HAL Id: hal-02861561
https://hal.inrae.fr/hal-02861561
Submitted on 9 Jun 2020
HAL is a multi-disciplinary open access
archive for the deposit and dissemination of
sci-entific research documents, whether they are
pub-lished or not. The documents may come from
teaching and research institutions in France or
abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est
destinée au dépôt et à la diffusion de documents
scientifiques de niveau recherche, publiés ou non,
émanant des établissements d’enseignement et de
recherche français ou étrangers, des laboratoires
publics ou privés.
Distributed under a Creative Commons Attribution| 4.0 International License
from Variably Protease-Sensitive Prionopathy and
Familial CJD Associated with PrPV180I Mutation
Zerui Wang, Jue Yuan, Pingping Shen, Romany Abskharon, Yue Lang,
Johnny Dang, Alise Adornato, Ling Xu, Jiafeng Chen, Jiachun Feng, et al.
To cite this version:
Zerui Wang, Jue Yuan, Pingping Shen, Romany Abskharon, Yue Lang, et al.. In Vitro Seeding
Activity of Glycoform-Deficient Prions from Variably Protease-Sensitive Prionopathy and Familial
CJD Associated with PrPV180I Mutation. Molecular Neurobiology, Humana Press, 2019, 56 (8),
pp.5456-5469. �10.1007/s12035-018-1459-0�. �hal-02861561�
In Vitro Seeding Activity of Glycoform-Deficient Prions from Variably
Protease-Sensitive Prionopathy and Familial CJD Associated
with PrP
V180IMutation
Zerui Wang1,2&Jue Yuan2&Pingping Shen1&Romany Abskharon3&Yue Lang1,2&Johnny Dang2&Alise Adornato2&
Ling Xu2&Jiafeng Chen1&Jiachun Feng1&Mohammed Moudjou4&Tetsuyuki Kitamoto5&Hyoung-gon Lee6&
Yong-Sun Kim7&Jan Langeveld8&Brian Appleby2,9,10&Jiyan Ma3&Qingzhong Kong2,9,10&Robert B. Petersen2,11&
Wen-Quan Zou1,2,9,10,12 &Li Cui1
Received: 12 September 2018 / Accepted: 17 December 2018 / Published online: 5 January 2019 # The Author(s) 2019, corrected publication 2019
Abstract
Both sporadic variably protease-sensitive prionopathy (VPSPr) and familial Creutzfeldt-Jakob disease linked to the prion protein (PrP) V180I mutation (fCJDV180I) have been found to share a unique pathological prion protein (PrPSc) that lacks the protease-resistant PrPScglycosylated at residue 181 because two of four PrP glycoforms are apparently not converted into the PrPScfrom their cellular PrP (PrPC). To investigate the seeding activity of these unique PrPScmolecules, we conducted in vitro prion conversion experiments using serial protein misfolding cyclic amplification (sPMCA) and real-time quaking-induced conversion (RT-QuIC) assays with different PrPCsubstrates. We observed that the seeding of PrPScfrom VPSPr or fCJDV180Iin the sPMCA reaction containing normal human or humanized transgenic (Tg) mouse brain homogenates generated PrPScmolecules that unexpectedly exhibited a dominant diglycosylated PrP isoform along with PrP monoglycosylated at residue 181. The efficiency of PrPScamplification was significantly higher in non-CJDMM than in non-CJDVV human brain homogenate, whereas it was higher in normal TgVV than in TgMM mouse brain homogenate. PrPCfrom the mixture of normal TgMM and Tg mouse brain expressing PrPV180Imutation (Tg180) but not TgV180I alone was converted into PrPScby seeding with the VPSPr or fCJDV180I. The RT-QuIC seeding activity of PrPScfrom VPSPr and fCJDV180Iwas significantly lower than that of sCJD. Our results suggest that the formation of glycoform-selective prions may be associated with an unidentified factor in the affected brain and the glycoform-deficiency of PrPScdoes not affect the glycoforms of in vitro newly amplified PrPSc.
Electronic supplementary material The online version of this article
(https://doi.org/10.1007/s12035-018-1459-0) contains supplementary
material, which is available to authorized users. * Robert B. Petersen [email protected] * Wen-Quan Zou [email protected] * Li Cui [email protected] 1
Department of Neurology, The First Hospital of Jilin University, Changchun, Jilin Province, People’s Republic of China 2
Department of Pathology, Case Western Reserve University School of Medicine, Cleveland, OH, USA
3 Center for Neurodegenerative Science, Van Andel Research Institute, Grand Rapids, MI 49503, USA
4
Virologie Immunologie Moléculaires, INRA, Jouy-en-Josas, France 5 Center for Prion Diseases, Tohoku University Graduate School of
Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575, Japan
6
Department of Biology, College of Sciences, University of Texas at San Antonio, San Antonio, TX 78249, USA
7
Department of Microbiology, College of Medicine, Hallym University, Chuncheon, Gangwon-do 24252, Republic of Korea 8 Wageningen BioVeterinary Research, Houtribweg 39, Lelystad, the
Netherlands 9
National Prion Disease Pathology Surveillance Center, Case Western Reserve University School of Medicine, Cleveland, OH, USA 10 Department of Neurology, Case Western Reserve University School
of Medicine, Cleveland, OH, USA 11
Foundation Sciences, Central Michigan University College of Medicine, Mount Pleasant, MI, USA
12 State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, Beijing, China
Keywords Prion . Prion disease . Variably protease-sensitive prionopathy (VPSPr) . Serial protein misfolding cyclic amplification (sPMCA) . Real-time quaking-induced conversion (RT-QuIC) . Humanized transgenic mice . Polymorphism
Introduction
Prions are infectious pathogens that are associated with a group of fatal transmissible spongiform encephalopathies or prion dis-eases affecting both animals and humans. They are composed mainly of the pathologic scrapie conformers (PrPSc) that originate from their normal cellular prion protein (PrPC) through a confor-mational transition of the largelyα-helical form to predominantly β-sheets by a seed- or template-assisted mechanism [1, 2]. Human prion diseases are highly heterogeneous: they can be familial, sporadic, or acquired by infection, and include Creutzfeldt-Jakob disease (CJD), Gerstmann-Sträussler-Scheinker (GSS) disease, fatal insomnia, kuru, variant CJD (vCJD), and variably protease-sensitive prionopathy (VPSPr) [3]. PrPScdetected in the brain of all sporadic and acquired CJD and in most familial CJD has been well recognized to be mainly composed of three typical PrP glycoforms including diglycosylated, monoglycosylated, and un-glycosylated forms. However, Zou and co-workers recently discovered that the spo-radic VPSPr along with familial Creutzfeldt-Jakob disease (fCJD) associated with a PrP mutation Val to Ile at residue 180 (fCJDV180I) generates a PrPScmolecule with a unique elec-trophoretic gel profile and is characterized by the accumulation in the brain of PrPScthat lacks diglycosylated PrPScand PrPSc monoglycosylated at residue 181 [4–6]. Unlike fCJD linked to the PrP mutation Thr to Ala at residue 183 (fCJDT183A) that eliminates the N-linked glycosylation at residue 181 [7–9], the overall cellular PrP from VPSPr and fCJDV180Ishows a normal PrP profile with the highest amount being diglycosylated PrP, followed by monoglycosylated PrP, and the lowest amount be-ing un-glycosylated PrP prior to digestion with proteinase K (PK). Therefore, at least based on Western blotting, PrP from VPSPr and fCJDV180Iseems to have an intact glycoform profile similar to that from normal controls but somehow the diglycosylated PrP and PrP monoglycosylated at residue 181 are not converted into the PK-resistant PrPSc; only un-glycosylated PrP and PrP monoun-glycosylated at residue 197 are converted into PK-resistant PrPSc[4–6]. Interestingly, two subsequent studies revealed that PrPScfrom VPSPr patients exhibited very low transmissibility in the first passage of a transmission study in humanized transgenic mice and no trans-mission was observed at all in the second passage [10,11].
