• Aucun résultat trouvé

Genetic basis for expression of the idiotypic network. One unique Ig VH germline gene accounts for the major family of Ab1 and Ab3 (Ab1') antibodies of the GAT system

N/A
N/A
Protected

Academic year: 2021

Partager "Genetic basis for expression of the idiotypic network. One unique Ig VH germline gene accounts for the major family of Ab1 and Ab3 (Ab1') antibodies of the GAT system"

Copied!
16
0
0

Texte intégral

(1)

HAL Id: hal-02931694

https://hal.inrae.fr/hal-02931694

Submitted on 7 Sep 2020

HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

Genetic basis for expression of the idiotypic network.

One unique Ig VH germline gene accounts for the major family of Ab1 and Ab3 (Ab1’) antibodies of the GAT

system

Claudine Schiff, Michèle Milili, Isabelle Hue, Stuart Rud1koff, Michel Fougereau

To cite this version:

Claudine Schiff, Michèle Milili, Isabelle Hue, Stuart Rud1koff, Michel Fougereau. Genetic basis for expression of the idiotypic network. One unique Ig VH germline gene accounts for the major family of Ab1 and Ab3 (Ab1’) antibodies of the GAT system. Journal of Experimental Medicine, Rockefeller University Press, 1986, 163 (3), pp.573-87. �10.1084/jem.163.3.573�. �hal-02931694�

(2)

G E N E T I C B A S I S F O R E X P R E S S I O N O F T H E I D I O T Y P I C N E T W O R K

O n e U n i q u e Ig VH G e r m l i n e G e n e A c c o u n t s f o r t h e M a j o r Family o f A b l a n d A b 3 ( A b l ') A n t i b o d i e s o f t h e G A T S y s t e m

BY CLAUDINE SCHIFF, MICHELE MILILI, ISABELLE HUE, STUART RUD1KOFF,* AND MICHEL FOUGEREAU

From the Centre d'Immunologie, Institut National de la Santd et de la Recherche Mddicale-Centre National de la Recherche Scientifique de Marseille-Luminy, Case 906, 13288

Marseille cddex 9, France; and the *Laboratory of Genetics, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20205

T h e idiotypic network as proposed b y J e r n e (1), and first approached by serial immunizations performed in discrete animals (2-5), may be most simply written as a cascade Ag --~ Abl ~ Ab2 --~ Ab3 . . . in which Ag represents the original immunizing antigen, A b l the responding antibody (idiotypic set), which, in turn, may elicit the synthesis of Ab2, or antiidiotypic antibodies. Jerne et al. (6) more recently proposed that Ab2 could be divided into Ab20~, or true antiidiotypic antibodies, which recognize the A b l idiotopes, and Ab2/3, complementary to the Abl paratope, and that thus appear as representing an internal image of the original antigen. T h e concept of internal image is crucial to account for the emergence, among Ab3 antibodies, o f a population o f molecules resembling Abl in that they may recognize the original antigen (Ag), besides expressing idiotopes o f A b l . They are generally termed A b l ' . In addition, Ab2e have also been described as epibodies (7), which are able to recognize both the original antigen and the A b l idiotopes.

A major issue concerns the physiological role o f the idiotypic network. It may regulate the production of a given family of antibodies as a result of the perturbation introduced by a foreign antigen (1). Idiotypic manipulations leading either to activation or suppression o f one member o f the cascade have been extensively documented (3-6, 8; see also 9 for a review). More profound may be the idea, centered on the internal image, that the idiotypic network may find its major physiological significance in playing a key role in the emergence of the antibody repertoire, and thus contribute essentially as an internal selective pressure that would allow Ig germline genes to have evolved to recognize a huge array of potential epitopes (1, 3, 4). The first requirement for the idiotypic network to play such a role is to prove that the cascade may spontaneously occur within one single animal. This was first shown in the mouse for the PC system (10). Experimental models have largely made use of inbred strains of mice, and This work was supported by the Centre National de la Recherche Scientifique and the Institut National de la Sant6 et de la Recherche M~dicale.

J. Exv. MED. © The Rockefeller University Press • 0022-1007/86/3/0573/15 $1.00 573 Volume 163 March 1986 573-587

(3)

574 A N T I - G A T Ig Vn GERMLINE GENE

of a number of rather simple antigens, allowing the production of antibodies expressing public or crossreactive idiotypes. Among the more extensively studied, the ARS (5), dextran (DEX) I (11), PC (12), 4-(hydroxy-4-nitrophenyl)acetyl (NP) (13), DNP (14), levane (15), and G A T (16, 17) have been largely documented, both from regulation and structural standpoints (see 9 and 18 for reviews).

We have been investigating the structural and genetic basis for the entire idiotypic cascade obtained in a syngeneic situation in the BALB/c mouse with GAT, which elicits, in a number of strains of mice, anti-GAT antibodies, the majority of which express public idiotypic specificities, termed C.GAT (16) or p G A T (17). The presence of this idiotype correlates strongly with a preferential recognition of the Glu-Tyr-containing epitopes (19), and the expression of the idiotypic specificities requires both the Abl H and L chains (20). Hybridomas have been isolated for each of the A b l , Ab2, and Ab3 levels of this idiotypic cascade in BALB/c mice (21-23). Nucleotide sequencing of H and L m R N A (24, 25) and cDNA, and Southern blot analysis (26, 27) revealed that expression of the p G A T specificities in A b l strongly correlated with the presence of conserved Vn and V~ sequences, an observation compatible with the use of a very small number of germline genes. More recently, similar analyses, effected at the Ab3 level, indicated that A b l ' molecules also made use of the same small set of germline genes, both for the H and the L variable regions (28). In this paper, we report the isolation and sequencing of three closely related Vn germline genes, from which one single gene accounts for expressed Vu sequences o f the G A T A b l / A b l ' antibodies that were previously reported (24, 26, 28).

Materials a n d M e t h o d s Hybridomas

Hybridomas of the Abl series (G7 and G8) were derived from fusions using spleen cells of BALB/c mice immunized with GAT coupled to KLH, and the X63-Ag8-653 cell line, as previously described (21).

Isolation of Cellular DNA

BALB/c cellular DNA was extracted from adult liver and hybridomas, according to Gross-Bellard et al. (29).

Southern Blot Analysis

Southern blot analysis (30) was performed on 15 t~g samples of EcoRI-digested DNA.

Hybridization after transfer to nitrocellulose was made with a JH probe in 2x SSC, 10x Denhardt's solution, 0.1% SDS, and 50 t~g/ml salmon sperm DNA, at 65°C for 48 h, followed by washings in 2x SSC in Denhardt's solution and 0.2x SSC, at the same temperature.

The P5JH probe was a kind gift of P. Legrain (31), and consists of the Barn HI-Eco RI fragment emcompassing the 3' end of the Jn cluster, containing the Jn3 and Jn4 cod- ing fragments. It was originally derived from the 6.2 kb probe pRI-JH (32). The probe

8 7

was nick-translated to asp act of 2 x 10 cpm/t~g, of which 3.6 x 10 cpm were used in 8 ml of hybridization buffer.

