIV-1-derived lentiviral vectors. Blood 2003;101:1727–

1733.

13. Nguyen TH, Birraux J, Wildhaber B, et al. Ex vivo lentivirus trans- duction and immediate transplantation of uncultured hepato- cytes for treating hyperbilirubinemic Gunn rat. Transplantation 2006;82:794 – 803.

14. Black M, Billing BH, Heirwegh KP. Determination of bilirubin UDP-glucuronyl transferase activity in needle-biopsy specimens of human liver. Clin Chim Acta 1970;29:27–35.

15. Marcos R, Monteiro RA, Rocha E. Design-based stereological estimation of hepatocyte number, by combining the smooth op- tical fractionator and immunocytochemistry with anti-carcinoem- bryonic antigen polyclonal antibodies. Liver Int 2006;26:116 – 124.

16. Seglen PO. Preparation of rat liver cells. 3. Enzymatic require- ments for tissue dispersion. Exp Cell Res 1973;82:391–398.

17. Sauter BV, Parashar B, Chowdhury NR, et al. A replication-defi- cient rSV40 mediates liver-directed gene transfer and a long-term amelioration of jaundice in Gunn rats. Gastroenterology 2000;

119:1348 –1357.

18. Seppen J, van der Rijt R, Looije N, et al. Long-term correction of bilirubin UDP-glucuronyltransferase deficiency in rats by in utero lentiviral gene transfer. Mol Ther 2003;8:593–599.

19. Thummala NR, Ghosh SS, Lee SW, et al. A non-immunogenic adenoviral vector, coexpressing CTLA4Ig and bilirubin-uridine- diphosphoglucuronateglucuronosyltransferase permits long-term, repeatable transgene expression in the Gunn rat model of Crigler- Najjar syndrome. Gene Ther 2002;9:981–990.

BASIC–LIVER,PANCREAS,ANDBILIARYTRACT

(9)

20. Loduca PA, Hoffman BE, Herzog RW. Hepatic gene transfer as a means of tolerance induction to transgene products. Curr Gene Ther 2009;9:104 –114.

21. Jooss K, Yang Y, Fisher KJ, et al. Transduction of dendritic cells by DNA viral vectors directs the immune response to transgene products in muscle fibers. J Virol 1998;72:4212– 4223.

22. Brunetti-Pierri N, Ng P. Progress and prospects: gene therapy for genetic diseases with helper-dependent adenoviral vectors. Gene Ther 2008;15:553–560.

23. Nguyen TH, Aubert D, Bellodi-Privato M, et al. Critical assessment of lifelong phenotype correction in hyperbilirubinemic Gunn rats after retroviral mediated gene transfer. Gene Ther 2007;14:

1270 –1277.

24. Nguyen TH, Oberholzer J, Birraux J, et al. Highly efficient lentiviral vector-mediated transduction of nondividing, fully reimplantable primary hepatocytes. Mol Ther 2002;6:199 –209.

25. Arumugam PI, Higashimoto T, Urbinati F, et al. Genotoxic poten- tial of lineage-specific lentivirus vectors carrying the beta-globin locus control region. Mol Ther 2009;17:1929 –1937.

26. Hacein-Bey-Abina S, Garrigue A, Wang GP, et al. Insertional on- cogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. J Clin Invest 2008;118:3132–3142.

27. Montini E, Cesana D, Schmidt M, et al. The genotoxic potential of retroviral vectors is strongly modulated by vector design and integration site selection in a mouse model of HSC gene therapy.

J Clin Invest 2009;119:964 –975.

28. Seppen J, van Til NP, van der Rijt R, et al. Immune response to lentiviral bilirubin UDP-glucuronosyltransferase gene transfer in fetal and neonatal rats. Gene Ther 2006;13:672– 677.

29. Themis M, Waddington SN, Schmidt M, et al. Oncogenesis fol- lowing delivery of a nonprimate lentiviral gene therapy vector to fetal and neonatal mice. Mol Ther 2005;12:763–771.

30. Podevin G, Otta E, Nguyen JM, et al. Factors influencing immune response after in vivo retrovirus-mediated gene transfer to the liver. J Gene Med 2004;6:16 –21.