To further understand the molecular mechanism underlying the conversion of PrPC into this unique PrPScin VPSPr and fCJDV180I, we employed two advanced technologies termed se-rial protein misfolding cyclic amplification (sPMCA) and real-time quaking-induced conversion (RT-QuIC) assays to investi-gate the in vitro seeding activity of PrPScfrom patients with these two conditions, respectively. We found that PrPScfrom VPSPr
and fCJDV180Ican be amplified very efficiently using the brain homogenate from non-CJD individuals carrying PrP-129MM but poorly using the brain homogenate from non-CJD individ-uals carrying PrP-129VV. With PrP substrates from humanized transgenic mice expressing human wild-type PrP-129MM (TgMM) or PrP-129VV (TgVV) or expressing human mutant PrP with V180I mutation coupled with PrP-129MM polymor-phism (TgV180I), amplification of PrPSc from VPSPr and fCJDV180Iwas highly efficient using TgVV and poor using TgMM or TgV180I alone. Interestingly, PrPScwas very efficient-ly amplified using a mixture of brain homogenate derived from both TgMM and TgV180I. As a control, we found that PrPSc from fCJDT183Athat lacks the N-linked glycosylation at residue 181 could be amplified in non-CJD human brain homogenate with either PrP-129MM or PrP-129VV. PrPScfrom fCJDT183A was also very efficiently amplified using brain homogenates from TgMM and TgMM + TgV180I, but not amplified using TgVVor TgV180I alone. Surprisingly, diglycosylated PrPScwas the predominant form in all amplified PrPScspecies. Moreover, RT-QuIC assay demonstrated that PrPScfrom VPSPr, fCJDV180I, and fCJDT183Awas all amplifiable using recombinant bank vole PrP as a substrate; the seeding activity of PrPScfrom VPSPr and fCJDV180Iwas approximately 102- to 105-fold lower than that of PrPScfrom sCJDMM1 and sCJDVV2.
Materials and Methods
Reagents and Antibodies
PK was purchased from Sigma Chemical Co. (St. Louis, MO). Reagents for enhanced chemiluminescence (ECL Plus) were from Amersham Pharmacia Biotech, Inc. (Piscataway, NJ). Anti-PrP antibodies 3F4 against human PrP residues 107-112 [12,13], 1E4 against human PrP97-106 [14], Tohoku 2 (T2) [15], Bar209, and V14 [4,16] were used.
Preparation of Humanized TgVV, TgMM, and TgV180I
Mice
The humanized TgVV mice expressing human wild-type PrP with VV at residue 129 (also termed TgWV) were prepared as described previously [17]; the TgMM mice (also called Tg40h) expressing human wild-type PrP with MM at residue 129 were generated by self-breeding of the previously report-ed Tg40 mice [18,19]. For preparation of TgV180I mice, the transgene construct was generated by introducing the V180I mutation via PCR-based mutagenesis into the pHGHuPrP-129M plasmid, which was microinjected into fertilized FVB/
NJ eggs, and planted into the oviducts of pseudopregnant CD-1 mice at the transgenic mouse facility of Case Western Reserve University (Cleveland, OH). Founder pups were screened by PCR of tail DNA. All founder mice carrying the transgenes were bred with FVB/Prnp0/0 mice to obtain Tg mice in PrP-null background. Transgenic PrP expression in the brain and other tissues of the Tg mice was examined by Western blot analysis using monoclonal antibody 3F4. All animal experiments in this study were approved by the Institutional Animal Use and Care Committee and the Institutional Biosafety Committee.
Preparation of Recombinant Bank Vole PrP109M
or PrP109I
The cloning of the bank vole PrP109M or PrP109I (BVPrP109M or BVPrP109I) genes were carried out based on the previously described [20]. The DNA coding for full-length BVPrP-109M and BVPrP-109I was amplified by PCR using a template plasmid of BVPrP-109M/pOPINE or BVPrP-109I/pOPINE. The amplification was carried out using oligonucleotides 5′ CGCGGATCCATGAAGAAGCG GCCAAAGCCTGG 3′ and 5′ CCCAAGCTTTTAGG AACTTCTCCCTTCGT 3′. The PCR product was digested with BamHI and HindIII and inserted into pET-28a (Novagen). The bank vole PrP109M or PrP109I recombinant protein expression and purification was done according to our previous study [21]. The Escherichia coli Rossetta (DE3) pLysS were transformed with full-length BVPrP-109M or BVPrP-109I for a large-scale production. The bacteria were induced at A600 = 0.6 by adding 1 mM isopropyl-b-d-thiogalactopyranoside (IPTG) and then subsequently grown at 37 °C for 5–6 h. Cells were collected by centrifugation (15 min at 15,000g). The bacterial pellets were re-suspended as 0.1 g of cell paste/milliliter in lysing buffer (10 mM Tris-HCl, 100 mM Na-PO4 buffer, pH 8.0). Mechanical disruption was used to lyse the cells and followed by centrifugation at 4 °C for 30 min at 15,000×g. The inclusion bodies were re-suspended in 6 M guanidine hydrochloride (GdnHCl), 10 mM
Tris-HCl, 100 mM Na-PO4 buffer, and 10 mM
β-mercaptoethanol (βME), pH 8.0, and sonicated on ice until completely solubilized. The recombinant bank vole PrP109M or PrP109I was refolded on the Ni-NTA column by running a GdnHCl gradient (from 6 M GdnHCl, 10 mM Tris-HCl, and 10 mMβME, pH 8.0, to 10 mM Tris-HCl and 100 mM Na-PO4 buffer, pH 8.0) at 1 mL/min. After wash, recombinant PrP was eluted with 10 mM Tris-HCl, 100 mM Na-PO4 buff-er, and 500 mM imidazole, pH 5.8. The eluted soluble BVPrP fractions were loaded on a SDS/PAGE to evaluate protein purity and then pooled. The fractions only containing BVPrP were collected and dialyzed against 10 mM sodium phosphate buffer pH 5.8 and concentrated to 0.7 mg/mL. Protein aliquots were stored at− 80 °C until use.
Preparation of Human or Mouse Brain Samples
for Western Blotting, sPMCA, and RT-QuIC Assays
Frozen brain tissues from patients with VPSPr, fCJDV180I, fCJDT183A, sCJDMM1, and sCJDVV2, or normal subjects with PrP129-MM or PrP129-VV and from humanized trans-genic mice of TgVV, TgMM, or TgV180I perfused, were col-lected and kept at− 80 °C. The samples were carefully cleaned with PBS for three times before the processing of each speci-men in order to avoid blood contamination. For Western blot-ting, or sPMCA assay, Beads Beater was used to prepare tissue homogenates and the samples were then centrifuged at 500g for 5 min. The supernatant (S1) was transferred to a clean tube for future use while the pellet (P1) was discarded. For RT-QuIC analysis, the S1 fraction was diluted at 1:1 with 2 × conversion buffer containing 300 mM NaCl, 2% Triton X-100, and a com-plete protease inhibitor in PBS without Ca2+and Mg2+to pre-pare a 5% brain homogenate and then make serial dilution with 1 × N2 in 0.05%SDS/PBS as described [22].