Construction of Genomic Libraries

Restricted libraries. As previous work indicated (26), BALB/c Eco RI restriction fragments that specifically hybridized with an anti-GAT cDNA Vn probe were identified at about 7.5, 7.0, 4.3, and 3.2 kb. Materials containing 4.3 and 3.2 kb Eco RI restriction

i Abbreviations used in this paper: DEX, dextran; NP, (4-hydroxy-3-nitrophenyl)acetyl.

(4)

SCHIFF ET AL. 5 7 5 fragments were isolated after centrifugation (41,000 g for 4 h at 20°C in a Beckman SW 41 rotor) in a sucrose gradient (5-20%), and ligated at Eco RI sites of pBR328 using T4 ligase. Transformation was performed according to Hanahan (33). Cells were directly plated on Millipore Triton-free nitrocellulose filters (Millipore S. A., Molsheim, France) in standard Petri dishes at high density (~10,000 colonies per filter), as described by Hanahan and Meselson (34).

Complete library. BALB/c liver DNA was partially cleaved with Mbo I, and centrifuged in a sucrose gradient (10-40%) in a Beckman SW 27 rotor, at 27,000 g for 22 h at 20°C.

Fractions sizing between 15 and 20 kb were pooled, inserted at the Barn HI restriction site of EMBL 3 phage as described by Maniatis et al. (35), and encapsidated using a ;~

DNA in vitro packaging kit (Amersham France).

GAT-specific Vn probes. Libraries were screened either with a nick-translated s~p_

labelled GAT-specific Vn cDNA (HIV.92, a 230 bp Pst I fragment encoding amino acids 4-81 [26]), or with a 780 bp Hinc II restriction fragment derived from a germline gene (clone H4a-3) starting 174 bp 5' upstream of the leader segment (see Fig. 1). The hybridization was made at 65 °C in 4x SET, 2X Denhardt's, 0.2% SDS, and the washings were done in 3x SET (20× SET is 3 M NaCI, 0.04 M EDTA, 0.6 M Tris, pH 8.0), 0.2%

SDS followed by 0.5× SET, 0.2% SDS at the same temperature.

Subcloning into M 13 vector. Double-stranded (RF) mp 8 vector (36) was digested with Sma I and iigated with T4 ligase to recombinant DNA digested with Hae III or Alu I.

Colonies of transformed bacteria (JM 101) were screened with either of the above VH probes.

DNA sequencing. Nucleotide sequences were determined by the dideoxy chain termi- nator procedure of Sanger et al. (37), using the M 13 universal primer (Amersham Corp.), and DNA polymerase Klenow fragment (Bethesda Research Laboratories, Herblay, France).

R e s u l t s

Screening of Genomic Libraries and Characterization of GAT-related VI~ Germline Genes. O n the basis o f previous work (26), it was k n o w n that G A T - r e l a t e d Vn g e r m l i n e genes would be identified within Eco RI inserts having a size o f 3,2, 4.3, 7.0, a n d / o r 7.5 kb. In addition, m R N A (24) o r c D N A (26) nucleotide s e q u e n c e data revealed the existence o f a characteristic 230 bp Pst I f r a g m e n t located within the c o d i n g region (codons 4 - 8 1 ) . T h e s e two criteria were used to select potential GAT-specific VH genes a m o n g r e c o m b i n a n t clones that gave a s t r o n g positive signal with the c D N A H IV.92 probe.

O u t o f the 7,000 r e c o m b i n a n t clones o b t a i n e d f r o m the 4.3 kb Eco R I - r e s t r i c t e d library, t h r e e gave a positive signal in stringent conditions, f r o m which o n e clone, t e r m e d H4a-3 m e t the a b o v e r e q u i r e m e n t s . T h e two o t h e r 4.3 kb Eco RI inserts gave fainter signals a n d did not contain the characteristic 230 bp Pst I fragments. A restriction m a p o f this clone is given in Fig. I, as well as limits o f the p r o b e that was d e r i v e d f r o m it and used to screen the c o m p l e t e E M B L 3 library. O u t o f a total o f 1.4 × 106 n o n a m p l i f i e d r e c o m b i n a n t clones r e p r e s e n t i n g two to t h r e e times the m o u s e g e n o m e , 200 positive plaques were harvested, f r o m which the 47 that gave the strongest signals were replated and serially screened.

A f t e r the f o u r t h screening, clones were divided into two groups, on the basis o f the intensity o f the hybridization signal. Only the g r o u p (composed o f 24 m e m b e r s ) that gave consistently a very s t r o n g signal was then extensively analyzed by restriction mapping. Five clones had the r e q u i r e d e x p e c t e d Eco RI a n d Pst I restriction sites. T w o c o n t a i n e d a 4.3 kb Eco RI f r a g m e n t that possessed restric- tion f r a g m e n t s (Eco RI; Eco RI + H i n d III; Hinc II; Hinc II + Stu I; Pst I) that

(5)

576

H 4a.3 T

A N T I - G A T Ig VH GERMLINE GENE

T Tr

' v . probe'

.,o T Y T T ; i"fT T

T ... T ... T

ECo R I ~" Hinc I 1' Barn H 1 ]~ Pst I 1" Stu ]

'~ Pvu [ ? Hind

FIGURE 1. Restriction maps of the three VH germline Eco RI fragments derived from clones that specifically hybridized with a GAT-specific VH probe. H4a-3, H10, and H2b-3 Eco RI fragments were 4.3, 3.2, and 7.6 kb, respectively.

hybridized with the VH probe as depicted in Fig. 1, and which were characteristic of the H4a-3 gene. It was thus assumed that these clones were identical to H4a- 3. T h r e e had the 3.2 kb Eco RI fragment and the same restriction map in the coding region, described as the H 10 prototype in Fig. 1. Within each group, the respective Eco RI fragments were contained in overlapping inserts having lengths between 15 and 20 kb. T h e 19 remaining clones did not meet completely the aforementioned requirements. Taking into account other restriction sites that could be defined in the H4a-3/H10 family (Stu I, Hinc II, Pvu II), five clones were still considered potential candidate.

Finally, an Eco RI fragment with a size of 7.6 kb, termed H2b-3 (Fig. 1) was identified in one of the nine positive clones from another restricted library that yielded 50,000 clones. T h e eight remaining positive clones gave only faint signals when high stringency was used for hybridization.

Nucleotide Sequences. T h e H4a-3, the three genes of the H 10 group, the H2b- 3, and the five potential anti-GAT candidates were sequenced by the Sanger method. Hae III and Alu I subclones were prepared in the M13 vector, and those containing coding and immediate flanking regions were selected and sequenced according to the strategy depicted in Fig. 2. T h e three genes of the H 10 group had identical sequence referred to as the H 10 prototype. Sequences of H 10, H4a-3, and H2b-3 were highly homologous (Fig. 3) and could be closely related to anti-GAT Abl sequences. All three genes exhibited characteristic features of the VnII family (38), including organization of the 5' noncoding region, high homology of the leader and coding region, and conservation in length and homology of the first intron (39). T h e homology between the three genes was >95%, whichever leader, intron, or main coding region was consid- ered. T h e five remaining clones also pertained to the VHII family, but their sequences were only 80-85% homologous to that of the anti-GAT family (data not shown).

