Calcium signals critical for egress and gametogenesis in malaria parasites depend on a multipass membrane protein that interacts with

Article

Reference

Calcium signals critical for egress and gametogenesis in malaria parasites depend on a multipass membrane protein that interacts with

PKG

BALESTRA, Aurélia,

.

Abstract

Calcium signaling regulated by the cGMP-dependent protein kinase (PKG) controls key life cycle transitions in the malaria parasite. However, how calcium is mobilized from intracellular stores in the absence of canonical calcium channels in Plasmodium is unknown. Here, we identify a multipass membrane protein, ICM1, with homology to transporters and calcium channels that is tightly associated with PKG in both asexual blood stages and transmission stages. Phosphoproteomic analyses reveal multiple ICM1 phosphorylation events dependent on PKG activity. Stage-specific depletion of Plasmodium berghei ICM1 prevents gametogenesis due to a block in intracellular calcium mobilization, while conditional loss of Plasmodium falciparum ICM1 is detrimental for the parasite resulting in severely reduced calcium mobilization, defective egress, and lack of invasion. Our findings suggest that ICM1 is a key missing link in transducing PKG-dependent signals and provide previously unknown insights into atypical calcium homeostasis in malaria parasites essential for pathology and disease transmission.

BALESTRA, Aurélia,

. Calcium signals critical for egress and gametogenesis in malaria parasites depend on a multipass membrane protein that interacts with PKG.

Advances

, 2021, vol. 7, no. 13, p. eabe5396

DOI : 10.1126/sciadv.abe5396 PMID : 33762339

Available at:

http://archive-ouverte.unige.ch/unige:150847

Disclaimer: layout of this document may differ from the published version.

1 / 1

advances.sciencemag.org/cgi/content/full/7/13/eabe5396/DC1

Supplementary Materials for

Ca

signals critical for egress and gametogenesis in malaria parasites depend on a multipass membrane protein that interacts with PKG

Aurélia C. Balestra, Konstantinos Koussis*, Natacha Klages, Steven A. Howell, Helen R. Flynn, Marcus Bantscheff, Carla Pasquarello, Abigail J. Perrin, Lorenzo Brusini, Patrizia Arboit, Olalla Sanz, Laura Peces-Barba Castaño,

Chrislaine Withers-Martinez, Alexandre Hainard, Sonja Ghidelli-Disse, Ambrosius P. Snijders, David A. Baker, Michael J. Blackman*, Mathieu Brochet*

*Corresponding author. Email: konstantinos.kousis@crick.ac.uk (K.K.); mike.blackman@crick.ac.uk (M.J.B.);

mathieu.brochet@unige.ch (M.B.)

Published 24 March 2021, Sci. Adv. 7, eabe5396 (2021) DOI: 10.1126/sciadv.abe5396

The PDF file includes:

Figs. S1 to S6 Table S1

Legends for movies S1 and S2 Legends for data S1 to S4

Other Supplementary Material for this manuscript includes the following:

(available at advances.sciencemag.org/cgi/content/full/7/13/eabe5396/DC1) Movies S1 and S2

Data S1 to S4

Supplementary materials.

Supplementary figures.

Fig. S1. Interaction between PKG and ICM1 in P. falciparum expressing PKG-GFP and characterisation of ICM1-HA3 line. (A)Approach used to create line PKG-GFP by single

crossover homologous recombination. (B) Genotyping PCR confirming correct integration in 2 clones, compared with parental WT parasites. Positions of oligonucleotides used for genotyping by diagnostic PCR are indicated in panel a (black arrows). (C) Representative DIC/fluorescence microscopic image of PKG-GFP schizonts. Scale bar, 10 μM. (D) Western blot analysis of the clones with anti-GFP antibodies showing expression of the PKG-GFP fusion protein (expected molecular mass 125 kDa). (E) Growth curve showing replication of pfpkg-gfp parasites relative to WT parasites. Parasitaemia was quantified by flow cytometry. Error bars, ± SD (n=3). (F) Volcano plot showing mass spectrometric quantification of proteins identified in pull downs from extracts of PKG-GFP and WT parasites using anti-GFP nanobodies. Enrichment of interaction partners in the pkg-gfp pull-down compared to the negative control, x-axis. Significance based on Student’s t test

is expressed as the log2 of the p value (y-axis). PKG is indicated (red dot) while the newly identified interaction partner ICM1 is shown in blue. (G) Genetic modification strategy and genotyping data for the PbICM1-HA3 line. Oligonucleotides used for PCR genotyping are indicated. (H) Agarose gel analysis of corresponding PCR amplicons from genotyping reactions.

Fig. S2. Modelling of PfICM1 (A) Top hits from PfICM1 homology modelling by Phyre2

indicating the region of homology and the associated percentage of identity, and the molecule description. (B) Cartoon representation of the I-TASSER AAT1 model (rainbow color) superimposed to its closest structural PDB template (6MU1: InsP3R1 from rat cerebellum, cryo- EM, 4.1 Å, wheat color). The best model was selected with a C-score= -0.30 (C-score range [-5,2], the higher the score, the higher confidence in the model), an estimated TM-score=0.67±0.12 and an estimated RMSD=10.6±4.6Å. The N and C-terminal extremities are indicated and the TM regions

are labelled based on the 6MU1 helices topology. The four-fold axis is represented by the vertical dashed line. Only one monomer of the 6MU1 tetramer is represented for clarity.