Serial PMCA Procedures
The preparation of PrP seeds and substrates as well as sPMCA was conducted as previously described [17,23]. In brief, hu-man or Tg mouse brain tissues were carefully dissected to avoid cerebellum and blood contamination as much as possi-ble. Brain homogenate substrates from normal frozen brains were homogenized (10% w/v) in PMCA conversion buffer containing 150 mM NaCl, 1% Triton X-100, and 8 mM EDTA pH 7.4 and the complete protease inhibitor mixture cocktail (Roche) in PBS. The seeds of the brain tissue homog-enates were prepared as the brain substrates described above. Tissue homogenates were centrifuged at 500g for 10 min at 4 °C and the supernatant (S1) fraction was collected as the substrate or centrifuged at 500g for 3 min for the seeds of brain samples. The substrates and seeds were kept at− 80 °C until use. Each seed was diluted in the substrate at the ratios from 1:12.5 to 1:100 (1μL or 8 μL seed + 99 μL or 92 μL substrate) into 200-μL PCR tubes with 1 PTFE beads (diameter 3/32″) (Teflon, APT, RI). Twenty microliters of each mixture was taken and kept at− 20 °C as a non-PMCA control. The remain-ing mixture was subjected to serial PMCA (sPMCA). Each cycle comprised a 20-s elapse time of sonication at amplitude 85 (250 W; Misonix S3000 sonicator) followed by an incuba-tion period of 29 min 40 s at 37 °C and each round of sPMCA consisted of 96 cycles. For the serial PMCA, 15μL sample was taken from the last cycle and placed into 85-μL fresh normal brain substrates for a new round of amplification.
RT-QuIC Analysis
RT-QuIC assay was conducted as previously described [20, 22,24]. Briefly, the reaction mix was composed of 10 mM
phosphate buffer (pH 7.4), 300 mM NaCl, 0.1 mg/mL recom-binant bank vole PrP23-231, 10μM thioflavin T (ThT), 1 mM ethylenediaminetetraacetic acid tetrasodium salt hydrate (EDTA), and 0.001% SDS. Aliquots of the reaction mix (98 μL) were loaded into each well of a 96-well plate (Nunc) and seeded with 2μL of brain homogenate spinning at 2000g for 2 min at 4 °C as previously described [22]. The plate was then sealed with a plate-sealer film (Nalgene Nunc International) and incubated at 42 °C in a BMG FLUOstar Omega plate reader with cycles of 1-min shaking (700 rpm double orbital) and 1-min rest throughout the indicated incu-bation time. ThT fluorescence measurements (450 ± 10-nm excitation and 480 ± 10-nm emission; bottom read) were tak-en every 45 min. Four replicate reactions were seeded with the same dilution of an individual sample. The average fluores-cence values per sample were calculated using fluoresfluores-cence values from all four replicate wells regardless of whether these values crossed the threshold described below. At least 2 of 4 replicate wells must cross this threshold for a sample to be considered positive.
Western Blotting
sPMCA-treated brain samples were subjected to treat-ment with PK at 100 μg/mL for 70 min at 45 °C with agitation prior to Western blotting. Samples were re-solved either on 15% Tris-HCl Criterion pre-cast gels (Bio-Rad) for SDS-PAGE as described previously [25]. T h e p r o t e i n s o n t h e g e l s w e r e t r a n s f e r r e d t o Immobilon-P membrane polyvinylidene fluoride (PVDF, Millipore) for 2 h at 350 mA. For probing of PrP, the membranes were incubated for 2 h at room temperature with anti-PrP antibodies 3F4 at 1:40,000, 1E4 at 1:500, T2 at 1:8000, Bar209 at 1:6000, and V14 at 1:6000 dilution, as the primary antibody. Following incubation with horseradish peroxidase-conjugated sheep anti-mouse IgG at 1:4000 or donkey anti-rabbit IgG (for T2 only) at 1:6000 dilution, the PrP bands were visualized on Kodak film by ECL Plus as described by the manufacturer. PrP protein bands were measured by densitometric analysis and quantified using a UN-SCAN-IT Graph Digitizer soft-ware (Silk Scientific, Inc., Orem, Utah).
Statistical Analysis
The statistical differences in intensity of PrPScamplified by sPMCA among different groups detected by Western blotting were statistically analyzed using Student’s T test or ANOVA test to obtain p values for comparisons between two groups or multiple groups.
Results
PrP
Scfrom VPSPr and fCJD
V180Ito be examined
for prion seeding activity lacks diglycosylated PrP
ScWe first wanted to confirm our previous finding in the samples to be examined in this study that PrPSc from the brain of patients with VPSPr and fCJDV180I lacks the PK-resistant diglycosylated glycoform, detected by the 3F4 and 1E4 anti-PrP antibodies [4–6,9]. On the 3F4 blot, in contrast to sCJD, the brain homogenates from VPSPr and fCJDV180Ipatients exhibited only mono- and un-glycosylated PK-resistant PrP bands migrating at approximately 26 kDa and 20 kDa upon the treatment of brain homogenates with different amounts of PK ranging from 5 through 100μg/mL (Fig.1a). However, in the samples without PK treatment (0 μg/mL), the diglycosylated PrP was readily detectable not only in sCJD but also in fCJDV180Iand VPSPr (Fig.1a). Our previous stud-ies demonstrated that the lack of the PK-resistant diglycosylated PrPSc results from the missing PrP species diglycosylated and monoglycosylated at residue 181 that are not converted into the PK-resistant PrPScmolecule [4,6]. The PK-resistant PrPScfrom fCJDT183Aexhibited a predominant monoglycosylated PrP band as well as a barely detectable diglycosylated and an un-glycosylated PrP bands (Fig.1a).
The epitopes of the 1E4 and 3F4 antibodies are next to each other on the protein, the former being composed of human PrP97-105 and the latter covering human PrP106-112 [13, 14], as shown in the schematic diagram of PrP structure and modifications in Fig.S1[26–28]. We previously observed that the two antibodies have different immunoreactivity with dis-tinct PrPScmolecules. For instance, compared to 3F4, 1E4 has a higher affinity for the sCJD PrPSctype 2 and a lower affinity for sCJD PrPSctype 1, in addition to its higher affinity for the unique ladder-like PrPSc in VPSPr and fCJDV180I [3–6]. According to the previous sequencing study, the PK-resistant PrPSctype 2 fragment starts at residue 97 [29], the first amino acid of the 1E4 epitope. Thus, it is most likely that the higher immunoreactivity of the 1E4 antibody than that of the 3F4 antibody is directly attributable to the well-exposed 1E4 epi-tope on the PrPSctype 2 fragment.
To confirm the particular gel profiles of PrPScfrom VPSPr and fCJDV180I, we next probed the blots with the 1E4 anti-body. Indeed, although the equal amounts of brain homoge-nates were loaded, compared to 3F4, 1E4 showed a greater intensity for sCJD PrPSctype 2 while a weaker intensity for sCJD PrPSctype 1 (Fig.1b, left two panels). Moreover, in addition to the two PK-resistant PrPScbands migrating at ~ 26 and ~ 20 kDa, 1E4 detected three additional PK-resistant PrP fragments migrating at ~ 23, ~ 17, and ~7 kDa in the samples from fCJDV180I and VPSPr, exhibiting the unique ladder-like PK-resistant PrPSc bands (Fig. 1b). They were not detectable in the samples from sCJDMM1 and
sCJDVV2 and also not in the samples from fCJDT183A(Fig. 1b). Since the PrPT183Amutation has been shown to complete-ly abolish the N-linked gcomplete-lycosylation at residue 181 [7–9], the faint diglycosylated PrPScdetected by both 3F4 and 1E4 is expected to be from the wild-type allele (Fig.1a, b) [7,9].
PrP
Scfrom VPSPr and fCJD
V180IPreferentially Seeds
Human Brain
–Derived PrP
C-129MM Substrate
by sPMCA, Forming Diglycoform-Containing PrP
ScGiven the unique PrPSc profile and low transmissibility of VPSPr and fCJDV180I, it would be important to determine whether the PrPScmolecules from these diseases can convert normal PrPC from healthy human brain homogenates and what types of PrPSccan be generated in vitro compared to PrPScfrom the most common sCJD. We conducted serial pro-tein misfolding cyclic amplification (sPMCA) of PrPScfrom brain homogenates of 129MM (VPSPrMM), VPSPr-129VV (VPSPrVV), VPSPr-129MV (VPSPrMV), and fCJDV180I-129MM using two types of PrPCfrom healthy hu-man brain homogenate with either 129MM or 129VV poly-morphism as the substrates. sPMCA is a highly efficient in vitro amplification assay that has been shown to be able to faithfully mimic prion conversion by continuously seeding PrPScin normal PrPCsubstrate [23]. PrPScfrom sCJDMM1, sCJDVV2, and fCJDT83Awas used as controls. It is known that the PrP polymorphism at residue 129 of the protein can significantly affect the efficiency of PrPC-PrPScconversion. Thus, the PrPScseeds from VPSPr carrying different
129-polymorphisms and the PrPCsubstrates from healthy human brain homogenates with either 129MM (hMM) or 129VV (hVV) were examined by sPMCA.