Southern Blot Hybridization of GaT-specific Hybridoma DNA with Specific Jn Probe. BALB/c mouse liver DNA and GAT-specific Abl hybridoma DNA (G8 Ca 1.7 and G7 Ab 2.9) Eco RI fragments were analyzed by Southern blot hybridization with a specific JH probe (Fig. 4). The unrearranged 6.4 kb Eco RI

(6)

SCH1FF ET AL. 5 7 7

H4a_3 '~ -- f ~f f? f

H 2 b _ 3 - - ? ~ ~ ?

~' H a e ] l f A r u Z

F]GIJ~E 2. Strategy used for M 13 subcloning and nuc]eotide sequence determination (Sanger dideoxy method).

H 10 ~QCC~TT~T~TT~&A~ATATATG&GAGAA~&TTQCT~ACTC~C&TAA~T~TATTGGT~TT~T~TTTAA~TTTCCAGTA~GT~A~C'CTCATTGCT~CTACCA

H 4 1 - 3 . . . C . . . A - - T C - A G - O . . . A - A . . . A - - T . . . A - 8 . * . . . + o . . - . . . 0 . . . C - A - : T - - T . . . T - - - k - -

H 1 0 C C A A T C A A T T T T T T C A C T A A G A C A A ~ T O A G T G T C T C A G O T T A G G A T T C T A T T T T A * * A G A T T O ~ G A T A T T A ~ i G C T T G A T A C T A C A T C T A A A T O G T C T G T A C , T G T C H 4 a ' 3 . . . A . . . * 0 . . . . C - - - T ' . . . T O A - A - A - - - A - O . . . T - G T . . . G . . . C . . .

H 1 0 TCGAA~J~AAGTTCTTCABAC`GA~TTA8GA~TT~GATCCCA~AGTTAG~ACTTOQACTGACTCAO~A~GACTCT~6TTTCTTCTTCTCCAGCTG~ATGTCCTT`

H 4 1 - 3 - - A G O . . . C - A . . . A . . . T . . . . T C . . . C - * - * C C * T G - - o . . . C . . . . T - C . . . . A - C - - C . . . ~ . . . C A . . . T . . . .

H 2 b - 3 . . . . k - - - C A . . .

H | 0 TOT,AGAAAAOCCTTGCCTCATnAoT A T O C A A A T C A T G T Q C G A C T O T G A T O ~ A G O G A T , T C C A C A C C A A A C A T C A T A T G A G C C C T A T C T T C T C T , . . . 6 A T - C . . . A . . . ° . . . . ° . A - T . . . T I - - ~ - - - - C c I - - A . . . T . . . A - T . . . A - - G - T . . . 2 b - 3 . . . G A T - C . . . . , . . . A - - - . . A - T . . . T G T - C . . . A . . . A - A - - G - T . . .

- 1 9 G 4 /

H 1 0 C A G A C A C T G A A T C T C ' A G G T C O T T A C A ATO A A A T G C A O C T O G G T T A T C T T C ' r T C C T O A T G O C A G T O G T T , C A G T A , G G G G C T C C C A H 4 " - 3 - - - T . . . C . . . / . . . A . . . H 2 b - 3 - - - T . . . C . . . T - - / . . .

- 4 1

H 10 AGTCCCAAACTTOAOGOTCCATAAACTCTGTOACAGTOGCA~TCACTTTGCCTTTCTTTOTACAG / 0 G G T C A A T T C A G A G G T T C A Q C T G C A G C A G H 4 a - 3 . . . 0 . . . C . . . 6 . . . / . . . H 2 b - 3 . . . O - - - C - C . . . T . . . / - ' A . . .

1 0 2 0 3 0

H 1 0 "TO1 G O 0 6 C A IBAO C T T O T O ' A O C C ' E G G GCC T C A G T C A A G T T O T C C T G C A C A O C T T O T G O C T T C A A C A T T A A A G A C A C C HH 4 1 ) - 3 . . . T . . . G . . . T . . . A . . . T A - 2 b - 3 . . . G - T . . . T A -

4 0 5 0

H 1 0 T A T A T O C A C T ~ B O T G A A O C A B A G O C O T O A k C A G G ( ; C C T G G A G T O O A T T G O A A G O A T T O A T C T G C O A A T G O T A A T A C T H 4 , - 3 . . . T . . . A . . . H 2 b - 3 . . . T . . . A . . . ~ . . .

b O ? 0 GO

H 1 0 A A A T A T G ' C C C G A A G T T C C ' G GOC A ' G QCC A C T A T , ' C A G C A Q A C ' C A T C C T C C , A C ' C A GCC T A C C T G C A G C T C ' 6 C H 4 • - 3 - T . . . G . . . H 2 b - 3 O . . . ¢ . . . G - - T . . .

b c 9 0

A G O C T G A C ' T C T G A G O ' C A C T G C C G T C T A T T A C T O T G O T A G A T T G C A A C C A C A T C C T G A G G T G T T A O , A C H 4 , - 3

x 2b-~ - 2 - -'_2 - - 2 2 - - . -_-2 -_2-_ - - - -_2- - - - - - - "_-2 --.- ~-~- ;~2 222222222::22-2222, 2:~

H 1 0 TGCAGGRAGCTGCCTGAGACTGAGRTGAC'GACAATATTATTGTGTTAGCT

HH 4 a - 3 C . . . . .. . . CC--'AGAT-TTCTCAGi~AATAGCC,TTTTGTGAGCCTGCCTATCTACAGTTTTAAATGCTAT 2 b - 3 . . .

FIGtml~ 3. Nucleotide sequences of the three V. germline genes, partially encompassing 5' and 3' noncoding regions. Numbering of the coding region is that of Kabat et al. (38).

Regulatory signals are boxed.

f r a g m e n t c o n t a i n i n g all JH sequences was present in all tracks, an observation compatible both with the g e r m l i n e organization o f liver D N A and the contribu- tion o f the parental X 6 3 . A g S . 6 5 3 cell line D N A (40). Interestingly, a n o t h e r b a n d c o r r e s p o n d i n g to the V-D-J r e a r r a n g e m e n t was o b s e r v e d at the same position (3.6 kb) f o r the two h y b r i d o m a DNA. As it was previously shown that b o t h G8 Ca 1.7 and G7 Ab 2.9 used Jr~4 (24), this was strongly suggestive that they used the same VH g e r m l i n e gene.

