Article
Reference
Nature and origin of the RNA associated with simian virus 40 large tumor antigen
DARLIX, Jean-Luc, KHANDJIAN, Edouard W., WEIL, Roger
Abstract
Simian virus 40 (SV40) large tumor (T) antigen isolated from mammalian cells undergoing lytic or transforming infection is associated with small RNA fragments ("T-antigen RNA") that are protected from nuclease digestion. The rather high complexity of the ribonuclease T1 fingerprints of T-antigen RNA suggested that it is mainly derived from cellular heterogeneous nuclear RNAs. In the present study, 5'-32P-labeled T-antigen RNA was hybridized to monkey, mouse, and human Alu and SV40 DNA, and the nucleotide sequence of 37 T1 oligonucleotides was determined. The results suggest that the bulk of T-antigen RNA is derived from noncoding, double-stranded, ordered regions of cellular heterogeneous nuclear RNAs that exhibit sequence homologies with interspersed repetitive elements of the cellular genome. The possible biological implications of these results are discussed.
DARLIX, Jean-Luc, KHANDJIAN, Edouard W., WEIL, Roger. Nature and origin of the RNA associated with simian virus 40 large tumor antigen. Proceedings of the National Academy of Sciences, 1984, vol. 81, no. 17, p. 5425-5429
DOI : 10.1073/pnas.81.17.5425
Available at:
http://archive-ouverte.unige.ch/unige:127863
Disclaimer: layout of this document may differ from the published version.
Proc.Natl. Acad. Sci. USA
Vol. 81, pp.5425-5429, September1984 Cell Biology
Nature and origin of the RNA associated with simian virus 40 large tumor antigen
(heterogeneous nuclearRNA/posttranscriptional regulation/control of cell proliferation)
JEAN-LUC DARLIX, EDOUARD
W. KHANDJIAN, AND ROGERWEIL
Department of Molecular Biology, University of Geneva, 30, Quai Ernest Ansermet, 1211 Geneva 4, Switzerland Communicated byV. Prelog, April9, 1984
ABSTRACT Simian virus 40(SV40) largetumor (T) an- tigen isolated frommammalian cells undergoing lytic or trans- forming infection isassociated with small RNA fragments("T- antigen RNA") that are protected from nuclease digestion.
Therather high complexity of theribonuclease T1rmgerprints of T-antigen RNA suggested that it is mainly derived from cellularheterogeneous nuclear RNAs. In the present study, 5'-
32P-labeled
T-antigen RNA was hybridized to monkey, mouse, and human Alu andSV40 DNA, and the nucleotide sequence of 37 T1 oligonucleotides was determined. The results suggest that the bulk of T-antigen RNA is derived from noncoding, double-stranded, ordered regions of cellular heterogeneous nuclear RNAs that exhibit sequence homologies with inter- spersed repetitive elements of the cellular genome. The pos- siblebiological implications of these results are discussed.Simian virus 40 (SV40) induces in a
variety
of mammalian cells a broad spectrum ofbiological, immunological, and molecular effects (1-3). Studies with SV40 deletion mutants (4-6) showed thatmostoftheseeffects, includingthevirus- induced mitotic host reaction (ref. 7; unpublished results), areunder thecontrol ofasingle viral protein,theSV40large Tantigen (Mr 88,000) encoded by the earlygeneof SV40(8, 9). Fromin vitrostudies, itwasconcluded that SV40 largeT antigen is a DNA-binding protein that interacts with theorigin
ofreplication
ofSV40DNA(10). SV40 largeTantigen
isolated frommonkey
or mousekidney
tissue culture cells undergoing lytic or transforming infection, respectively, is associated with small RNA fragments("T-antigen
RNA") which areprotected from nuclease digestion. Ribonuclease T1fingerprint analysis
of isolatedT-antigenRNArevealeda rather highcomplexity,
and the patterns obtained with T-antigen
RNA frommonkey
or mousekidney
cells were similar butnotidentical. These earlier resultssuggested
that T-antigen RNAismainly derived
from cellularheterogene- ousnuclearRNAs(hnRNAs)
ormRNAs, andthey
excludedT-antigen
RNAfrombeing
afortuitous contamination with cellularRNA(11).
Todetermine thenatureand
origin
ofT-antigen
RNA,wehybridized
5'-32P-labeledT-antigen
RNAtocellularandSV40 DNA;subsequently,
weestablishedthenucleotidesequence of 37unique
T1oligonucleotides
derived fromT-antigen
RNA.MATERIALS
ANDMETHODS
Infection withwild-type SV40 of CV-1
monkey kidney
cell cultures, in the presenceof1-,8-D-arabinofuranosylcytosine (araC)
at20,g/ml,
and ofconfluentprimary
mousekidney
cellcultures,
isolation of SV40large
Tantigen (18
hrafterinfection),
andextraction ofT-antigen
RNA(with proteinase
Kandphenol)
wereperformed
asdescribed(11).