Amplification of PrPScfrom sCJDMM1 or sCJDVV2 was observed in all three rounds of sPMCA-treated samples but not in non-sPMCA-treated control samples conducted with the seed-substrate polymorphism-matched and unmatched sPMCA (Fig. 2a, b). The amplification efficiency of sCJDMM1 PrPScwas significantly greater in seed-substrate-matched than unseed-substrate-matched sPMCA (MM-MM vs MM-VV, p < 0.001) while there was no significant difference in the amplification efficiency of sCJDVV2 between the seed-substrate-matched and unmatched sPMCA (VV vs VV-MM, p > 0.05) (Fig.2a, b, TableS1).
After 6 rounds of sPMCA, PrPScfrom three genotypes of VPSPr including 129-MM, 129-VV, and 129-MV was all am-plified in normal human brain homogenates hMM (Fig.2c, e). In contrast, in hVV, PrPScfrom VPSPrMM or VPSPrVV ex-hibited significantly low efficiency while the PrPSc amplifica-tion from VPSPrMV or fCJDV180I varied (Fig.2c, e). The amplification of PrPScfrom VPSPrMM and VPSPrVV was significantly higher in hMM than in hVV substrate (p < 0.001), whereas no significant difference was observed for VPSPrMV (p > 0.05) (Fig. 2c, e). PrPScfrom fCJDV180I was amplified in both hMM and hVV substrates while it showed significantly stronger amplification in hMM than in hVV (Fig.2c, e). Notably, PrPScfrom fCJDT183Awas ampli-fied efficiently with 5–8 rounds of sPMCA in both hMM and hVV; the amplification efficiency was significantly higher in
Fig. 1 Comparison of PrPSc from VPSPr, fCJDV180I, fCJDT183A, sCJDMM1, and sCJDVV2. Representative Western blotting of untreated and treated PrPSc with different amounts of PK from sCJDMM1, sCJDVV2, fCJDT183A, VPSPrMV, and fCJDV180Iprobed with 3F4 (a) and 1E4 (b). PrPScfrom fCJDV180Iand VPSPr lacks the PK-resistant diglycosylated PrPScon the Western blotting probed with
3F4 while it has diglycosylated PrP species prior to PK treatment. It contains monoglycosylated PrP migrating at ~ 26 kDa and un-glycosylated PrP migrating at ~ 20 kDa. On the 1E4 blot (b), additional small fragments migrating at ~ 23 kDa, ~ 17 kDa, and ~ 7 kDa were detected in the PK-treated samples from fCJDV180Iand VPSPr. Molecular weight markers are shown in kDa on the right side of the blots
hVV than in hMM (p < 0.01) (Fig.2d, e), which was different from VPSPr, fCJDV180I, or sCJD. ANOVA analysis showed no differences in PrPScamplification between different seeds but significant differences between substrates (TableS1).
In sum, like sCJDMM1, PrPScfrom three genotypes of VPSPr and fCJDV180Iwas all amplified in the hMM substrate while no or less amplification in the hVV substrate. PrPSc from sCJDVV2 or fCJDT183Ashowed increased amplification in hVV than in hMM. In contrast to sCJD whose PrPSc am-plification could be observed at the first round of sPMCA, PrPScwas not amplified until 4 or 5 rounds of sPMCA in VPSPr and fCJD, suggesting that the prion seeding activity in glycoform-deficient PrPScfrom VPSPr and the two fCJD cases was lower than that from sCJD. Most surprisingly, all amplified PK-resistant PrPSc showed a predominant diglycosylated PrP isoform, although the PrPScseeds display no, or significantly decreased, such isoform in VPSPr, fCJDV180I, and fCJDT183A.
PrP
Scof VPSPr and fCJD
V180IFavorably Seeds Tg
Mice
–Derived Human PrP
C-129VV Substrate
by sPMCA, Also Forming Diglycoform-Containing
PrP
ScHuman PrPCfrom the brain homogenate of humanized trans-genic (Tg) mice expressing human PrP has been widely used as a substrate for amplification of human PrPScby sPMCA in vitro [17, 30]. To determine whether the glycoform-deficient PrPScfrom VPSPr and fCJDV180Iis amplifiable in different humanized Tg mouse brain homogenates, their PrPSc molecules were subjected to sPMCA in four different Tg mouse brain homogenates, respectively, expressing human
PrP-129VV (TgVV), PrP-129MM (TgMM), PrPV180I
(Tg180), or in vitro mixed brain homogenate from TgMM and Tg180 mice (Tg180/TgMM). Since the PrPV180Imutation is characterized with the deposition in the brain of fCJDV180I of the unique PK-resistant PrPScthat has the gel profile similar to that of PrPScfrom VPSPr, we generated humanized Tg mice expressing human PrPV180Ito determine how the muta-tion affects the PrPScformation in vitro.
We first determined amplification of classic PrPSc from sCJDMM1 or sCJDVV2 using sPMCA with the Tg mouse
brain homogenate substrates. PrPScfrom both sCJDMM1 and sCJDVV2 was amplified in the TgVV and TgMM substrates, respectively. The efficiency of amplification was significantly higher in TgVV than in TgMM substrate from both sCJDMM1 and sCJDVV2 PrPS c seeds (p < 0.01 or p < 0.0001) (Fig.3a, b, c, Table S1). Interestingly, although PrPScof sCJDMM1 or sCJDVV2 was virtually not amplified in the Tg180 substrate and less amplifiable in the TgMM substrate along, it was highly efficiently amplified in the in vitro mixed substrate of TgMM and Tg180 brain homoge-nate (p < 0.0005 or p < 0.0001) (Fig.3a, b, c, TableS1).
Similar to PrPScfrom sCJD, the amplification of PrPScof all three genotypes of VPSPr and fCJDV180Iwas highly effi-cient in the TgVV than in the TgMM substrate (p < 0.0001) (Fig. 3d, e, g, Table S1). Also no amplification was found using the brain homogenate as the substrate from Tg180 mice, although the level of PrPCin the brain of Tg180 was similar to that of PrPC in the brain of TgVV and TgMM (Fig. S2). Interestingly, amplification was rescued when TgMM sub-strate was mixed with the Tg180 mouse brain homogenate substrate (Fig. 3d, e). We also noticed that although the gel profiles of PrPScseeds are different among different genotypes of VPSPr, sCJDMM1, and sCJDVV2, a similar pattern of PrPScwas generated by sPMCA using PrPCfrom the TgVV brain homogenate as the same substrate, (Fig. 3a, b, d, e, TableS1), suggesting that the PrPCsubstrate may determine the gel profile of newly generated PrPScby sPMCA.
After 5–8 rounds of sPMCA, amplification efficiency of PrPScfrom fCJDT183Awas significantly higher in TgMM than in TgVV substrate (p < 0.0001) (Fig.3f, g), which was oppo-site to the amplification efficiency of PrPScfrom VPSPr and fCJDV180I(Fig.3d, e, g). Notably, the similar opposite effect of PrPT183Aon the PrPScamplification in the two Tg mouse– derived substrates between fCJDT183Aand all other prion dis-eases examined above including sCJD, VPSPr, and fCJDV180I was also observed in human brain–derived PrPC
substrates (Fig.2). Again, no PrPScof fCJDT183Awas amplified in the Tg180 substrate but amplification was rescued when TgMM mouse brain homogenate was mixed with Tg180 brain ho-mogenate (Fig.3f). Although PrPScfrom VPSPr, fCJDV180I, and fCJDT183Acontains virtually no diglycosylated PrPSc, the same as in human brain–derived PrPC
substrate, a dominant diglycosylated PrPScwas amplified in the Tg mouse brain– derived PrPCsubstrates as did PrPScfrom sCJD (Fig.3a, b, d, e, f, TableS1).