(7)

578 ANTI-GAT lg VH GERMLINE GENE

FIGURE 4. Southern blot of Eco RI DNA restriction fragments from (a) adult BALB/c liver, (b) G7 Ab 2.9, and (c) G8 Ca 1.7 GAT-specific hybridomas. Hybridization was performed using the p5 Ju probe. Arrows indicate the origin.

Discussion

Most antibodies prepared in various strains of mice against the random terpolymer GAT express a public idiotype (16, 17), which presumably contains a mosaic of idiotopes, to which epitopes 20 a n d / o r 22 may be associated (22).

Amino acid, mRNA, and cDNA nucleotide sequence determination effected on a collection of BALB/c anti-GAT hybridomas clearly suggested that the GAT- specific, p G A T + antibodies (Ab 1) were encoded by a very small number of Vn and V~ germline genes (24-27). T h e H chains seemed to use one or very few germline Vn, preferentially associated with JH4. T h e D region, using either a partially mutated D.SP2 or FL.16 gene, had interesting features (presence of aromatic and positively charged amino acids) that suggested it might be involved in G A T recognition. When Ab3 antibodies were produced by injecting mono- clonal Ab2, a large proportion were found to express the pGAT public specific- ities (Abl'), some of which were, in addition, G A T specific. This could be predicted from the essence of the idiotypic network and from the suggestion that an internal image-like structure was present in the D region of the Ab2 mAb (41). T h e expression of the p G A T idiotypic specificities by A b l ' strictly correlated with the presence of VH and V~ sequences that were very close, if not identical, to that of the Abl prototype (G8 Ca 1.7). T h e presence of these V region sequences was not sufficient, however, to insure GAT recognition, which was shown to be highly dependent upon the structure of the D region (28). If one considers that V germline genes may be selected in evolution as a conse- quence of a physiological role of the immune network (42), one should expect to induce germline genes more efficiently with Ab2 immunization than with the corresponding antigen.

(8)

SCHIFF ET AL. 579 General Features of GAT-related VH Germline Genes. We have isolated and characterized seven clones that contained the characteristic Pst 1 230 bp fragment predicted from the nucleotide sequence o f the coding region and possessing the Eco RI fragments of expected sizes (i.e., 3.2, 4.3, and 7.6 kb) that specifically hybridized in Southern blot analysis with VH GAT-specific probes, using stringent conditions.

These clones were assigned to three distinct, strongly homologous sequences, identified as HI0, H4a-3, and H2b-3, corresponding to clones containing the expected Eco RI fragments of 3.2, 4.3, and 7.6 kb, respectively. T h r e e clones expressing the H 10 sequence were independently isolated and sequenced. T h r e e clones were assigned to the H4a-3 prototype on the basis of a very detailed restriction map. A unique clone containing the H2b-3 gene was isolated. Using the same probe and the same hybridization conditions, 19 other related VH genes have been isolated and characterized by restriction mapping analysis. Five of them have been sequenced and differed rather extensively from the anti-GAT- related genes.

Nucleotide sequence o f the three clones H4a-3, H10, and H2b-3 (Fig. 3), indicated that they all pertained to the VHII family (38), within which they represent a highly homologous subfamily. Strong homology (constantly >95%) begins in the section starting at the initiation codon and extends downstream to the 3' noncoding region. T h e conservation o f the leader segment and that of the first intron is especially striking. T h e length of this intron has already been reported as characteristic of the family (39, 43). All three genes have an open reading frame in the coding regions, and appear potentially functional, with a possible T A T A box (44) starting about 78 bp 5' upstream of the initiation codon, and a highly conserved element (45, 46), reading A T G C A A A T C A , which has been recently reported to control cell type specificity of transcription (47).

T h e nucleotide sequence of the three germline genes were then compared with cDNA (26) or mRNA (24) sequences o f Abl (G series) and A b l ' (28) (20 and 22 series) monoclonal VH sequences (Fig. 5). Main characteristics of Ab 1/Ab 1' mAb are given in Table I.

One Single VH Germline Gene Accounts for H Chain V Regions of Expressed Anti- GAT (pGAT +) Abl Antibodies in BALB/c Mice. T h e most striking feature noted was that the anti-GAT (Abl) VH cDNA sequence of G8 Ca 1.7 (26) was completely identical to that of the H 10 germline gene. As previously reported (24) mRNA nucleotide sequences of G8 Ca 1.7 and G5 Bb 2.2 were also completely identical, demonstrating that the same germline gene was employed in two hybridomas derived from separate fusions. Incidentally, the mRNA sequence previously reported (24) for codon 14 should read CCA, and not CCT, in agreement with results derived from cDNA sequencing (26).

A substitution of A ~ G was observed between H 10 and most of the expressed VH at the last position of the V region. This may be explained on the basis of V- D joining, and the inclusion of a G residue as the result of terminal transferase activity, as suggested by Alt and Baltimore (32), regarding the N-diversity.

T h e two remaining Abl anti-GAT antibodies (with a slight uncertainty due to the lack of nucleotide sequence for the first eight codons, which expressed

(9)

580 A N T I - G A T lg Vn GERMLINE GENE

H 1 0 4 g - 3 2 b - 3 0 8 C , 1 o 7 8 5 3 6 2 . 2 8 7 A b 2 * 9 8 8 A d 3 . B

1 1 0 2 0

G A G 8 T T C A 8 C T 8 C R G C A 8 T C T 8 0 8 8 C A G A G C T T 8 T 8 A R G C C R G B G 8 C C T C A 8 T C A A 8 T T G T C C T G C A C R G C T T C T . . . T . . . 8 . . . T . . . A . . . . . . 8 - T . . . . . .

. . . . . . T . . . . . .

H 1 0 H 4 a - 3 H 2 b - 3 8 8 C , 1 . 7 G S B b 2 . 2 8 7 A b 2 o 9 8 8 ~ d 3 . s 2 2 . 8 2 2 . 1 7 6 2 0 . 1 1 2 2 . 1 8 6

3 0 4 0 5 0

G G C T T C R A C R T T R A A G A C & C C T A T & T O C R C T 8 8 Q T G R A G C R G ~ G G C C T B & A C A 8 G G C C T G G A G T G G A T T 8 0 ~ R G G . . . T A . . . T - - . . . T A . . . T - - . . . ~ . . . . . . . . . A . . . ~ . . . . . . T . . .

. . . . . . . . . X . . .

. . .

H 1 0 H 4 8 - 3 H 2 b - 3 8 8 C , 1 o 7 8 5 B b 2 . 2 8 7 R b 2 . 9 8 8 R d 3 . B 2 2 . 8 2 2 . 1 7 6 2 0 * 1 1 2 2 . 1 8 6 2 0 . 3 3 2 0 ° 8

6 0 7 0

A T T B A T C T 0 C 0 A A T G G T A R T A C T ~ R & T R T O A C C C O & A B T T C C A B 0 0 C A A G B C C A C T A T A & C A G C A G & C A C A T C C . . . & . . . T . . . 6 . . . . . . & . . . G . . . G . . . C . . . 8 - - T . . . . . . . . . . . . X & . . . 8 . . . 8 . . . X X . . . . R . . .