Ascontrols("RNA control"; ref. 11), we used strips from parallel gels loaded with immunoprecipitates from mock-infected CV-1 (see Results) or mouse kidney (not shown) cell cultures.
RibonucleaseT1fingerprintanalysis of T-antigen RNA gave the same results whether T antigen was purified by NaDodSO4/polyacrylamide gel electrophoresis (11) or by immunoaffinity chromatography only(unpublished data). T- antigenRNAand the T1oligonucleotideswere5'-32P-labeled asdescribed (11,12).SV40, monkey,andmouseDNAs were isolated and purified by standard methods; they were di- gested with restrictionnucleases and subjected to electropho- resisinagarose slab gels as described in the legends of Figs.
1 and 2. The plasmids pBR322 containing a human Alu sequence (BLUR8) or a complete SV40 genome were iso- lated and purified by conventional methods (13). Dot-blot hybridization wasperformed as described by Kafatos et al.
(14).Thefiltersweretreated priortohybridizationfor 5 hr at 66°C in5x
NaCl/P1/EDTA
medium(1x = 180 mMNaCl, 10 mM NaH2PO4, 1 mM EDTA, pH 7.4) containing 0.5%NaDodSO4, 5x Denhardt's solution (1x = 0.02% polyvi-
nylpyrrolidone/0.02% Ficoll/0.2%
bovine serum albumin), 50,goftRNA perml, 200,ugof denatured calf thymusDNA or polyA per ml, and 0.1% sodium pyrophosphate. Under standard conditions,hybridization
of5'-32P-labeled
T-anti- gen RNA(specific radioactivity,107
cpm/,ug) withSV40and cellularDNA was for 12 hr. Restrictionfragments of SV40 and cellularDNAs were transferred onto nitrocellulose fil- ters (15) and then pretreated and hybridized with5'-32p-
labeledT-antigenRNA asdescribed above and forthelengths of time indicated in thelegends ofFigs. 1-3. Afterhybridi-
zation, the filters were washed under stringent conditions (15), the last stepincluding incubation with RNase A at10,ug/ml
in 0.1xNaCl/Pi/EDTA
at30°C
for 60 min. Auto- radiography with a screen was at -70°C forthe lengths of time indicated in the legendsto thefigures.To measure the amounts of double-stranded RNA,5'-32P-labeled T-antigen
RNA was incubated in 50 mM TrisHCl,
pH7.5/150
mM NaCl withRNase A at 10,ug/ml
at37°C
for30min,andthe amount of nuclease-resistant radioactive RNA was mea- suredeitherbyprecipitation
from 5%(wt/vol)
trichloroace- tic acidoniceorbyelectrophoresis
inpolyacrylamide (20%o acrylamide)
slab gels. RNA was sequencedby
therapid enzymatic
method (16, 17). Nucleotide sequencecompari-
sons were carried out with a Hewlett-Packard computer using the European Molecular BiologyOrganization's
se- quence databank.RESULTS
T-Antigen RNA Contains Double-Stranded
Snapback
Se- quences. About 30% of5'-32P-labeled T-antigen RNAmonkey
and 15% of
T-antigen RNAmouse corresponded
to double- stranded RNAasjudged by
its resistancetodigestion
at37°C
with RNase A. Thesamerelativevalueswereobtained if the
Abbreviations: SV40, simian virus40; T antigen, SV40 tumoran-
tigen; hnRNA, heterogeneous nuclearRNA; nt, nucleotide(s).
Thepublicationcostsof this articleweredefrayedin partbypagecharge payment. Thisarticlemusttherefore beherebymarked"advertisement"
in accordance with18U.S.C. §1734 solelytoindicatethis fact.
Proc. Natl. Acad. Sci. USA 81 (1984) TaqI
HindJ
a b Hinf I Aval[
a b a b Control
1330 1768- f 1830-A 1580 1264- 11101- 1085-U 952
610-1- ~737-1 765-u~665-i985-
396-35432-i 47 525- 40
SV40DNA- (nt) RNA's
monkey 3
mouse 3
* FIG. 1. Hybridization of5'-32P-labeled T-antigen RNA
237- to restriction fragments ofSV40DNA. SV40 DNA (2.5
ug
215- per assay) was treated with the restriction nucleases indi-
cated. DNAfragments, separated by electrophoresis in a 1.7%agarose gel,were transferred onto a nitrocellulose fil- g 0O O o s ter. Hybridization with5 x 104 cpm of 5'-32P-labeled T-an- - 1 1 * e I 4 Jn >
tigen RNAmonkey
per ml(lanes
a), 3 x 104 cpm of 5'-32P- VP2RNA.,O,,-
labeledT-antigen per ml (lanes b), and 1 x 104VP3 cpmof "control RNA" (see Materials andMethods) per ml
vP1 wasfor 12 hr, and autoradiography was for 24 hr (monkey
T T and mouse) or 10 days (control). Hybridization was quan-
t tified by scanningthe autoradiographs at 630 nm and by in- tegrating the peaks. The radioactive signals (+, + +, and ++ + +
+++I
++ + ++++ correspondingtoweak, medium, or strongsignals)I++ Eare localized on thephysical map of SV40 DNA. The sizes
+ ++ ++ + +E of the DNA restriction fragments are given in nucleotide
pairs.
