Index Table of contents
837
Towards the Development of Sequence Based Markers
for Resistance to Coffee Berry Disease (Colletotrichum kahawae)
E.K. GICHURU1, M.-C. COMBES2, E.W. MUTITU3, E.C.K. NGUGI3,
C.O. OMONDI1, B. BERTRAND4, P. LASHERMES2
1Coffee Research Foundation (CRF), P O Box 4, Ruiru 00232, Kenya
2Institut de Recherche pour le Développement (IRD), UMR DGPC, Résistance des Plantes, 911, Av. de Agropolis, BP 64501, F-34394, Montpellier, France
3University of Nairobi, P O Box 29053, Nairobi, Kenya
4Centre de coopération Internationale en Recherche Agronomique pour le Développement, (CIRAD-CP). UMR-DGPC, IRD, 911 Av. de Agropolis, BP 64501, F-34394,
Montpellier, France
SUMMARY
Coffee Berry Disease which affects green Arabica coffee (Coffea arabica) berries is caused by the fungus Colletotrichum kahawae and is a major problem in Arabica coffee production in African countries. Breeding for resistance to this disease is therefore to a major priority in these countries avoid intensive chemical usage for its control. Recently, microsatellite and Amplified Fragment Length Polymorphisms (AFLP) markers for a gene conferring resistance to the disease were identified and mapped onto the chromosomal region carrying the gene. To improve the repeatability of the AFLP markers, four of the marker bands were selected for cloning and sequencing to facilitate specific primers to be designed. Three of the resultant primers did not amplify products that exhibited polymorphism characteristic of the parent AFLP bands; but one primer pair amplified a product that dominantly identified the presence of the parent AFLP marker at an optimum temperature of 62 °C followed by electrophoresis in agarose. The reliability of the designed primers was confirmed by analysis in 95 plants from a F2 population previously used to map the chromosomal fragment carrying the resistance. The importance of the results in enhancing the utility of the parent AFLP marker in relation to analytical costs and position on the chromosomal fragment is discussed.
INTRODUCTION
Coffee is an important export crop and a major foreign currency earner for many countries located in the tropical areas of Africa, Asia and Latin America. Arabica coffee (Coffea
arabica L.) accounts for about 75% of the total world coffee production and the rest is mainly
Robusta coffee (Coffea canephora Pierre). One of the major constraints of coffee production includes disease epidemics. Disease management is an especially limiting factor to economic coffee production by smallholders due to limitation of financial and technical capabilities (Masaba and Waller, 1992). Among the most important coffee diseases is Coffee Berry Disease (CBD) which currently occurs only in Africa. This is an anthracnose of coffee berries that is caused by the fungus Colletotrichum kahawae. Infection of green immature fruits by the fungus can cause up to 80% crop loss if not controlled when conditions are favourable (Griffiths et al., 1971). An alternative strategy for its management by breeding for resistance is highly desirable due to low cost to producer and environmental safety.
Inheritance studies by Van der Vossen and Walyaro, (1980) identified three genes of resistance carried in varieties Rume Sudan (R and k genes), Hibrido de Timor (T gene) and K7
838
(k gene). Hibrido de Timor (HDT) is natural cross between Arabica and Robusta (C.
canephora) coffees and is widely used for breeding programmes especially for pest and
disease resistance including Coffee Leaf Rust, CBD and nematodes (Lashermes et al., 2000; Silva et al., 2006). For example in Kenya, a breeding programme involving HDT led to the release of an Arabica coffee cultivar (cv Ruiru 11) that combines resistance to CBD and CLR with high yields, fine cup quality and compact growth (Nyoro and Sprey, 1986). This cultivar is a composite of about 60 hybrids, each derived from a cross between a specific female and male population (Omondi et al., 2001). The population is therefore not genetically uniform, raising a need to conduct molecular studies to identify markers that can help in tracking the genes in breeding programmes (marker assisted selection: MAS).