. . . . . . . . . T . . . G . . . G - - 8 X . . . . . . X . . . . . .

. . .

H $ 0 H 4 1 - 3 H 2 b - 3 0 8 C a 1 . 7 6 5 B b 2 . 2 0 7 & b 2 . ? 0 0 R d 3 ° E 2 2 * 0 2 2 ° 1 7 6 2 0 . 1 1 2 2 . 1 8 6 2 0 , 3 3 2 0 * B

8 0 a b ¢ 9 0

T C C R A C A~:'R 8 C ~ T A C C , T ~ C ~ C T ~ A ] 3 C f k O C C T G R C A T C T G ~ Q G & C ' ~ C T G r ' C G T C T A T TWC T G T ~ T A G R . . . . . . A ~ - G C - . . . 6 . . . G . . . . 0 - 0 . . . • . . . A . . . A . . . . G . . . T . . . A . . . C . . . . . . X - ~ . . . . . . . . . . . . . . . . . .

FzCU~E 5. T h e H10 germline gene encodes Va-GAT A b l and A b l ' sequences. Germline genes of the H series (this paper) are compared with A b l (G series, refs. 24, 26) and A b l ' (20 and 22 series, ref. 28) Vr~ nucleotide sequences. Characteristics of these hybridomas are given in Table I.

however the expected amino acids) (24) are also strongly homologous to the H 10 gene sequence, differing by 12 (G7 Ab 2.9) or 6 (G8 Ad 3.8) nucleotides. None o f these substitutions was observed in alternate sequences of the two homologous germline genes (H4a-3 and H2b-3), with one exception at codon 93. These two VH sequences must either derive from H10 by somatic events or result from the expression o f an as yet unidentified V . gene. T o decide between these possibil- ities, a Southern blot analysis was performed with rearranged G7 Ab 2.9 and G8 Ca 1.7 DNA. As can be seen in Fig. 4, both hybridomas expressed a rearranged band of the same size (~3.6 kb). As both use the J . 4 gene (24), this result leads to the conclusion that they also use the same VH germline gene. Since the portion extending from the beginning of J , 4 to the 3' Eco RI site contributes 1.2 kb (32), a length o f 2.4 kb starting at the 5' Eco R[ site and encompassing the V-D region remains to be accounted for. This size fits exactly the H10 restriction map given in Fig. 1, arguing definitively that H 10 is the germline gene used for G7 Ab 2.9 and G8 Ca 1.7, and indicating that observed nucleotide differences

(10)

S C H I F F E T AL. 581

TABLE I

Main Characteristics of Ab l and Ab l ' Hybridomas

Hybridoma lsotype Anti-GAT pGAT

activity expression A b l

G8 Ca 1.7 "ylx + +

G5 Bb 2.2 3,1x + +

G 7 A b 2.9 -rlx + +

G 8 A d 3.8 ~,lx + +

Abl'

22.8 UK +/- +

22.176 #x - +

20.11 "ylK + +

2 2 . 1 8 6 #~ + +

2 0 . 3 3 #K + +

20.8 #K + +

Data a r e t a k e n f r o m Leclercq et al. (21) (G series) a n d R o t h et al. (28) (20 a n d 22 series).

are due to somatic mutations. This observation is similar to situations reported in other systems such as PC (48, 49), ARS (50, 51), Oxazolone (52, 53), and NP b

(54, 55).

The Same HIO Germline Gene Is Used in Abl and A b l ' VH Regions of the Anti- GAT System. In Fig. 5 is also given the comparison of the H10 sequence with six monoclonal A b l ' VH regions. All of these A b l ' had been produced by immunization with monoclonal Ab2 (22, 23). All express the p G A T specificities, and all but two (22.8 and 22.176) were GAT-specific, as determined either by direct fixation or inhibition tests (28, and see Table I). Five of these (22.8, 22.176, 22.186, 20.33, 20.8) had sequences that were completely identical over the region analyzed, which runs from codon 29, 43, or 54 (28). As it was previously shown (24) that, in the G A T system, mutations accumulated prefer- entially in the COOH-terminal half of the VH region; it seems likely that the entire V , o f these hybridomas express the H10 germline gene without modifi- cation. Hybridoma 20.11 had four differences from the germline sequence.

T h e absence or the low level of somatic mutations observed in Ab 1' antibodies may result from several factors: (a) fusions were made with lymphocytes derived from one single immunization. This is consistent with the existence of a majority of # chains, although it should be recalled that fusion was performed 1 mo after immunization. The absence of mutation might thus be simply related to a low rate of division o f IgM-expressing B cells. (b) Alternatively, the system may tend not to accumulate mutations because, in Ig-Ig interactions of the idiotypic network, the optimal fit might be already insured by germline gene-encoded antibodies.

T h e selection of this germline Vr~ repertoire is not necessarily associated with G A T recognition, since hybridomas 22.8 and 22.176, which used the H10 germline gene did not bind the G A T antigen (Table I). It was previously shown (28) that G A T recognition in A b l ' was associated with structural features of the D region.

(11)

582

H 1 0 1 7 . 2 . 2 3 2 0 . 1 . 4 3 1 8 . 1 o 1 6

A N T I - G A T Ig V. GERMLINE GENE

~ 1 7 ~ 4 /

C A A G D T C C T T A C A ATG A A A TGC AGC TDG GTT A T C TTC TTC CTD ATO DCA GTG GTT A C A G T A A G G D G C T C C C A A G T C C C A A A C T T . . . / - G . . . . . . .

. . . t3 . . . . . . 13 . . .

H 1 0 1 7 . 2 o 2 5 2 0 . 1 o 4 3 1 D . 1 ° 1 6

- 4 1

G A D G G T C C A T A A A C T C T ° , G T G A C A G T G O C A A T C A C T T T G C C T T T C T T T C T A C A D / DG OTC ART T C A DAG GTT CAG CTG CAG CAD TCT DGG . . . CT . . . /

. . . . . .

1 0 2 0 3 0

H 1 0 GCA GAD CTT GTB RAG C C A GGG GCC T C A DTC RAG TTG TCC TDC A C A GCT TCT GOC TTC A A C A T T A A A OAC ACC T A T A T D 1 7 . 2 o 2 5 . . . G . . . G . . . 2 0 o l . 4 3 . . . D . . . 1 8 . 1 . 1 6 . . . D . . .

H 1 0 1 7 , 2 . 2 5 2 0 . 1 . 4 3 1 G o 1 . 1 6

4 0 3 0

CAC TGG OTG A A G CAG ABG CCT G A A CAG GGC CTG OAG TOG A T T GGA AGG A T T OAT C T GCG A R T GGT A R T ACT A A A T A T . . . . . . . . .

H 1 0 1 7 , 2 . 2 ~ 2 0 , 1 . 4 3 1 8 . 1 . 1 6

6 0 7 0 8 0 a b

G&C CCG A&G TTC C&G GGC A A G OCC A C T A T A A C A B C A GAC A C A TCC TCC ARC A C A GCC T A C CTG C A 6 CTC AGC AGC CTG . . . ": . . . A . . . . . . . . .