RNA preparations were denatured by boiling for 1 min before RNasetreatment,indicatingthat thedouble-stranded RNAcorrespondedtosnapbacksequences. Preincubationat 66°C for 12 hr increased RNase resistance only slightly, to 35% for T-antigen RNAmonkey and to 20% for T-antigen RNAmouse, asdetermined in repeated experiments (datanot shown). These values may be underestimates of double- strandedness ofT-antigen RNA (18).
Dot-Blot Hybridization of T-Antigen RNA toCellular and SV40 DNA.Monkey, mouse, andSV40DNA, respectively,
were spottedonto nitrocellulose filters and hybridized with 5'-32P-labeled T-antigen RNA (14). In several individualex- periments, we varied the concentration ofT-antigen RNA from
104
to 107 cpm/ml and the time ofhybridization from 6 to 48 hr. Taking into account the relative complexities of cellular(106 kilobases) and SV40 DNA (5.2 kilobases), weconcluded from theresults that the bulk ofT-antigen RNA hybridizedtocellularDNA, whereas about 15% of T-antigen RNAmonkey and 5% of T-antigen RNAmouse hybridized to SV40DNA(data not shown).
Hybridization of T-Antigen RNA toRestriction Fragments ofSV40 DNA. 5'-32P-labeledT-antigen RNA washybridized to Southern blots (15) ofSV40DNA. T-antigen RNAmonkey hybridized strongly (Fig. 1)tofragments specifying: (i) the 5' noncoding region of the late viral RNAs, (ii) the 3' noncoding
region of VP2 and VP3 viral RNAs overlapping with the
sequencecoding VP1,(iii) the 3' end of the late viral RNAs and, (iv) the 5' noncoding region of the early viral RNA. T- antigen RNAmonkey thus hybridized predominantly to non-
coding regions of SV40 DNA. Similarresultswereobtained with T-antigen
RNAmOuSe,
although the radioactive signalswere weaker (Fig. 1).
Hybridization ofT-AntigenRNA to RestrictionFragments ofMonkey and Mouse DNA. To determinewhetherT-antigen RNAwas derived from slightly, moderately, orhighly re-
petitive sequences of the cellular genome (19-21), we hy- bridized 5'-32P-labeled T-antigen RNAmonkey and T-antigen RNAmouse to Southern blots of monkey or mouse DNA fragments obtained by treatment with various restriction nucleases (Fig. 2). After a short incubation (12 hr) and autoradiography (12 hr), severalstrongsignalsweredetected that most likely reflected hybridization to moderately or highly repetitive DNA sequences. When incubation was
extendedto24 hr and autoradiographyto48 hr, additional, rather faintsignals wereobserved thatmayreflect hybridi- zationtosequencespresentin lowercopynumbers(datanot shown). These results suggested that cellularsequencesinT- antigen RNA originated mainly from transcripts of moder- ately orhighly repetitive DNA sequences.
Hybridization ofT-antigen RNAmonkeytoAlu 1 fragments T-antigen RNA(monkey)
2 3 4 5 6 7 8
- _ a-
1768-
1100-
775-
447- 215-
* it
aIa
T-antigen RNA(mouse) 2 3 4 5 6 7 8
,. ft.* _af_ oft
-IVsr
&840 #
,tJ
If
Control
FIG. 2. Hybridization of 5'-32P-labeled T-antigen RNA to restriction fragments of monkey and mouse DNA. Cellular DNA (5 ,g perassay; monkeyDNA in lanes1, 3,5, and 7andmouseDNA inlanes2, 4, 6,and 8)wastreated withAlu 1(lanes 1 and2),BamHI (lanes 3 and4), EcoRI (lanes5and6),orHindIII(lanes 7and 8); fragmentswereseparatedina1.7%agarosegel,trans- ferredontoanitrocellulosefilter,andhybridizedwith5'- 32P-labeledT-antigen RNA as described. Autoradiogra- phy was for 24 hr (monkey), 72 hr (mouse), or 2 wk (control).