Taken together, as in the human brain–derived PrPC
sub-strate, PrPScfrom VPSPr and fCJDV180Iwas also amplified in the Tg mouse–derived human PrPC
substrate and the ampli-fied PrPSccontained a dominant diglycosylated PrP species. However, unlike the human brain PrPC substrate, the TgVV substrate was more susceptible to be recruited into PrPScthan the TgMM by sCJD, VPSPr, and fCJDV180Iby sPMCA. Like in the human brain substrate, PrPScfrom fCJDT183Ashowed
Fig. 2 Serial PMCA of PrPScfrom sCJD, VPSPr, fCJDV180I, and fCJDT183Ain human brain homogenate substrates. Representative Western blotting of PrPScfrom sCJDMM1 and sCJDVV2 (a), VPSPr, fCJDV180I, and fCJDT183A(c, d) amplified with 1–3, 1–6, or 1–8 rounds of sPMCA in human brain homogenate substrates from non-CJD MM (hMM) or VV (hVV) probed with the 3F4 antibody. sPMCA-R, sPMCA rounds. Molecular weight markers are shown in kDa on the left side of the blots. PK, proteinase K. b, e Bar graph showing the quantitative analyses of the intensity of PrPScamplified by sPMCA after densitometric scanning. *p < 0.05; **p < 0.01; ***p < 0.001; NS, not statistically significantthe effect of the 129-polymorphsim on PrPSc amplification opposite to that from sCJD, VPSPr, and fCJDV180I. Remarkably, while PrPScfrom none of the four human prion
diseases was able to seed the Tg180 substrate alone, it was amplified only in the substrate of combination of TgMM and Tg180 substrates.
No Small PK-Resistant PrP
ScFragments Are Amplified
by sPMCA from VPSPr and fCJD
V180Iin Both
Human-and Humanized Tg Mouse
–Derived PrP
CSubstrates
In addition to the lack of diglycosylated PrP and the PrP mol-ecule monoglycosylated at residue 181 shown by the 3F4 anti-body and other anti-PrP antibodies including the 1E4 antianti-body, another unique feature of the gel profiles of PrPScfrom VPSPr and fCJDV180I is the formation of the ladder-like five PK-resistant PrPScbands with extra small fragments detected by the 1E4 antibody [4–6,31], as shown in Fig.1. Moreover, using glycoform-specific anti-PrP antibodies Bar209 and V14, we identified the PrP molecules with N-linked glycosylation spe-cifically at residue 181 that are not converted into PK-resistant PrPSc[4]. To determine whether the PrPScamplified by sPMCA in TgVV, TgMM, Tg180, or the mixture of TgMM and Tg180 substrate contains those particular small PK-resistant fragments migrating at ~ 23 kDa, ~ 17 kDa, and ~ 7 kDa, we probed the amplified PrPScwith different anti-PrP antibodies.
When the PrPScmolecule amplified with the VPSPr and fCJDV180I seeds in the hMM or hVV substrate was probed with the 1E4 antibody, the PrP gel profiles observed were virtually the same as those detected by the 3F4 antibody with-out extra small PK-resistant PrPScfragments (Fig. 4a). The observable differences between the two blots included that the intensity of the un-glycosylated PrPSc band from all VPSPr and fCJDV180Iamplified in hMM or hVV was in-creased on the 1E4 blot compared to the 3F4 blot and the amplified PrPScin the hVV substrate became readily detect-able with 1E4 (Fig.4a with 1E4 vs Fig.2c with 3F4). When PrPScwas amplified in the TgVV or TgMM mouse substrate, notably, no typical three small PK-resistant PrPScwere detect-ed (Fig.4b). Since it is known that 1E4 has a higher affinity for PrPSctype 2 than PrPSctype 1 compared to 3F4 [14], we expected that more PrPSctype 2 was detected by 1E4 from PrPScamplified in the TgVV substrate compared to 3F4. To confirm this, we used another antibody named Tohoku 2 (T2) that specifically detects PrPSctype 2 to probe the blot [15]. As shown in Fig.S3, similar to 1E4, the intensity of the PK-resistant un-glycosylated PrP was increased compared to that shown by the 3F4 antibody, although there were some smear bands migrating under ~ 19 kDa in the TgVV or TgMM + Tg180 seeded with PrPScof VPSPrMM or VPSPrVV.
PrP
Scof VPSPr and fCJD
V180IAmplified in Human
Brain
– or Humanized Tg Mouse–Derived PrP
CSubstrates Contains Intact Mono- and Diglycosylated
PrP Species
To determine whether there is any glycoform deficiency of PrPSc amplified by sPMCA, we detected the sPMCA-amplified PrPScwith glycoform-specific anti-PrP antibodies Bar 209 and V14 [4,16]. The Bar209 antibody specifically recognizes the PrP molecule monoglycosylated at residue 197 while the V14 antibody specially recognizes the PrP molecule monoglycosylated at residue 181; both of them detect the un-glycosylated PrP molecule [4,16]. When the PrPScamplified in different brain homogenate substrates was probed with the two antibodies, the two glycoforms were detected by the two antibodies (Fig. S4), suggesting that unlike the PrPSc seeds themselves from VPSPr and fCJDV180I, both glycoforms were converted into PrPScfrom various PrPCsubstrates by sPMCA.
In Vitro Prion Seeding Activity of Glycoform-Deficient
PrP
Scfrom VPSPr and fCJD
V180IIs Detectable
by RT-QuIC Assay
RT-QuIC is another in vitro ultrasensitive assay to amplify and quantify PrPScby measuring its seeding activity [32]. Prion-seeding activity is expected to reflect the ability of PrPScto replicate in the presence of the PrPCsubstrate, characteristic of infectious prions [22,24,32]. Unlike sPMCA, RT-QuIC assay uses the recombinant PrP as the substrate instead of non-infected brain homogenate and monitors the aggregation-triggered increase in thioflavin T fluorescence in real time [24,32]. Our RT-QuIC end-point titration assay revealed that the seeding activity of PrPScfrom VPSPr and fCJDV180Iin the recombinant bank vole PrP23-231 substrate was approximate-ly 102- to 105-fold lower than that of PrPScfrom sCJDMM1 and sCJDVV2 (Fig.5). Among the three genotypes of VPSPr, fCJDV180I, and fCJDT183A, the prion seeding activity was highest in fCJDT183A, followed by VPSPrVV, fCJDV180I, VPSPrMM, and VPSPrMV according to the seeding activity at the highest dilution (Fig.5). The latter two (VPSPrMM and VPSPrMV) exhibited the similar prion seeding activity.
Discussion
The key molecular event in the pathogenesis of various animal and human prion diseases is the conversion of PrPCinto PrPSc. The molecular mechanism underlying the structural conver-sion of the two isoforms remains poorly understood, which prevents not only our understanding of pathogenesis and transmission of prion diseases between different species but also the development of efficient therapeutics for prion dis-eases. For instance, the species barriers are widely present in
Fig. 3 Serial PMCA of PrPScfrom sCJD, VPSPr, fCJDV180I, and fCJDT183Ain transgenic mouse brain homogenates. Representative Western blotting of PrPScfrom sCJDMM1 (a); sCJDVV2 (b); and VPSPr, fCJDV180I, and fCJDT183A(d, e, f) amplified with 1–3, 1–6, or 1–8 rounds of sPMCA in humanized transgenic mouse brain homogenates from TgVV, TgMM, Tg180, or TgMM + Tg180 mouse line prior to PK digestion and Western blotting probed with the 3F4 antibody. sPMCA-R, sPMCA rounds. PK, proteinase K. c, g Bar graph showing the quantitative analyses of the intensity of PrPScamplified by sPMCA after densitometric scanning. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; NS, not statistically significanttransmission of prion diseases among different species and are believed to result from a complex interplay of primary amino acid sequence, glycoform patterns, and three-dimensional structure of the PrP molecule [3].