Recent work by Gichuru et al. (2006, 2008) mapped the T gene within a chromosomal fragment of about 10 cM that is introgressed into C. arabica from C. canephora through HDT. The molecular markers identified included two microsatellites and nine Amplified Fragment Length Polymorphism (AFLP) bands. AFLP markers are not very specific to DNA sequences of the genome under study and are therefore not highly repeatable over time and between laboratories (Rafalski et al., 1996). The reproducibility of AFLP markers can be improved by converting them into Sequence Characterised Amplified Regions (SCARs). This technique involves sequencing of markers (DNA fragments) and designing primers that are specific to the parent loci. The subsequently amplified products can be analysed under more stringent PCR conditions, may maintain the polymorphism of their parental markers, may exhibit different polymorphism like co-dominance while the parent markers were dominant, or even loose the polymorphism (Shan et al., 1999; Zhang and Stommel, 2001). Another reason for conversion of markers such AFLPs to SCARs is the possibility of the resultant markers being easier and cheaper to analyse than the more sophisticated procedures such as AFLP. The objective of this study was therefore to develop SCAR markers from AFLP markers linked to resistance to CBD.
MATERIALS AND METHODS Extraction of DNA from AFLP bands
Four AFLP markers linked to resistance to CBD (Gichuru et al., 2008) were selected for this study based on size (more than 100bp) and clear separation from other bands. Genomic DNA from seven plant samples consisting of a susceptible parent cultivar (SL28), a resistant parent cultivar (Catimor) and five F2 progeny of their cross was amplified with the appropriate selective AFLP primers used by Gichuru et al. (2008). During electrophoresis, a 62-well comb with alternate teeth removed to give double sized wells was used. Ten micro-litres of each sample were loaded and after electrophoresis, the dried gels were stapled onto the films before placing them into the cassettes to avoid movements between the two. To extract the DNA from the bands of interest, the developed films and the gels were re-matched, pieces of the dry gel were cut from at least two of the F2 plants with the target band and soaked PCR grade water as detailed in Gichuru (2007). The resultant DNA solution was amplified in 25 µl reaction mixtures containing 2 µl of the DNA solution, 2.5 µl of 10X buffer, 2.0 µl of MgCl2 (25 mM), 0.5 µl of dNTPs (5 mM), 0.6 µl of each of the primers used to amplify the particular bands during AFLP (10 µM), 0.1µl of Taq DNA polymerase and 16.7 µl of PCR water. The PCR programme consisted of an initial denaturation step of 5 minutes at 95 °C followed by 35 cycles of denaturation at 94 °C for 45 sec, primer annealing at 50 °C for 45 sec, elongation at 72 °C for 45 sec and a final extension step of 10 min at 72 °C. Two micro-litres of the amplification products were electrophoresed in 2% agarose gel and revealed in ethidium bromide. Only samples with one clear band were judged to be good for cloning and two of the samples with high intensity bands were selected for cloning.
839
Cloning DNA extracted from AFLP bands
The fresh PCR products were cloned using TOPO TA Cloning® kit with pCR® 2.1-TOPO® vector and chemically competent cells (Invitrogen, Life Technologies) according to the manufacturer’s instructions. The cultures were then tested for inserts by PCR using 2 µl of the liquid culture and the same reaction mix as the one used to amplify the AFLP DNA before cloning. The PCR programme was also the same as during amplification of extracted AFLP DNA but the initial denaturation step was increased to 10 min, to ensure adequate rupturing of the bacterial cells to release the plasmids. To assess the inserts, 2 µl of the PCR products were electrophoresed in 2% agarose gel alongside a sample of the PCR product used for cloning to ascertain that the size of the cloned fragments were the ones targeted. Clones with inserts of different sizes from the targeted fragments and those without inserts were discarded. A maximum of four and a minimum of two clones with the right size of insert per individual cloning reaction (depending on availability) were selected for extraction of plasmid DNA for sequencing commercially by Genome Express, France. In all cases, the sequenced bands included two different plants samples.
The actual plant DNA sequences were identified from the entire sequences to exclude AFLP primers and vector sequences. Replicate sequences of the same band were aligned using CLUSTAL W 1.82 programme (European Bioinformatics Institute, http://www.ebi.ac.uk/ clustalw). Only sequences that were highly similar were considered as allelic. Sequence specific primers were designed from one of the alleles of the same band using Primer3 programme (Whitehead Institute, USA, http://frodo.wi.mit.edu/cgi-bin/primer3/primer3 www.cgi). The parameters considered in designing the primers targeted sizes between 18 and 22bp and optimum annealing temperature of 55 °C or 60 °C, so that they could all be analysed under the same PCR conditions.