MboIa b
p
zEr
.cr
C4,Z
5426 Cell
Biology:
Darfixetal.Proc. Natl. Acad. Sci. USA 81 (1984) 5427
/ -- - FIG. 3.
Hybridization
of5'- -n-/.,- 32P-labeled T-antigen RNA to4 cloned human Alu DNA. For
X , hybridization 0.5, 1.5, 3, and 6
z 8 ,gof BLUR8 DNA per dot was
X Q2 ' used with 1.8 x
i0s
cpm of T-0, antigen RNAnonkey (o) or 6 x
antigen
RNmonky(a)ori105
cpm of T-antigen RNAmouse(0)
per ml. Hybridization was 1 2 3 4 5 6 for 12hrunder standard condi- DNA,,utgperdot tions.ofmonkey DNA gave strong signals at 300-450 nucleotides (nt) suggesting that afractionof T-antigen RNAmonkey origi- natedfrom Alusequences that are interspersed in thecellular genome (22, 23). BamHI or HindIII DNA fragments gave only a few distinct signals. In contrast, hybridization with EcoRIfragmentsresultedinadistinctladder, suggesting that partof T-antigenRNAmonkey originated from repeated EcoRI (orHaeIII) elementsofmonkey DNA (21). Hybridization of T-antigen RNAmonkey to Alu 1 fragments of mouse DNA again gave distinct signals at 300-450 nt, corresponding to those obtained with monkey DNA; however, other radio- active signals observedwith monkey DNA were either weak orabsent, and several faintsignals were detected with mouse DNAthatwere
absent
in monkey DNA (see Fig. 2,lanes 1 and 2, atabout 1kilobase). Hybridization of T-antigen RN- Amouse to monkey or mouse DNA (Fig. 2, lane b) gave distinct signals corresponding to Alu type and EcoRI se- quences, whereas the other signals differed from those ob- tained withT-antigenRNAmonkey,
suggesting that T-antigen RNAcontained sequences homologous toAlu DNA. Since Alu DNA ofa variety of mammalian species contains ex- tensive homologies (23), we hybridized5'-32P-labeled
T- antigenRNAwith cloned humanAluDNA. From theresults in Fig. 3, representative ofa typical experiment, and from those obtained by varying the concentration of T-antigen RNA and the time of hybridization (data not shown), we concluded that 6 + 2% of the sequences in T-antigen RNAmonkeyand 3 + 1%in T-antigenRNAmousehybridized to humanAlu
DNA.T-antigen RNA(mouse) T-antigen RNA
CL~~ ~ ~ ~ ~ ~ .
C'4
0 x-
I
10% PAGE in 7 M urea,pH3.5Nucleotide Sequence Analysis of T-Antigen RNA. The T1 oligonucleotides in Fig. 4 indicated by broken circles were sequenced (16, 17); the results oftwo sequencedetermina- tions are shown in Fig. 4c (the arrowheads in Fig. 4b indicate thecorrespondingoligonucleotides).The sequences of 37 T1 oligonucleotides are presented in Fig. 5.
Nucleotide Sequence Homologies Between T-Antigen RNA and SV40 DNA. T1 oligonucleotide sequences were com- pared bycomputeranalysis with both strands of SV40 DNA (24). The results(Fig. 6) revealedhomologiesthat,with one exception,were incomplete: homologies(-9 nt)betweenT- antigen RNAmonkey and SV40 DNA map in (i) the RNA transcripts ofthe late mRNA at nt 260, 381, and 397, the last position correspondingto the attenuatorsite ofVP1 mRNA (25), (ii)the 3' noncodingregion in the16S late mRNA at nt 2350, 1833, and 1599, the last position including the UAA termination codoncommon to VP2 and VP3 and/or to the 19S mRNAcodingregion, (iii) the 3' end of the nuclear late RNA at nt 3099, (iv) the 3' noncoding region of the early RNA atnt 2627,and(v) partof the intron sequence common toboth small andlarge T antigen at nt 4602. The (complete) homology at nt 609 is situated in the anti-late RNA. Se- quence homologies with T1 oligonucleotides of T-antigen RNAmouse arelocated in noncoding regions of SV40DNA (nt 3873, 4266, and4415in the late strand and 1909intheearly strand) andalso intworegions encodinglarge Tantigen(nt 3721 and 2688). Homologies, though incomplete, are thus mainly observed in noncoding regions ofthe primary viral transcripts.
NucleotideSequence Homologies and Complementarities Be- tween T-Antigen RNA, Cellular DNA, and Small Nuclear RNAs.Thehybridization data presented above pointedtothe possible existence of homologies between T-antigen RNA andrepeated elementsof monkey,mouse,and humanDNA.
The resultsobtained fromthecomparison bycomputer analy- sis of the established T1 oligonucleotide sequences with a variety of cellular DNA sequences, and the corresponding references are presented in Fig. 7.