? 0

H 1 0 A C A TCT GAG (3~C ACT GCC GTC T&T T A C TGT OCT &O& C A C A G T G T T G C A ~ C C A C A T C C T G A G C D T G T C A G A A A C C A T A 6 ~ A C T S C A Q G & A G C T 1 7 . 2 , 2 5 . . .

2 0 . 1 . 4 3 . . . T 1 8 . 1 . 1 6 . . .

FIGURE 6. Comparison of H10 germline gene with nucleotide sequences of rearranged V, gene (17.2.25, ref. 59), and cDNA (20.1.43 and 18.1.16, ref. 60) derived from anti-NW- producing hybridomas in BALB/c mice.

This observation is in line with similar conclusions drawn in the levane (31) and the ARS (56) systems. In contrast, in the NP b system, another example for which Ab3 antibodies of the A b l ' type have been analyzed (57), only those antibodies that both expressed the public idiotype and were antigen specific used VH similar to that used for the A b l .

We also have evidence that, in the G A T system, V, germline genes are used preferentially (Corbet, S., manuscript in preparation). As the expression o f the p G A T idiotypic specificities relies on the presence of both the H and the L chains, this clearly suggests a very strict role of a given member o f the idiotypic cascade for the restricted expression of an idiotype, which is largely dependent on the use o f germline gene sequences.

The Same HIO Germline Gene Encodes VH GAT and Vn N P ~ Sequences. We reported earlier (58) that a C A T V , sequence derived from a C57BL/6 mouse was almost identical to the germline gene V186.2 (54) encoding the V , of the NP b family. This suggested that the same germline gene could be used, through different V-D-J rearrangements and various H-L pairings, to yield antibodies of discrete specificities. A similar observation was reported in the BALB/c mouse, in which GAT-Vn and NW-VH seemed to derive from the same germline gene (26, 59). Recently, Boersch-Supan et al. (60) reported the nucleotide sequence o f two NW Vn c D N A (20.1.43 and 18.1.16) that were highly homologous to that previously reported (I 7.2.25) (59). These three sequences are aligned with the H10 sequence in Fig. 6. T h e overall homology between each of these sequences and H10 was >99%, including the leader segment. In the coding region, 18.1.16, 20.1.43, and 17.2.25 differed from H10 by only one, two, and three nucleotides, respectively, reinforcing the previous hypothesis that NW, and anti-GAT VH regions were encoded by the same germline gene. An additional

(12)

SCHIFF ET AL. 5 8 3

argument was derived from Southern blot analysis performed on Eco R I - rearranged DNA. Boersch-Supan et al. (60) reported that the hybridization patterns strongly suggested that the same VH gene was used in each rearrange- ment. This Vn gene was contained in an Eco R! restriction fragment, to which it contributes 2.2 kb 5' upstream o f the V coding region, a value very close to that discussed above for G8 Ca 1.7 and G7 Ab 2.9 GAT-specific hybridomas.

Detailed 5' restriction mapping o f 17.2.25 (59) was also in complete agreement with that of H10. Finally, and as already stressed, three clones that all contained the 3.2 kb Eco RI fragment were isolated and sequenced. All three sequences were identical and are referred to as that of the H10 germline gene. This strongly argues against the possibility of having additional germline genes that would differ from H 1 0 at one, two, or three positions, and accounting for each o f the NW reported sequences (18.1.16, 20.1.43, and 17.2.25).

Out of the few positions that differed from the H 10 germline sequence (Fig.

6), two were clustered at codons 13 and 23 (and also one at - 1 3 in the leader segment). In all cases, the same nucleotide (G) was found, which may be suggestive o f a conversion event (49). We may thus unequivocally conclude that the same germline gene is being used in the NP" and G A T systems. This definitive p r o o f will presumably be extended to other VH and VL gene combinations, since, at the expression level, a number o f cases have already been reported in which the same chains are involved in different specificities (61). The random pairing o f H and L chains must therefore contribute a major source of antibody diversity, as originally proposed in 1963 by Edelman et al. (62).

S u m m a r y

Ig germline genes have been isolated from recombinant clones prepared in separate libraries constructed from adult BALB/c liver DNA either in pBR328 plasmid or in EMBL 3 phage. T h r e e clones that gave a very strong positive hybridization signal with a VH anti-GAT-specific probe were completely char- acterized and sequenced. All three were >95% homologous, with the exception of the 5' noncoding region, which was only 85% homologous but contained characteristic regulatory signals.

One of these genes, H 10, had a sequence that was completely identical to that of a cDNA derived from a GAT-specific BALB/c hybridoma. Southern blot analysis using Eco RI-digested DNA from rearranged GAT-specific hybridomas revealed that the same gene was used for other GAT-specific VH regions, including one differing from the H 10 sequence by 12 nucleotides, which must have been generated by a somatic mechanism. The same H 10 germline gene was also used, in most cases without any nucleotide substitution, in hybridomas of the A b l ' set o f the G A T idiotypic cascade, suggesting that immunization with Ab2 (antiidiotypic) antibodies preferentially stimulates the direct expression of Vr~ germline genes.

Finally, the previous hypothesis that NP a and G A T VH genes were derived from the same germline gene was definitively confirmed, both from sequence data and Southern blot analysis.

(13)

584 ANT1-GAT Ig Vn GERMLINE GENE

We express our gratitude to Dr. P. Legrain for his kind gift of the P5 Jn probe.

Received for publication 27 August 1985 and in revised form 28 October 1985.

R e f e r e n c e s

1. Jerne, N. K. 1974. Towards a network theory of the immune system. Ann. Immunol.

(Paris). 125(C):373.

2. Oudin, J., and M. Michel. 1963. Une nouvelle forme d'allotypie des globulines y du s~rum de lapin apparemment li~e ~ la sp~cificit~ des anticorps. C. R. acad. Sci. (Paris).

257:805.

3. Urbain, J., M. Wikler, J.D. Franssen, and C. Collignon. 1977. Idiotypic regulation of the immune system by the induction of antibodies against anti-idiotypic antibodies.

Proc. Natl. Acad. Sci. USA. 74:5126.

4. Cazenave, P. A. 1977. Idiotypic-anti-idiotypic regulation of antibody synthesis in rabbits. Proc. Natl. Acad. Sci. USA. 74:5122.

5. Nisonoff, A., S. T. Ju, and F. L. Owen. 1977. Studies of structure and immuno- suppression of a cross-reactive idiotype in strain A mice. lmmunol. Rev. 34:89.

6. Jerne, N. K., J. Roland, and P. A. Cazenave. 1982. Recurrent idiotopes and internal images. EMBO (Eur. Mol. Biol. Organ.) J. 1:243.

7. Bona, C. A., S. Finley, S. Waters, and H. G. Kunkel. 1982. Anti-Ig antibodies. III.

Properties of sequential anti-idiotypic antibodies to heterologous anti-~,-globulins.