Several lines of evidence have suggested that the individual PrP glycoforms may affect the efficiency of PrPC-to-PrPSc conversion even within the same species and individuals. Our previous work has shown, for the first time, that similar to fCJDT183A, in which the PrPT183Amutation eliminates the N-linked glycosylation at residue 181, the PrP molecules with N-linked glycosylation at residue 181, including both di- and monoglycosylated species, are not converted into PK-resistant PrPScin sporadic VPSPr and familial CJD associated with PrPV180Imutation [4, 6]. However, our study also revealed that in contrast to fCJDT183A, both VPSPr and fCJDV180I ex-hibit three intact PrP glycoforms prior to PK digestion [4,9]. Indeed, the glycoform profiles of PrPV180I mutation from transfected M17 cell lines and humanized Tg mice expressing
human PrP with V180I mutation also showed no difference from those of wild-type PrP expressed in similar cell lines and humanized Tg mice [4]. Notably, we observed that PK-resistant PrPV180I from the cultured M17 cells contained diglycosylated PrP species, which made us think that the de-ficiency in conversion of PrPCinto PrPScmay not be directly attributable to the PrPV180Imutation alone and there might be other factors that are involved in mediating the formation of this unique PrPSc isoform in vivo. Our previous findings raised two possibilities: first, the glycoform-selective prion formation observed in the brain of patients with VPSPr or fCJDV180Imay involve dominant-negative inhibition caused by the interaction between misfolded and normal PrP mole-cules; second, one or more co-factors may be operating in VPSPr and fCJDV180Iand the co-factors may prevent conver-sion of the PrPC molecules with N-linked glycosylation at r e s i d u e 1 8 1 i n t o P r PS c i n c l u d i n g b o t h d i - a n d monoglycosylated species [4,6].
Fig. 4 Serial PMCA of PrPScfrom VPSPr and fCJDV180Iin transgenic mouse brain homogenates. Representative Western blotting of PrPSc amplified with 4–6 rounds of sPMCA by seeding PrPScof VPSPrMM, VPSPrVV, VPSPrMV, or fCJDV180I in humanized transgenic mouse
brain homogenates from TgVV, TgMM, Tg180, or TgMM + Tg180 mouse line (b and c). The blots were probed with the 1E4 antibody. sPMCA-R, sPMCA rounds. Molecular weight markers are shown in kDa on the left side of the blots. PK, proteinase K
In addition, it is possible that the presence of the multiple PK-resistant PrPScfragments in VPSPr and fCJDV180Imay be associated with the dysfunction of the endoproteolytic pro-cessing event in vivo. For instance, a small C-terminal PK-resistant PrPSctermed C3 migrating at ~ 7 kDa that was be-lieved to be generated by theγ-cleavage was significantly increased in the brain of sCJD patients [33]. The ~ 7-kDa fragment, one of the three small PK-resistant PrPScfragments detected in VPSPr and fCJDV180I, is detected by 1E4 with the epitope localized between residues 97 and 105. Thus, this fragment is expected to be different from the C3 fragment generated by theγ-cleavage but more like the 7-kDa PrP ob-served in GSS.
The serial PMCA is able to faithfully amplify PrPScin vitro [23,34]. Using this ultrasensitive method, we observed that PrPScfrom VPSPr and fCJDV180I was amplified very effi-ciently using the brain homogenate substrates from TgVV, non-CJD patients with PrP-129MM, and mixed brain homog-enates with Tg180 and TgMM as well as less efficiently using TgMM and non-CJD patients with PrP-129VV. Currently, we do not know the exact reason why the PrPCfrom TgVV sub-strate is more susceptible to sCJDMM1, VPSPr, and fCJDV180IMM than that from TgMM, except for fCJDT183A. It would be interesting to compare sPMCA assay with animal-based bioassay with these cases in the future. No PrPSc am-plification was found when brain homogenate from Tg180 alone was used as the substrate. PrPScfrom fCJDT183Awas
also amplified using human hMM or hVV, TgMM, or TgMM + Tg180. Moreover, like sCJDMM1 or sCJDVV2, PrPSc am-plified from VPSPr and fCJDV180I surprisingly showed a dominant diglycosylated PrPScisoform.
Our finding is consistent with the recent observation by Peden et al. [35] in which they observed the generation of a ~ 30-kDa band corresponding to PK-resistant diglycosylated PrPScafter PMCA of PrPScfrom brain homogenates of VPSPr patients using human brain homogenate as the substrate. Notably, sPMCA of PrPScfrom fCJDT183Aalso generated a dominant diglycosylated PrPScisoform. The PrPT183A muta-tion has been shown to specifically eliminate the first N-linked glycosylation site of the protein so that the mutant PrP cannot have either the di- or the monoglycosylated form at residue 181. Bearing this in mind, it is conceivable that the PK-resistant diglycosylated PrP amplified from fCJDT183Awas most likely originated from the wild-type PrPScsince most of the fCJD patients, if not all of them, carry both mutant and wild-type alleles. Indeed, a small amount of PK-resistant diglycosylated PrPScwas observed in the brain samples from a patient with fCJDT183A, which was considered to derive from the wild-type allele [8]. Although it is unclear at the present where the diglycosylated PrPScexactly comes from and why the diglycosylated PrPSc is highly efficiently generated in sPMCA reactions seeded by VPSPr and fCJDV180Ibrain ho-mogenates, it is likely that the amplified diglycosylated PrPSc could be converted from the normal wild-type PrP as does
Fig. 5 RT-QuIC analysis of PrPScfrom VPSPr, fCJDV180I, fCJDT183A, sCJDMM1, and sCJDVV2 with the recombinant bank vole PrP109I. PrPScfrom VPSPr, fCJDV180I, fCJDT183A, sCJDMM1, and sCJDVV2 was seeded in recombinant bank vole PrP23-231 prior to RT-QuIC assay. The prion seeding activity was measured until 60 h. Different
dilution of brain homogenates from infected human brains was tested from 10−3to 10−11according to their seeding activity. The panel at the lower right corner of the figure is the scatter graph for the comparison of the maximal dilution to be detected by RT-QuIC
PrPScin fCJDT183A. On the other hand, the extra small PK-resistant PrP fragments detected specifically by the 1E4 anti-body were not amplified in either human or mouse brain ho-mogenates, consistent with the observation as well by Peden et al. [35]. The finding of no seeding activity of these 1E4-detected PrPScsmall fragments by sPMCA may echo the ob-servation of the low, or lack of, transmissibility of VPSPr observed by bioassays [10,11].
While PrPScfrom VPSPr showed highly efficient amplifica-tion in the brain homogenate of TgVV, similar to that from fCJDV180Iand sCJD, it had a poor amplification in the brain homogenate of TgMM compared to that from the two fCJD and two sCJD cases. Although the amplification of PrPScfrom all three genotypes of VPSPr with brain homogenates from TgMM or Tg180 mice alone was poor or even not at all, it was significantly increased by mixing the brain homogenates from the two Tg mice, especially for PrPScfrom VPSPr-129VV. This result seemed to contradict the observation found in the brain of patients with VPSPr, where we expected that the inter-action between wild-type and mutant PrPV180Iin the brain may prevent the conversion of the PrPCmolecules glycosylated at residue 181 to the PK-resistant PrP. Telling et al. [36] reported that the presence of wild-type PrP could delay or prevent prion formation initiated by the mutant PrP. Also, Noble et al. [37] observed that recombinant wild-type PrP in trans inhibited the spontaneous formation of a PK-resistant recombinant mutant PrP. Therefore, it is most likely that PrPScfrom VPSPr and fCJDV180Icould represent a unique prion strain that behaves differently from other common human prion strains.