Homologies
of 8-15 nt wereobserved withbothstrands of Alu-type DNA andwith repeated elements of monkey, mouse, and human DNA;furthermore,homologies of 8-12ntweredetectedin theAlu elements, the 5' and 3' noncodingregions, and the second intron of the human fetal
globin
gene, whereas none wast U2kPmL BC t U2'4M L BC
(monkey) G
U _G
C A
§ ^ * C _m-~ - _ A
uC _ _ ___A
C Al_ ,
U AyU
C (N)
U U
b
c(G)C A
(G)C
t
FIG.4. Sequenceanalysis of T1 oligonucleotidesfromT-antigenRNA. 5'-32P-labeled T1 oligonucleotidesfromT-antigen RNAmouse (a) andT-antigen RNAmonkey(b) were separated byelectrophoresis intwodimensions (11),followedby autoradiographyfor 3 hr. Thecircled oligonucleotides wereeluted, subjectedtoelectrophoresisinonedimension, reeluted,andsequenced(16, 17).Thearrowsin(b)indicate the oligonucleotides sequenced (c);thepartialswereseparatedon apolyacrylamide(20%acrylamide) gelcontaining8.3Murea, pH8.3.Lanes inc: t, undigested control;U2, U2RNase(As); pM,PhysarumM RNase(Asand Us); L,ladder(allnucleotides obtained byalkalinehy- drolysis); Bc, Bacillus cereusRNase (Us andCs). N, undetermined residue, probably withasubstitutionon the ribosemoiety(nopartial uponalkalinedegradation). Autoradiography wasfor 48 hr. The 5' nucleotides of thepartials weredeterminedbypaperelectrophoresis at pH 3.5after extensive alkalinedegradation. (G), guanineinferred from the fact that T1RNasecleaves afterguanineresidues.
6
.1.7
I00Cell
Biology:
Darlixetal.n
Proc. Natl.Acad. Sci. USA 81
(1984)
(G) CTTTTTNG (G)CCCTTCCTG
(G)AAAATCCAG (G)ATTCTTTTG
(G) CAAAAATATG (G) TTCCTCCTG
(G)AAAAAAACAG (G)TTCCTTCTG
(G)TCTCCCTCTG (G)ATTTTTCCAG
(G)AAAAACATTG
(G)A2MCAAATG
(G)CCCAACTTNG
(G)ACT29&CTG
(G)CCTTTTTCCCCG (G)dCTAAAACTCCTG
(G)CCAACCCCTTNG (G)ACACCTCCACCTG (G)TTAAAACTCCTG (G)AAACCTCCACCTG
(G)T8AAACTCTTG (G)ATTCCCCTTCCTG
(G)CTCNT'ACCAG (G)AACCACCTCCCCCTG (G)CTATCCCCCCCAG (G)TTCTTTTTTTCCCTG (G)TTCTCTTTTCTTTG (G)ACTACATACTTTCTTG (G)CTCCTCTCCTACTTG (G)ATCTCCCCTCTTCCCTG (G) TCCTTTTCTCCACCTG (G)CTTTCCTCTTCCTCCCTG
(G)ATT CCTT TG (G)TTCTTCTTTTCTTTCCG (G)
AA:ATTACCCAATCCTG
(G)ATCCCCTCACCCCACTATCG
(G)TTA4TTTT TAATCTATATCCTCCCCTG
FIG. 5. Established T1 oligonucleotide sequences ofT-antigen RNAmonkey (Left) and of T-antigen RNAmoUse (Right). All se- quences have been determined with three independent prepara-
tions ofT-antigen RNA. U has been replaced byT forcomputer convenience, and N is an undetermined residue. Boxes indicate TAA terminationcodons;directorinvertedrepeatsareunderlined.
found in the exohs, even if the search for homology was decreasedto7nt.Sequence complementarities (-8 nt)werd
observed with the 5' end ofUl RNAand the3' endof U3 RNA and also with 4.5SRNA from CHO cells.
DISCUSSION
5'-32P-labeled T-antigen RNA was hybridized to monkey, mouse, humanAlu, and SV40 DNA. Estimated byqdot-blot hybridization, the bulk of T-antigen RNA hybridized to cellular DNA, whereas about 15% of T-antigenRNAmonkey and 5% ofT-antigen
RNAmouse
hybridized toSV40
DNA.The resultsobtained with monkey andmouseDNA restric- tion fragments suggested that T-antigen RNA hybridized mainly with noncoding, repetitive elements of the cellular
genome; this assumption was supported by thefinding that 3-6% ofT-antigen RNA hybridized with humanAlu DNA.