Detection of reactivity of anti-idiotype antibodies with epitopes of Fc fragments (homobodies) and with epitopes and idiotopes (epibodies).J. Exp. Med. 156:986.

8. Eichmann, K., and K. Rajewsky. 1975. Induction o f t and B cell immunity by anti- idiotypic antibody. Eur. J. lmmunol. 5:661.

9. Rajewsky, K., and T. Takemori. 1983. Genetics, expression, and function ofidiotypes.

Ann. Rev. Immunol. 1:569.

10. Cosenza, H. 1976. Detection of anti-idiotype reactive cells in the response to phos- phorylcholine. Eur. J. lmmunol. 6:114.

1 I. Blomberg, B., W. R. Geckeler, and M. Weigert. 1972. Genetics of the antibody response to dextran in mice. Science (Wash. DC). 177:178.

12. Cosenza, H., and H. Kohler. 1972. Specific inhibition of plaque formation to phos- phorylcholine by antibody against antibody. Science (Wash. DC). 176:1027.

13. Jack, R. S., T. Imanishi-Kari, and K. Rajewsky. 1977. Idiotypic analysis of the response of C57BL/6 mice to the (4-hydroxy-3-nitrophenyl) acetyl group, Eur. J. lmmunol.

7:559.

14. Sirinsinha, S., and H. N. Eisen. 1971. Autoimmune antibodies to the ligand binding sites of myelorna proteins. Proc. Natl. Acad. Sci. USA. 68:3130.

15. Lieberman, R., M. Potter, W. Humphrey, E. B. Musinski, and M. Vrana. 1975.

Multiple individual and cross-specific idiotypes on 13 levan-binding myeloma proteins of BALB/c mice. J. Exp. Med. 142:106.

16. Ju, S. T., T. J. Kipps, J. Theze, B. Benacerraf, and M. E. Dorf. 1978. Idiotypic analysis of anti-GAT antibodies. I. Presence of common idiotypic specificities in both responder and non-responder mice. J. Immunol. 121 : 1034.

17. Theze, J., and J. L. Moreau. 1978. Genetic control of the immune response to the GAT terpolymer. I. Interstrain and interspecies cross-reactive idiotype. Ann. Immu- nol. (Paris). 129(C):721.

18. Rudikoff, S. 1983. Immunoglobulin structure-function correlates: antigen binding and idiotypes. Contemp. Topics Mol. Immunol. 9:169.

19. Theze, J., and G. Somme. 1979. Genetic control of the immune response to the

(14)

SCHIFF ET AL. 585 terpolymer GAT. Characterization of a cross-reactive idiotype associated with anti- GAT antibodies from responder and non-responder mice. Eur. J. Immunol. 9:294.

20. Somme, G., J. Rocca-Serra, L. LeClercq, J. L. Moreau, J. C. Mazie, D. Moinier, M.

Fougereau, andJ. Theze. 1982. Contribution of the H and L chains of the combining site to the idiotypic specificities of mouse anti-GAT antibodies. Mol. lmmunol.

19:1011.

21. Leclercq, L., J. C. Mazie, G. Somme, and J. Theze. 1982. Monoclonal anti-GAT antibodies with different fine specificities express the same public idiotype. Mol.

Imrnunol. 19: I001.

22. Somme, G., C. Roth,J. C. Mazie, P. Salem, andJ. Theze. 1983. Public and individual idiotopes in the anti-GAT response: analysis by monoclonal antibodies. Eur. J.

lmmunol. 13:1023.

23. Roth, C., G. Somme, C. Schiff, andJ. Theze. 1985. Immune response against GAT:

immunization with monoclonal anti-idiotypic antibodies leads to the predominant stimulation of idiotypically similar Ig with an anti-GAT activity, Eur. J. Immunol.

15:576.

24. Rocca-Serra, J., H. W. Matthew, M. Kaartinen, C. Milstein, J. Theze, and M.

Fougereau. 1983. Analysis of antibody diversity: V-D-J mRNA nucleotide sequence of four anti-GAT monoclonal antibodies. EMBO (Eur. Mol. Biol. Organ.)J. 2:867.

25. Tonnelle, C., J. Rocca-Serra, A. Moulin, D. Moinier, and M. Fougereau. 1983. V, gene family in GAT-specific antibodies that express CGAT (or p.GAT) public idiotypic specificities. Protein and mRNA sequencing of eight monoclonal V, chains.

J. Exp. Med. 158:1415.

26. Schiff, C., M. Milili, and M. Fougereau. 1983. Immunoglobulin diversity: analysis of the germ-line VH gene repertoire of the murine anti-GAT response. Nucleic Acids Res. 11:4007

27. Scbiff, C., S. Corbet, M. Milili, and M. Fougereau. 1983. Interstrain conservation of the murine GAT-specific V, repertoire as analyzed at the germ line level, EMBO (Eur.

Mol. Biol. Organ.)J. 2:1771.

28. Roth, c . , J . Rocca-Serra, G. Somme, M. Fougereau, andJ. Theze. 1985. The gene repertoire of the GAT immune response: comparison of the Vn, V,, and D regions used by anti-GAT antibodies and monoclonal antibodies produced after anti-idiotypic immunization. Proc. Natl. Acad. Sci. USA. 82:4788.

29. Gross-Bellard, M., P. Oudet, and P. Cbambon. 1973. Isolation of high-molecular- weight DNA from mammalian cells. Eur. J. Biochem, 36:32.

30. Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503.

31. Legrain, P., J. Rocca-Serra, A. Moulin, M. Fougereau, and G. Buttin, 1985. A single VH gene associated with a variety of D- and J-segments encodes for a large family of ABPC-48-related antibodies induced by anti-idiotypic immunization. Mol. Immunol.

22:437.

32. Alt, F. W., and D. Baltimore. 1982. Joining of immunoglobulin heavy chain gene segments: Implications from a chromosome with evidence of three D-JH fusions. Proc.

Natl. Acad. Sci. USA. 79:4118.

33. Hanahan, D. 1983. Studies on transformation ofEscherichia coli with plasmids.J. Mol.

Biol. 166:557.

34. Hanahan, D., and M. Meselson. 1980. Plasmid screening at high colony density. Gene (Amst.) 10:63.

35. Maniatis, T., E. F. Fritsch, andJ. Sambrook. 1982. Construction ofgenomic libraries.

In Molecular Cloning, A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 269-307.

(15)

586 ANTI-GAT Ig Vn GERMLINE GENE

36. Messing, J., andJ. Vieira. 1982. T h e pUC plasmids, an M13 mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene (Amst.)

19:259.

37. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74:5463.

38. Kabat, E. A., T. T. Wu, H. Bilofsky, M. Reid-Miller, and H. Perry. 1983. Sequences of proteins of immunological interest. U. S. Department of Health and Human Services. National Institutes of Health, Bethesda, Md. pp. 12 I - 127.