RT-QuIC assay is another ultrasensitive approach for con-version of normal PrP into PrP aggregates in vitro [22,24,32]. It has been found that RT-QuIC assay is able to differentiate prion strains [22,24,35]. Unlike sPMCA, it uses recombinant PrP molecules instead of normal brain homogenates as the sub-strates and involves shaking instead of sonication to trigger the protein conversion process. The other feature of RT-QuIC is that the sequence barriers of the PrPSc-PrPCseeding are not so strict, which does seem to be different from sPMCA. For in-stance, many prion strains from different species can have fairly efficient conversion by RT-QuIC with substrates of recombi-nant hamster or bank vole PrP molecule. On the other hand, the conversion efficiency of PrP by sPMCA is mostly determined by the similarity in protein sequences, which is consistent with in vivo bioassays. Using the RT-QuIC assay, prion seeding activity was found using all genotypes of VPSPr, fCJDV180I, and fCJDT183A. Our RT-QuIC end-point titration assay indicat-ed that the prion seindicat-eding activity was approximately 102- to 105-fold lower in VPSP and fCJDV180I than in sCJDMM1 and sCJDVV2, which is consistent with the observation by Peden et al. [35] in which they observed a lower prion seeding activity in VPSPr than in sCJD.
In conclusion, our current findings indicate that like sCJD, the glycoform-deficient PrPScfrom VPSPr and fCJDV180Ican
be amplified as the typical PrPSc with intact diglycosylated species using sPMCA. It also exhibited prion seeding activity despite the lower amount than that in sCJD. The amplification efficiency of the glycoform-deficient PrPScin vitro was en-hanced by the interaction of brain homogenates from wild-type and mutant PrPC substrates. The extra three small PK-resistant PrPScfragments were not be amplified by sPMCA in vitro, suggesting that those PrPScspecies may not be highly infectious, which is consistent with the observations by in vivo animal-based bioassay reported previously. On the other hand, the inability of in vitro amplification to duplicate the unique PrPScgel profile of VPSPr and fCJDV180I with either human or humanized Tg mouse brain substrate suggests that the formation of glycoform-selective and the ladder-like PK-resistant PrPSc may be associated with an unidentified factor in the affected human brain. It would be important to exclude the possibility in the future that the unknown factor could be a second component that is able to cause prion dis-ease, as shown in other neurodegenerative diseases such as Alzheimer’s disease and amyotrophic lateral sclerosis in which there are more than one gene that are involved in the pathogenesis of the diseases.
Acknowledgements We thank all donors for brain tissues, the families affected by CJD, and the physicians for support. We also thank the CJD Foundation for its invaluable help as well as Aaron Foutz and Xiaoqing Liu for providing technique sup-port for RT-QuIC assay. This study was supsup-ported in part by the CJD Foundation and the National Institutes of Health (NIH) NS062787 and NS087588 to W.Q.Z., NS062787 and NS109532 to W.Q.Z. and Q.K., NS088604 to Q.K., the Centers for Disease Control and Prevention Contract UR8/ CCU515004 to B.S.A., and the National Natural Science Foundation of China (NNSFC) (No. 81801207) to PS, as well as NNSFC (No. 81671186) to LC.
Authors’ Contributions ZW, WQZ, and LC conceived and designed the study. ZW performed sPMCA and RT-QuIC analyses. JY performed an-imal breeding and tissue collections and Western blotting of human and animal brain samples. PS, YL, JD, AA, and LX conducted Western blot-ting analysis of human brain samples. RA and JM performed design and generation of recombinant bank vole PrP. QK performed design and generation of humanized transgenic mice (TgMM). RBP and WQZ per-formed design and generation of humanized transgenic mice (TgVV and Tg180). MM, TK, and JL provided antibodies against PrP. ZW and WQZ wrote the first draft of the manuscript. All authors critically reviewed and approved the final version of the manuscript.
Compliance with Ethical Standards
Conflict of Interest The authors declare that they have no conflict of interest.
Ethics Approval The use of human brain tissues was authorized by the Institutional Review Board, which is recognized by the Office for Human Research Protections of the US Department of Health and Human Services. The Institutional Animal Use and Care Committee and the Institutional Biosafety Committee approved all of the animal experiments used in this study.
Informed Consent The consents were received for each case through our National Prion Disease Pathology Surveillance Center.
Open Access This article is distributed under the terms of the Creative C o m m o n s A t t r i b u t i o n 4 . 0 I n t e r n a t i o n a l L i c e n s e ( h t t p : / / creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. Publisher’s Note Springer Nature remains neutral with regard to juris-dictional claims in published maps and institutional affiliations.
References
1. Lansbury PT Jr (1997) Structural neurology: are seeds at the root of neuronal degeneration? Neuron 19:1151–1154.https://doi.org/10. 1016/S0896-6273(00)80406-7
2. Prusiner SB (1998) Nobel Lecture: Prions. Prions Proc Natl Acad Sci U S A 95:13363–13383.https://doi.org/10.1073/pnas.95.23. 13363
3. Das AS, Zou WQ (2016) Prions: beyond a single protein. Clin Microbiol Rev 29:633–658. https://doi.org/10.1128/ CMR.00046-15
4. Xiao X, Yuan J, Haïk S, Cali I, Zhan Y, Moudjou M, Li B, Laplanche JL et al (2013) Glycoform-selective prion formation in sporadic and familial forms of prion disease. PLoS One 8:e58786.