Experiments with SV40 DNA restriction fragments showed
Repeated monkey DNA (ref. 26) 10-AAACTCCT (monkey) 13-CTCCTCTC (monkey)
Repetitive dispersed human DNA sequer pPD15- 21-TCCTCCCC (monkey)
30-CTTTTCTC(CA)CCT (monkey) pPD16-120-TTCCCCTTCCTG (mouse)
158-TCCCCTCACCCCACT (monkey) Alu-type DNA elements (ref. 23 & 28)
67-AAAAATCCA (monkey) 75-GTTAATTTTTAAT (monkey) 87-AAACTCCTG (monkey) B2-mouse DNA elements (ref. 29 & 30)
92-A(T)CCTCCCCTG (monkey) 129-AAA(C)CTCCACCT (mouse) Alu-BLUR8 (ref. 23)
CCTTAAACC (monkey) Human fetal globin gene (ref. 31)
(ref. 27)
180-CAAAAATA Alu-type (mouse)
350-TCTCTTTT
1490-TTAATCTAT(A)TCCT
1880-TTAATTTTT(AA)T(C)TA(T)CCTJ
3090-TATATCCT }2nd intron (mouse) 3740-GTTCTTfTTTT 3'-poly(A) (mouse) U1 RNA (ref. 32)
12-TCCCTCTG (monkey; Cp) 159-GCTCCTCTC (monkey) U3 RNA (ref. 33)
188-TCTCCCTCT (monkey; Cp) CHO-4.5S RNA (ref. 34 & 35)
CAGGAGGA(A)C (mouse; Cp) CA(GG)GGAGGAT (monkey; Cp)
FIG. 7. Comparison of known cellular DNA and aNA se- quenceswithT1 oligonucleotide sequences(from Fig. 5) ofT-an- tigenRNA. Thenumbersrefertothe nucleotide position alongthe cellularDNAorRNAsequenceswherehomologyorcomplemen- tarity (Cp)withT-antigenRNA starts;residuesinparenthesescor-
respondtomismatches.
that T-antigen RNA mainly hybridized with noncoding re-
gions of the viralgenome.
Sequence analysis of 37 unique T1 oligonucleotides of T- antigen RNA revealed that mostsequences are rich in py-
rimidine and thatsome containdirectorinvertedrepeats of 5-6 nt and termination codons. Comparison by computer
FIG. 6. Comparison of SV40 DNA with the oligo- nucleotide sequences of T- antigen RNA. The upper lines correspond to SV40 DNA sequences, the num-
bers indicating the nucleo- tidepositiononthephysical
mapofSV40DNA(24). The lower lines correspond to the sequenced T1 oligonu- cleotides ofT-antigen RNA (see Fig. 5). For computer convenience,U hasbeenre-
placed by T. Stretches ho- mologoustoSV40 DNAare
underlined.
T-antigen RNA SV40 DNA
Latestrand Early strand
250.CACAGCTGGTTCTTTCCG.269 619.GAAAATCCAG.608
GTTCTTCTTTTCTTTCCcG GAAAATCCAG
378.GTAAAAAACAG-6nt-GCCTTTTTGTGTT.410 2644.TATTGCAGCTTAtAATG.2626 G AAAAAAACAG GCCTTTTTCCCCG GATTTAACCTTATAATG
1598.GTTAAAACTGGAG.1612 4614.TAAAATTTTTAAGTGTATAATGTGTTAA.4585
Monkey GTTAAAACTCCTG GTTAATTTTTAATCTATATCCTCCCCTG
1832.GTTAAAACTGAGG.1846 GTTAAAACTCTTG
2347.TAAAATTACCCTTAGAAA.2366 GTAAATTACCCAATCCTG 3097.ATTCTCTTTTCTAAC.3113
GTTCTCTTTTCTTTG
3872.GTTCTTTTTTAATACA.3889 1920.GGGTTTTCCAG.1908
GTTCTTTTTTTCCCTG GATTTTTCCAG
Mouse 4264.TATTTTTCCAT.4276 2704.CCCACACCTCCCCCTG.2687
GATTTTTCCAG GAACCACCTCCCCCTG
4413.CTTCTTTTTTGGAGGA.4430 3732.GAGAACAAATG.3720
GTTCTTTTTTTCCCTG GATAACAAATG
5428 Cell
Biology:
Darlixetal.Proc. Nati. Acad.Sci. USA 81 (1984) 5429 analysis revealed homologies (8-12 nt) between T-antigen
RNA and repetitive noncoding elements of mouse, monkey, and human DNA;furthermore, sequence complementarities weredetectedbetweenT-antigen RNA and thesmall nuclear RNAs U1 and U3, thought to play a role
in
splicing of hnRNA (36) and in the maturation of45Sprecursor rRNA (37), respectively, and also with 4.5S RNA that is hydrogen- bonded to cellular hnRNA (35). One of the consensus se- quences(T-N-A-A-G-A-G-G-A-A-N) thought to be involved inthe coordinate regulation of sets of genes (38) exhibits a 8- ntcomplementarity withaTioligonucleotide from T-antigen RNA(T-T-C-C-T-C-T-T). These resultsand theobservation
thatatleast15-30%ofT-antigen RNAsequences aredouble- stranded snapback RNA suggest that the bulk of T-antigen RNA is derived from double-stranded, ordered regions of cellular hnRNAsthat exhibit sequence homologies within- terspersed repetitive elements of cellular DNA (39) and complementarity with nuclear 4.5S RNA(23, 35). Since the homologies with SV40 DNA were incomplete, the T1 oli- gonucleotidessequencein thisstudy mayactuallybe derived from (SV40-induced ?) cellular transcripts. In contrast, no homologies (,9 nt) withpolyoma DNA were detected.Wepresently investigate whether large T antigen exerts at least some of its pleiotropic effects (3), such as the mitotic activation (7), primarily by interfering with cellular gene expression on theposttranscriptional level (40): by interact- ingwith noncoding, repetitive, and double-stranded regions of cellular hnRNPs(ribonucleoproteins; precursor mRNAs).