39. Schiff, C., M. Milili, and M. Fougereau. 1985. Functional and pseudogenes are similarly organized and may equally contribute to the extensive antibody diversity of the Ig Vu II family. EMBO (Eur. Mol. Biol. Organ.)J. 4:1225.

40. Neuberger, M.S.,and F. Calabi. 1983. Reciprocal chromosome translocation between c-myc and Ig ~2b gene. Nature (Loud.) 305:243.

41. Fougereau, M., S. Corbet, P. Oilier, J. Rocca-Serra, C. Roth, C. Schiff, G. Somme, J. Theze, and C. Tonnelle. 1985. The internal image and the structural idiotypic network (Abl, Ab2, Ab3) in the G A T system. Ann. Inst. Pasteur (Paris). 136(C): 143.

42. Urbain, J., C. Wuilmart, and P. A. Cazenave. 1981. Idiotypic regulation in immune networks. Contemp. Topics Mol. Immunol. 8:113,

43. Rechavi, G., D. Ram, L. Glazer, R. Zakut, and D. Givol. 1983. Evolutionary aspects of Ig heavy chain variable region (Vu) gene subgroups. Proc. Natl. Acad. Sci. USA.

80:855.

44. Breathnach, R., and P. Chambon. 1981. Organization and expression of eucaryotic split genes coding for proteins. Ann. Rev. Biochem. 50:349.

45. Parslow, T. G., D. L. Blair, W. J. Murphy, and D. K. Granner. 1984. Structure of the 5' ends of immunoglobulin genes: a novel conserved sequence. Proc. Natl. Acad.

Sci. USA. 81:2650.

46. Falkner, F. G., and H. G. Zachau. 1984. Correct transcription of an Ig K gene requires an upstream fragment containing conserved sequence elements. Nature (Lond.). 310:71.

47. Mason, J. O., G. T. Williams, and M. S. Neuberger. 1985. Transcription cell type specificity is conferred by an IgVu gene promoter that includes a functional consensus sequence. Cell. 41:479.

48. Crews, S., J. Griffin, H. Huang, K. Calame, and L. Hood. 1982. A single Vn gene segment encodes the immune response to PC: somatic mutation is correlated with the class of the antibody. Cell. 25:47.

49. Clarke, S. H., and S. Rudikoff. 1984. Evidence for gene conversion among Ig heavy chain variable region genes. J. Exp. Med. 159:773.

50. Sims, J., T. H. Rabbitts, P. Estess, C. Slaughter, P. W. Tucker, and J. D. Capra.

1982. Somatic mutation in genes for the variable portion of the immunoglobulin heavy chain. Science (Wash. DC). 216:309.

51. Siekevitz, M., S. Y. Huang, and M. L. Gefter. 1983. The genetic basis of antibody production: a single heavy chain variable region gene encodes all molecules bearing the dominant anti-arsonate idiotype in the strain A mouse. Eur. J. Immunol. 13:123.

52. Kaartinen, M., G. M. Griffitbs, A. F. Markham, and C. Milstein. 1983. mRNA sequences define an unusually restricted IgG response to 2-phenyloxazolone and its early diversification. Nature (Lond.). 304:320.

53. Kaartinen, M., G. M. Griffiths, P. H. Hamlyn, A. F. Markham, K. Karjalainen, J. L.

T. Pelkonen, O. Makela, and C. Milstein. 1983. Anti-oxazolone hybridomas and the structure of the oxazolone idiotype. J. Immunol. 130:937.

54. Bothwell, A. L. M., M. Paskind, M. Reth, T. Imanishi-Kari, K. Rajewsky, and D.

(16)

SCHIFF ET AL. 587 Baltimore. 1981. Heavy chain variable region contribution to the NP b family of antibodies: somatic mutation evident in a ~,2a variable region. Cell. 24:625.

55. Bothwell, A. L. M. 1984. The genes encoding anti-NP antibodies in inbred strains of mice. In The Biology of Idiotypes. M. I. Greene and A. Nisonoff, editors. Plenum Press, New York. 19.

56. Margolies, M. N., L.J. Wysocki, and V. L. Sato. 1983. Immunoglobulin idiotype and anti-anti-idiotype utilize the same variable region genes irrespective of antigen spec- ificity.J. Immunol. 130:515.

57. Dildrop, R., J. Bovens, M. Siekevitz, K. Beyreuther, and K. Rajewsky. 1984. A V region determinant (idiotope) expressed at high frequency in B lymphocytes is encoded by a large set of antibody structural genes. EMBO (Eur. Mol. Biol. Organ.)J.

3:517.

58. Rocca-Serra, J., C. Tonnelle, and M. Fougereau. 1983. Two monoclonal antibodies against different antigens using the same VH germ-line gene. Nature (Lond.). 304:353.

59. Loh, D. Y., A. L. M. Bothwell, M. E. White-Scharf, T. Imanishi-Kari, and D.

Baltimore. 1983. Molecular basis of a mouse strain-specific anti-hapten response.

Cell. 33:85.

60. Boersch-Supan, M. E., S. Agarwal, M. E. White-Scharf, and T. Imanishi-Kari. 1985.

Heavy chain variable region multiple gene segments encode anti-4-(hydroxy-3-nitro- phenyl)acetyl idiotypic antibodies. J. Exp. Med. 161 : 1272.

61. Capra, J. D., and M. Fougereau. 1983. Structural correlates of idiotypes: one from column A, one from column B. Imraunol. Today. 4:177.

62. Edelman, G. M., D. E. Olins, J. A. Gaily, and N. D. Zinder. 1963. Reconstitution of immunologic activity by interaction of polypeptide chains of antibodies. Proc. Natl.

Acad. Sci. USA. 50:753.

Références

Documents relatifs

Die Resultate der Studie zeigen, dass trotz einem erhöhten Risiko zu psychischen Folgen eines Einsatzes Rettungshelfer Zufriedenheit und Sinn in ihrer Arbeit finden können und

Nous souscrivons donc aux recommandations européennes les plus récentes concernant le traitement anticoagulant et antiagrégant des patients atteints de fibrillation auriculaire (et

C 1,α regularity of the blow-up curve at non characteristic points for the one dimensional semilinear wave equation. On the regularity of the blow-up set for semilinear

By combining regulatory sequence analy- sis and metabolic pathway analysis, one could obtain two independent and comple- mentary sources of information for these clusters

The second chapter is devoted to the synthesis and characterization of imidazol(in)ium dithiocarboxylates (NHC•CS 2 adducts), carboxylates (NHC•CO 2 adducts) and thiocarboxylates

The effect of SNVs on the functionality of the BRCA1 gene was assessed by means of the PolyPhen2 [10], the Provean [19], the Align GVGD [20], the Strum [9], the Cupsat [21], and

A national cancer control programme is a public health programme designed to reduce the incidence and mortality of cancer and improve the quality of life of cancer patients in

RECOMMENDS that the new procedure adopted for the elaboration of the fifth programme of work become the method of choice for all the planning activities of the