The primers (synthesised by Eurogentec, Belgium) were first tested for performance and possible polymorphism in 2% agarose gels as described by Poncet et al. (2005). Where amplification was successful but without polymorphism in agarose, further amplification was done using a radioactive nucleotide (αdATP33) followed by electrophoresis in 6% denaturing acrylamide gel as described by Combes et al. (2000). Once polymorphism was observed, reliability of the marker was confirmed by analysis on the 95 plants used by Gichuru et al. (2008) to map the chromosomal fragment.
RESULTS
Four AFLP markers linked to resistance to CBD were cloned, sequenced and loci-specific primers designed. SCARs were amplified using the primers and tested for polymorphism related to CBD resistance in agarose and denaturing poly-acrylamide gels. One primer pair amplified non-specific products (a smear) and two primer pairs amplified products that did not exhibit any polymorphism between plants with and without the parental AFLP band. However, the fourth one designed from the AFLP marker AGC-CTG-c (Gichuru et al., 2008) appeared to be more intense in samples with the parent AFLP marker than in samples without the marker when amplified at 60 °C (Figure 1A). More tests at different annealing temperatures and electrophoresis in denaturing poly-acrylamide gel were done to confirm if the difference was due to primer mismatch which can be exploited by altering the annealing temperature or due to multiple products in plants with the parent marker. Reduction of the annealing temperature to 55 °C resulted into PCR products that did not appear to have differences between plants with and without the parent AFLP band (Figure 1B). At an annealing temperature of 62 °C, only samples with the parent AFLP marker were amplified (Figure 1C). At a higher temperature of 64 °C, the intensity of the bands decreased (Figure
840
1D). The marker was designated ‘ScAGC-CTG-c’ by adding ‘Sc’ to denote SCAR. Its reliability was tested by amplification in all the 95 plants from the F2 population used to map the resistance and it amplified as expected. The sequences of the primers are ACCTATCAGAGGGGAATTTG (forward) and GGTGATGAGGTACAGTT GCT (reverse).
Figure 1. PCR products of the ScAGC-CTG-c SCAR from plants with and without the parent AFLP marker (AGC-CTG-c +) and those without the marker (AGC-CTG-c ) at different annealing temperatures.
DISCUSSION
Four AFLP markers for resistance to CBD were sequenced and specific primers designed. One pair of primers amplified non-specific products that were revealed as a smear in 2% agarose. Two other pairs amplified products which were not polymorphic between plants with and without the parent AFLP bands. The fourth pair from the AFLP band AGC-CTG-c (Gichuru et al., 2008) amplified a SCAR (ScAGC-CTG-c) that identified the presence of the parent marker in a dominant manner. The amplification of the SCAR was sensitive to annealing temperature and the optimum temperature to detect the polymorphism in this study was 62 °C (Figure 1). The conversion of AFLP markers into SCAR markers is not often successful as also observed other workers such as Shan et al. (1999) in wheat and barley and Diniz et al. (2005) in coffee. The most effective parameters in optimization of PCR results are annealing temperatures and concentration of Mg++ ions (Zhang and Stommel, 2001). The success of achieving polymorphism by alteration of annealing temperature depends on the degree of mismatch between the primers and DNA sequences. An optimum is achieved between low temperatures that amplify all samples and higher temperatures that lead to unreliable results as observed in this study. For successful use of this marker, pre-testing to optimise and ascertain the difference in amplification is due to genetic factors and not due to technical factors is recommended. This is because the temperature regimes of different thermocyclers in different conditions might affect the results. It is also important to ensure that lack of amplification is not due to technical attributes of the DNA sample such as its quality. Currently the analysis of ScAGC-CTG-c has been successfully demonstrated in Coffee Reaseach Foundation, Kenya
The marker is dominant and therefore less informative than co-dominant markers but is as informative as the parent AFLP marker. However it has the advantage of being analysed in agarose and revealed by ethidium bromide which makes it suitable for use in laboratories lacking in the higher skills and equipments/reagents required for AFLP analysis. The utility of ScAGC-CTG-c is especially high in breeding programmes due to its position in the
841
chromosomal fragment carrying the CBD resistance gene in relation to two microsatellites mapped onto the same chromosomal fragment (Gichuru et al., 2008). Use of the three markers will enable selection of recombinant plants on both sides of the gene, which will be useful both for MAS breeding and collection of recombinant plants for finer mapping. The markers will be of importance for breeding even in regions which do not have CBD.