https://doi.org/10.1371/journal.pone.0058786
5. Zou WQ, Puoti G, Xiao X, Yuan J, Qing L, Cali I, Shimoji M, Langeveld JP et al (2010) Variably protease-sensitive prionopathy: a new sporadic disease of the prion protein. Ann Neurol 68:162–
172.https://doi.org/10.1002/ana.22094
6. Zou WQ, Gambetti P, Xiao X, Yuan J, Langeveld J, Pirisinu L (2013) Prions in variably protease-sensitive prionopathy: an update. Pathogens 2:457–471. https://doi.org/10.3390/ pathogens2030457
7. Grasbon-Frodl E, Lorenz H, Mann U, Nitsch RM, Windl O, Kretzschmar HA (2004) Loss of glycosylation associated with the T183A mutation in human prion disease. Acta Neuropathol 108: 476–484.https://doi.org/10.1007/2Fs00401-004-0913-4
8. Nitrini R, Rosemberg S, Passos-Bueno MR, da Silva LS, Iughetti P, Papadopoulos M, Carrilho PM, Caramelli P et al (1997) Familial spongiform encephalopathy associated with a novel prion protein gene mutation. Ann Neurol 42:138–146.https://doi.org/10.1002/ ana.410420203
9. Zou RS, Fujioka H, Guo JP, Xiao X, Shimoji M, Kong C, Chen C, Tasnadi M et al (2011) Characterization of spontaneously generated prion-like conformers in cultured cells. Aging (Albany NY) 3:968–
984.https://doi.org/10.18632/aging.100370
10. Diack AB, Ritchie DL, Peden AH, Brown D, Boyle A, Morabito L, Maclennan D, Burgoyne P et al (2014) Variably protease-sensitive prionopathy, a unique prion variant with inefficient transmission properties. Emerg Infect Dis 20:1969–1979.https://doi.org/10. 3201/eid2012.140214
11. Notari S, Xiao X, Espinosa JC, Cohen Y, Qing L, Aguilar-Calvo P, Kofskey D, Cali I et al (2014) Transmission characteristics of var-iably protease-sensitive prionopathy. Emerg Infect Dis 20:2006– 2014.https://doi.org/10.3201/eid2012.140548
12. Kascsak RJ, Rubenstein R, Merz PA, Tonna-DeMasi M, Fersko R, Carp RI, Wisniewski HM, Diringer H (1987) Mouse polyclonal and monoclonal antibody to scrapie-associated fibril proteins. J Virol 61:3688–3693
13. Zou WQ, Langeveld J, Xiao X, Chen S, McGeer PL, Yuan J, Payne MC, Kang HE et al (2010) PrP conformational transitions alter species preference of a PrP-specific antibody. J Biol Chem 285: 13874–13884.https://doi.org/10.1074/jbc.M109.088831
14. Yuan J, Dong Z, Guo JP, McGeehan J, Xiao X, Wang J, Cali I, McGeer PL et al (2008) Accessibility of a critical prion protein region involved in strain recognition and its implications for the early detection of prions. Cell Mol Life Sci 65:631–643.https:// doi.org/10.1007/s00018-007-7478-z
15. Kobayashi A, Mizukoshi K, Iwasaki Y, Miyata H, Yoshida Y, Kitamoto T (2011) Co-occurrence of types 1 and 2 PrP(res) in sporadic Creutzfeldt-Jakob disease MM1. Am J Pathol 178:1309– 1315.https://doi.org/10.1016/j.ajpath.2010.11.069
16. Moudjou M, Treguer E, Rezaei H, Sabuncu E, Neuendorf E, Groschup MH, Grosclaude J, Laude H (2004) Glycan-controlled epitopes of prion protein include a major determinant of suscepti-bility to sheep scrapie. J Virol 78:9270–9276.https://doi.org/10. 1128/JVI.78.17.9270-9276.2004
17. Yuan J, Zhan YA, Abskharon R, Xiao X, Martinez MC, Zhou X, Kneale G, Mikol J et al (2013) Recombinant human prion protein inhibits prion propagation in vitro. Sci Rep 3:2911.https://doi.org/ 10.1038/srep02911
18. Kong Q, Huang S, Zou W, Vanegas D, Wang M, Wu D, Yuan J, Zheng M et al (2005) Chronic wasting disease of elk: transmissibility to humans examined by transgenic mouse models. J Neurosci 25: 7944–7949.https://doi.org/10.1523/JNEUROSCI.2467-05.2005
19. Kong Q, Zheng M, Casalone C, Qing L, Huang S, Chakraborty B, Wang P, Chen F et al (2008) Evaluation of the human transmission risk of an atypical bovine spongiform encephalopathy prion strain. J Virol 82:3697–3701.https://doi.org/10.1128/JVI.02561-07
20. Abskharon R, Dang J, Elfarash A, Wang Z, Shen P, Zou LS, Hassan S, Wang F et al (2017) Soluble polymorphic bank vole prion pro-teins induced by co-expression of quiescin sulfhydryl oxidase in E. coli and their aggregation behaviors. Microb Cell Factories 16:170–
181.https://doi.org/10.1186/s12934-017-0782-x
21. Abskharon R, Wang F, Vander Stel KJ, Sinniah K, Ma J (2016) The role of the unusual threonine string in the conversion of prion pro-tein. Sci Rep 6:38877.https://doi.org/10.1038/srep38877
22. Orrú CD, Yuan J, Appleby BS, Li B, Li Y, Winner D, Wang Z, Zhan YA et al (2017) Prion seeding activity and infectivity in skin samples from patients with sporadic Creutzfeldt-Jakob disease. Sci Transl Med 9:417–427.https://doi.org/10.1126/scitranslmed.aam7785
23. Castilla J, Saá P, Hetz C, Soto C (2005) In vitro generation of infectious scrapie prions. Cell 121:195–206.https://doi.org/10. 1016/j.cell.2005.02.011
24. Orrú CD, Groveman BR, Raymond LD, Hughson AG, Nonno R, Zou W, Ghetti B, Gambetti P et al (2015) Bank vole prion protein as an apparently universal substrate for RT-QuIC-based detection and discrimination of prion strains. PLoS Pathog 11:e1004983.https:// doi.org/10.1371/journal.ppat.1004983
25. Yuan J, Xiao X, McGeehan J, Dong Z, Cali I, Fujioka H, Kong Q, Kneale G et al (2006) Insoluble aggregates and protease-resistant conformers of prion protein in uninfected human brains. J Biol Chem 281:34848–34858.https://doi.org/10.1074/jbc.M602238200
26. Zahn R, Liu A, Lührs T, Riek R, von Schroetter C, López García F, Billeter M, Calzolai L et al (2000) NMR solution structure of the human prion protein. Proc Natl Acad Sci U S A 97:145–150.
https://doi.org/10.1073/pnas.97.1.145
27. Stahl N, Borchelt DR, Hsiao K, Prusiner SB (1987) Scrapie prion protein contains a phosphatidylinositol glycolipid. Cell 51:229–
240.https://doi.org/10.1016/0092-8674(87)90150-4
28. Baldwin MA, Stahl N, Reinders LG, Gibson BW, Prusiner SB, Burlingame AL (1990) Permethylation and tandem mass spectrom-etry of oligosaccharides having free hexosamine: analysis of the glycoinositol phospholipid anchor glycan from the scrapie prion
protein. Anal Biochem 191:174–182. https://doi.org/10.1016/0003-2697(90)90405-X
29. Parchi P, Zou W, Wang W, Brown P, Capellari S, Ghetti B, Kopp N, Schulz-Schaeffer WJ et al (2000) Genetic influence on the structural variations of the abnormal prion protein. Proc Natl Acad Sci U S A 97:10168–10172.https://doi.org/10.1073/pnas.97.18.10168
30. Concha-Marambio L, Pritzkow S, Moda F, Tagliavini F, Ironside JW, Schulz PE, Soto C (2016) Detection of prions in blood from patients with variant Creutzfeldt-Jakob disease. Sci Transl Med 8: 370ra183.https://doi.org/10.1126/scitranslmed.aaf6188
31. Gambetti P, Dong Z, Yuan J, Xiao X, Zheng M, Alshekhlee A, Castellani R, Cohen M et al (2008) A novel human disease with abnormal prion protein sensitive to protease. Ann Neurol 63:697–
708.https://doi.org/10.1002/ana.21420
32. Wilham JM, Orru CD, Vascellari S, Hughson AG, Caughey B (2013) Quaking-induced conversion assays for the detection of di-agnosis of prion diseases. In: Zou WQ, Gambetti P (eds) Prions and diseases: Vol 2, animals, humans, and the environment, 1st edn. Springer Science+Business Media, New York, pp. 223–232 33. Lewis V, Johanssen VA, Crouch PJ, Klug GM, Hooper NM, Collins
SJ (2016) Prion protein“gamma-cleavage”: characterizing a novel
endoproteolytic processing event. Cell Mol Life Sci 73:667–683.
https://doi.org/10.1007/s00018-015-2022-z
34. Morales R, Abid K, Soto C (2007) The prion strain phenomenon: molecular basis and unprecedented features. Biochim Biophys Acta 1772:681–691.https://doi.org/10.1016/j.bbadis.2006.12.006
35. Peden AH, Sarode DP, Mulholland CR, Barria MA, Ritchie DL, Ironside JW, Head MW (2014) The prion protein pro-tease sensitivity, stability and seeding activity in variably protease sensitive prionopathy brain tissue suggests molecu-lar overlaps with sporadic Creutzfeldt-Jakob disease. Acta Neuropathol Commun 2(152):152. https://doi.org/10.1186/ s40478-014-0152-4
36. Telling GC, Haga T, Torchia M, Tremblay P, DeArmond SJ, Prusiner SB (1996) Interactions between wild-type and mu-tant prion proteins modulate neurodegeneration in transgenic mice. Genes Dev 10:1736–1750.https://doi.org/10.1101/gad. 10.14.1736
37. Noble GP, Walsh DJ, Miller MB, Jackson WS, Supattapone S (2015) Requirements for mutant and wild-type prion protein misfolding in vitro. Biochemistry 54:1180–1187.https://doi.org/ 10.1021/bi501495j