31. Annoni A, Brown BD, Cantore A, et al. In vivo delivery of a microRNA-regulated transgene induces antigen-specific regula- tory T cells and promotes immunologic tolerance. Blood 2009;

114:5152–5161.

32. Seppen J, Bakker C, de Jong B, et al. Adeno-associated virus vector serotypes mediate sustained correction of bilirubin UDP glucuronosyltransferase deficiency in rats. Mol Ther 2006;13:

1085–1092.

33. Gentner B, Schira G, Giustacchini A, et al. Stable knockdown of microRNA in vivo by lentiviral vectors. Nat Methods 2009;6:

63– 66.

Received September 14, 2009. Accepted May 11, 2010.

Reprint requests

Address requests for reprints to: Tuan Huy Nguyen, PhD, INSERM Unité 948, Biothérapies Hépatiques, CHU Hotel Dieu, 44093 Nantes Cedex, France. e-mail:[email protected].

Acknowledgments

N.F. and T.H.N. contributed equally to this work.

Conflicts of interest

The authors disclose no conflicts.

Funding

Supported by grants from the Association Française contre les Myopathies (to A.M.) and the Association Francophone des Glycogénoses. M.F. received a fellowship from A.F.M.

BASIC–LIVER, PANCREAS,AND BILIARYTRACT

(10)

Supplementary Figure 1. Off-target transgene expression from a liver-specific promoter in rat hematopioietic cells. (A) NR8383 rat macrophage cells and (B) Gunn rat dendritic cells were transduced with lentiviral vectors encoding GFP under the control of the mTTR promoter at a MOI of 1 or 10 and 20, respectively before FACS analysis. The percentage of GFP-positive cells and mean intensity of fluorescence are indicated in the lower right corner of each plot. Control infections were done with medium only (mock). Significant expression of GFP was observed from the liver-specific lentiviral vector in transduced rat hematopoietic cells.

(11)

Supplementary Figure 2. Hematoxylin and eosin stainings of paraffin-embedded liver sections of non-injected Gunn rat (left) and Gunn rat that has been injected with mTTR.hUGT1A1 vectors (right) at month 6 post-vector delivery.

Supplementary Table 1. Evaluation of Vector Dissemination in Various Organs

Rat #91 #92 #93 #138 #140

Liver 0.4839 0.2644 0.3944 0.7344 2.0735

Kidney 0 0 0 0 0

Intestine 0.0027 0.0019 0 0.0035 0

Spleen 0.0178 0.031 0.0294 0.0976 0.0221

Testis 0 0 0 0.0031 0

Lung 0 0 0.0099 0.0428 0

Heart 0 0 0 0 0

NOTE. Real-time quantitative PCR was performed on total DNA extracted from various organs from mTTR.hUGT1A1.142T-injected Gunn rats at 6 months post-vector delivery, as described in Materials and Methods. The number of vector copies per haploid genome is shown for individual animals.

Références

Documents relatifs

Abstract Despite one and a half decade of research and an impressive body of knowledge on how to represent and process musical audio signals, the discipline of Music

Then, impact on formulations of usual WEEE (Waste of Electric and Electrical Equipment) plastics were evaluated, with PE, PP, ABS and HIPS as matrices, and carbon black (at di

Dans notre recherche, nous tentons, d’une part, de cerner les besoins des étudiants qui sont en fin de leur cursus universitaire, de la filière de « droit et sciences

Similarly, we used a multiple linear regression model of the entire cohort that included the variables signif- icantly associated with miR-126 expression in univariate analysis;

Minimum energy path (MEP) calculations of the lowest-lying triplet state are used to find the most favorable path connecting the key structures that mediate the excited-state decay,

7-Relationship between applied vertical stress and change in void ratio for incremental and constant rate of loading tests... loading together with the significant

ENGINEERING GEOLOGY_A FIFTY YEAR REVIE'V 545 than doubled since 1939, a year which has already been seen to have been almost a turning point in the development of

In the cases of Plummer distributions with half the total mass in the common background halo, the projected density profile of the giant galaxy does not follow the r 1/4 law at