Tantigen might modulate splicing and in this way alter the synthesis of pivotal cellularregulator proteins; this hypoth- esis obviously does not exclude that SV40 large T antigen may also exert direct effects on transcription of cellular genes(41) and ontranslation of mRNAs (42).
We may speculate that uninfected mammalian cells syn- thesize proteinsfunctionally analogous to SV40 large T an- tigen and thatsuch proteins playanimportant role in control of cellproliferation (3, 7), in differentiation (3), and in me- diating the pleiotropic effects induced byretinoids (43)and by certaingrowth-promoting hormones (44).
We are grateful to Profs. A. J. Shatkin, L. Philipson, and C.
Weissmann for the criticalreading of themanuscript. WethankDrs.
J. Weissbach and P.Tiollais for thegift of the BLUR8plasmid and Drs. E. andP. Mayfor theSV40plasmid. We alsothank Mrs. M.
Schwagerfor excellenttechnicalassistance,Mr. N. Bensemannefor preparing thecellcultures, andMrs. Y.Eprechtand Mr.0.Jenni for drawing thefigures and forphotography. This workwas supported byGrants 3.072.81 (toR.W.) and 3.321.82(toP.-F. Spahr) fromthe SwissNational Science Foundation andafellowship from the Emil Barrell Foundationof Hoffmann-La Roche(toE.W.K.).
1. Acheson,N. H.(1980) in MolecularBiologyofTumorViruses, ed. Tooze, J. (Cold Spring HarborLaboratory, Cold Spring Harbor, NY), Part2, pp. 125-204.
2. T,pp, W. C., Lane, D. & Pollack, R. (1980) in Molecular Biologyof Tumor Viruses, ed. Tooze, J.(ColdSpring Harbor Laboratory, Cold Spring Harbor, NY),Part2, pp. 205-2%.
3. Weil,R. (1978) Biochim.Biophys. Acta516, 301-388.
4. Martin,R. G.,Setlow, V. P.,Edwards,C. A. F.&Vembu,D.
(1979)Cell 17, 635-643.
5. Shenk,T. E.,Carbon,J.&Berg,P.(1976)J.Virol.18,664-671.
6. Topp, W. C., Rifkin, D. B. & Sleigh, M.J. (1981) Virology 111, 341-350.
7. Matter, J.-M., Tiercy, J.-M. & Weil, R. (1983) NucleicAcids Res. 11, 6611-6629.
8. Greenblatt, J. F., Allet, B., Weil, R. & Ahmad-Zadeh, C.
(1976) J. Mol.Biol. 108, 361-379.
9. Tegtmeyer, P. (1980) in Molecular Biology of Tumor Viruses,
ed. Tooze, J. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY), Part 2, pp. 297-338.
10. Rigby, P. W. & Lane, D. P. (1983) in Advances in Viral On- cology, ed. Klein, G. (Raven, New York), Vol. 3, pp. 31-57.
11. Khandjian, E. W., Loche, M., Darlix, J.-L., Cramer, R., Turler, H. & Weil, R. (1982)Proc. Natl.Acad. Sci. USA79, 1139-1143.
12. Richardson, C. C. (1971)in Procedures in Nucleic AcidsRe- search, eds.Cantoni, G. L. & Davies, D. R. (Harper & Row, New York), Vol. 2, pp. 815-828.
13. Maniatis, T., Fritsch, E. F. & Sambrook,J. (1982) inMolecu- larCloning:ALaboratory Manual (ColdSpringHarbor Labo- ratory, Cold SpringHarbor, NY).
14. Kafatos, R. C., Jones, C. W. & Efstratiadis, A. (1979) Nucleic Acids Res. 7, 1541-1552.
15. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517.