ACKNOWLEDGEMENTS
This study was supported financially by IRD, France, EU (CBDRESIST Project) and CRF, Kenya. Technical assistance from IRD, CRF and CIRAD staff is gratefully appreciated. The presentation of this paper was supported financially by CTA through the ASIC 2008 Organisers (Contract CTA/ASI-Project No 2-8-23-308-8). This paper is published with the permission of the Director of Research, CRF.
REFERENCES
Combes M.C., Andrzejewski S., Anthony F., Bertrand B., Rowelli P., Graziosi G. and Lashermes P. (2000). Characterization of microsatellite loci in Coffea arabica and coffee species. Mol Ecol 9: 1178-1180.
Diniz L.E.C., Sakiyama N.S., Lashermes P., Caixeta E.T., Oliveiera, Zambolin E.M., Loureiro M. E., Pereira A. A. and Zambolin L. (2005). Analysis of AFLP markers associated to the Mex-1 locus in Icatu progenies. Crop Breed Applied Biotech 5: 387-393.
Gichuru E.K., Combes M.-C., Mutitu E.W., Ngugi E.C.K., Bertrand B., Lashermes P. (2006) Characterisation and genetic mapping of a gene conferring resistance to coffee berry disease (Colletotrichum kahawae) in Arabica coffee (Coffea arabica L.) 21st International Scientific Colloquium on Coffee. (Montpellier, France, 11-15th September)
Gichuru E.K. (2007) Characterization of genetic resistance to Coffee Berry Disease (Colletotrichum kahawae Waller and Bridge) in Arabica coffee (Coffea arabica L.) that is introgressed from Coffea canephora Pierre. PhD Thesis University of Nairobi, Kenya, 225p.
Gichuru E.K., Agwanda C.O., Combes M.C., Mutitu E.W., Ngugi E.C.K., Bertrand B. and Lashermes P. (2008). Identification of molecular markers linked to a gene conferring resistance to coffee berry disease (Colletotrichum kahawae) in Coffea arabica L. Pl. Path. (Online puplication)
Griffiths E., Gibbs J.N. and Waller J.M. (1971). Control of coffee berry disease. Ann Appl Biol. 67: 45-74
Lashermes P., Andrzejewski S., Bertrand B., Combes M.C., Dusert S., Graziosi G., Trouslot P. and Anthony F. (2000). Molecular analysis of introgressive breeding in coffee (Coffea arabica L.) Theor Appl Genet 100: 139-146.
Masaba D.M. and Waller J.M. (1992). Coffee Berry Disease: The current status. In: Bailey, J. A. and Jerger, M. J. (Eds), Colletotrichum; Biology, pathology and control. CABI Wallingford. UK. pp 237-249.
Nyoro J.K. and Sprey L.H. (1986). Introducing Ruiru 11 to estates and smallholders. Kenya Coffee 51: 7-28.
Omondi C.O., Ayiecho P.O., Mwang’ombe A.W. and Hindorf H. (2001). Resistance of
Coffea arabica cv Ruiru 11 tested with different isolates of Colletotrichum kahawae,
842
Poncet V., Hamon P., Sauvage de Saint Marc M.B., Bernard T., Hamon S. and Noirot M. (2005). Base composition of Coffea AFLP sequences and their conservation within the genus. Journal of Heredity 96: 59-65.
Rafalski J.A., Vogel J.M., Morgante M., Powell W. Andre C. and Tingey S.V. (1996). Generating and using DNA markers in Plants. In: Non-mammalian genomic analysis: A practical guide (Biren, B. and Lai, E., Eds), Academic Press Inc. New York p 75-134. Shan X., Blake T.K. and Talbert L.E. (1999). Conversion of AFLP markers to sequence
specific PCR markers in barley and wheat. Theoretical and Applied Genetics 98: 1078.
Silva M.C., Varzea V., Guerra-Guimaraes L., Azinheira H.G., Fernandez D., Petitot A.-S., Bertrand B., Lashermes P. and Nicole M.(2006). Brazilian Journal of Plant Physiology 18: 119-147.
Van der Vossen H.A.M. and Walyaro D.J. (1980). Breeding for resistance to coffee berry disease in Coffea arabica L. Inheritance of the resistance. Euphytica 29: 777-791.
Zhang Y. and Stommel J.R. (2001). Development of SCAR and CAPS markers linked to the