16. Donis-Keller, H.,Maxam, A. M. & Gilbert, W. (1977)Nucleic Acids Res. 4, 2527-2538.
17. Simoncsits, A., Brownlee, G. G., Brown, R. S., Rubin, J. R.
& Guilley, H. (1977) Nature (London) 269, 833-836.
18. Shatkin,A,J.(1965)Proc.Natl,Acad. Sci. USA 54, 1721-1728.
19. Britten, R. J. & Kohne, D. E. (1968) Science 161,529-540.
20. Davidson, E.H., Hough, B. R., Amenson, C. S. & Britten, R. J. (1973) J. Mol. Biol. 77, 1-23.
21. Manuelidis, L. (1976)NucleicAcids Res. 3, 3063-3076.
22. Houck, C. M.,Rinehart,F. P.&Schmid,C. W. (1979) J.Mol.
Biol. 132,289-306.
23. Jelinek,W. R.,Toomey, T. P., Leinwand, L., Duncan, D. H., Biro,P.A.,Choudary,P. V.,Weissman,S. M., Rubin, C. M., Houck,C. M.,Deininger,P. L.&Schmid, C. W.(1980)Proc.
Nati. Acad. Sci. USA 77, 1398-1402.
24. Buchman, A. R., Burnett, L.& Berg, P. (1980) in Molecular Biology ofTumor Viruses, ed. Tooze, J. (Cold SpringHarbor Laboratory, Cold Spring Harbor, NY),Part2,pp.799-829.
25. Hay, N.,Skolnik-David,H.& Aloni,Y.(1982)Cell29,183-193.
26. Manuelidis,L. & Wu, J. C. (1978) Nature(London)276,92-94.
27. Deininger, P. L.,Jolly,D.J.,Rubin, C. M., Friedmann,T.&
Schmid, C. W. (1981)J.Mol. Biol. 151, 17-33.
28. Rubin, C. M., Houck, C. M.,Deininger,P. L.,Friedmann, T.
& Schmid, C. W. (1980) Nature (London) 284, 372-374.
29. Krayev, A. S., Kramerov, D. A., Skryabin, K.G., Ryskov, A. P., Bayev, A. A. & Georgiev, G. P. (1980) Nucleic Acids Res. 8, 1201-1215.
30. Krayev, A.S.,Markusheva, T. V., Kramenov,D. A.,Ryskov, A. P.,Skryabin,K. G.,Bayev, A. A.&Georgiev, G. P.(1982) NucleicAcidsRes. 10,7461-7475.
31. Shen, S. H., Slighton, J. L. & Smithies, 0. (1981) Cell 26, 191-203.
32. Reddy, R.,Ro-Choi,T. S., Henning, D.&Busch,H.(1974)J.
Biol. Chem. 249, 6486-6494.
33. Reddy, R.,Henning,D.&Busch,H.(1980)J.Biol.Chem.255, 7029-7033.
34. Ro-Choi,T. S., Reddy, R.,Henning, D., Takano,T.,Taylor, C. W. &Busch,H. (1972)J.Biol. Chem. 247, 3205-3222.
35. Harada,F.& Kato, N. (1980)Nucleic AcidsRes.8, 1273-1285.
36. Steiz, J. A., Lerner, M. R., Boyle, J. A., Andrews, N. C., Hendrick, J.P. &Miller, I. G.(1981) in ExpressionofEukary- otic Viral and Cellular Genes, eds. Pettersson, R. F., Kaariainen, L., Soderlund, H. & Oker-Blom, N. (Academic, NewYork), pp. 257-264.
37. Bachellerie, J.-P., Michot, B. & Raynal, F. (1983) Mol. Biol.
Rep. 9, 79-86.
38. Davidson, E. H.,Jacobs,H. T.&Britten, R. J.(1983)Nature (London)301, 468-470.
39. Robertson, H. D., Dickson, E. &Jelinek, W. (1977) J. Mol.
Biol. 115,571-589.
40. Scherrer, K., Imaizumi-Scherrer, M.-T., Reynaud, C.-A. &
Therwath, A. (1979)Mol. Biol. Rep. 5, 5-28.
41. Milner,R.J.,Bloom,F.E.,Lai, C., Lerner, R. A.&Sutcliffe, J. G. (1984) Proc. Natl. Acad. Sci. USA 81, 713-717.
42. Schwyzer, M.,Tai, Y.,Studer,E.&Michel,M. R.(1983)Eur.
J. Biochem. 137, 303-309.
43. Bollag, W. (1983) Lancet i, 860-863.
44. Tata, J. R. (1970) in BiochemicalActions of Hormones, ed.
Litwack, G. (Academic, New York), Vol. 1, pp. 89-133.
Cell