Fig. S3. Generation and Characterisation of pkg:cKO line. (A) Schematic of the Cas9-enhanced

targeted homologous recombination approach used to create line pkg:cKO. The position targeted by the guide RNA used to direct Cas9-mediated cleavage is indicated (blue vertical line). RAP-induced DiCre activity switches expression from WT PKG to expression of a significantly truncated protein fused to mCherry. Black arrows; oligonucleotides used for identification of non-excised and excised products by PCR. (B) Excision PCR confirming efficient gene excision 26 h post treatment with vehicle only (-RAP) or RAP (+RAP). Expected sizes of the amplicons corresponding to non-excised and excised populations are 5.2 kb and 1.2 kb respectively. (C) Western blot analysis of mature schizonts of two independent parasite clones showing loss of PKG expression upon RAP-treatment of pkg:cKO parasites, and appearance of signals corresponding to the mCherry fusion. A rabbit polyclonal antibody against AMA1 was used as a loading control. (D) Representative stills from time-lapse DIC/fluorescence microscopy of DMSO (DIC - no colour) and RAP-treated (red) pkg:cKO schizonts showing that only control schizonts undergo rupture and merozoite egress. Scale bars, 10 μm. (E) Replication of DMSO- and RAP- treated pkg:cKO parasites over two erythrocytic cycles relative to the parental pfpkg_2lox line. Error bars, ± S.D (n=3).

Fig. S4. Generation, genotyping, and characterisation of PbICM1 stage-specific knock-down lines. (A) Genetic modification strategy and genotyping data for PbICM1-HA3. Oligonucleotides

used for PCR genotyping are indicated. Agarose gel analysis of corresponding PCR amplicons from genotyping reactions are shown. (B) Depletion of ICM1-AID/HA upon auxin treatment leads to no defect in exflagellation (error bars show standard deviation from the mean; two technical replicates from 3 independent infections; p = 0.58, two-tailed t-test). However, depletion of ICM1-AID/HA upon addition of auxin to mature purified gametocytes cannot be assessed by western blotting; α-

tubulin serves as a loading control. (C) Genetic modification vector and genotyping data for Pama1ICM1 and Pclag9ICM1 lines. Oligonucleotides used for PCR genotyping are indicated and PCR products from genotyping reactions are shown. (D) Relative levels of pbicm1 mRNA in WT and gametocytes. (E) Stage-specific knock-down of pbicm1 leads to a profound defect in exflagellation (error bars, ± S.D.; technical replicates from 3 independent infections; two-tailed unpaired t-test).

(F) Fluorescence response kinetics of gametocytes loaded with Fluo4-AM upon stimulation with

100 µM XA at t = 0 sec. Insets show quantifications of the relative maximum intensity or area under the curve (error bars, ± S.D.; 3 independent replicates; two tailed unpaired t-test). (G) Fluorescence response kinetics of gametocytes loaded with Fluo4-AM upon stimulation with A23187 at t = 0 sec.

Insets show quantification of the relative maximum intensity or area under the curve (error bars, ± S.D.; 2 independent replicates; two-way ANOVA). (H) Fluorescence response kinetics of gametocytes loaded with Fluo4-AM upon stimulation with BIPPO at t = 0 sec. Insets show quantification of the relative maximum intensity or area under the curve (error bars, ± S.D.; 2 independent replicates; two-way ANOVA).

Fig. S5. Generation, genotyping, and characterisation of pficm1:HA and pficm1:cKO lines. (A)

Schematic of the two-step Cas9-enhanced targeted homologous recombination approach used to create lines pficm1:HA and pkg:cKO. (B) Genotyping PCR confirming correct integration in line pficm1:HA, compared with parental WT parasites. Positions of oligonucleotides used for genotyping

by diagnostic PCR are indicated in panel a (black arrows).. (C) Replication of pficm1:HA parasites over three erythrocytic cycles relative to the WT control line. Error bars, ± S.D (n=3). (D) Genotyping PCR confirming correct integration in line pficm1:cKO (cl1) compared with parental WT parasites. (E) Excision PCR confirming efficient gene excision 26 h post treatment with vehicle (-RAP) or RAP (+RAP). Expected sizes of amplicons corresponding to non-excised and excised

populations are 7.2 kb and 1.6 kb respectively. (F) Representative stills from time-lapse DIC/fluorescence microscopy of DMSO (-RAP) and RAP-treated (+RAP) pficm1:cKO schizonts, showing that RAP-treated schizonts express GFP. Scale bar, 10 μM. (G) IFA analysis of DMSO and RAP-treated pficm1:cKO schizonts in parallel to the parental B11 line. Cells were counterstained with DAPI and antibodies to the PV marker SERA5. Scale bar 5 μM.

Fig. S6. Protein discharge from exonemes is unaffected in PfICM1-null parasites. (A) Top panel: Representative Giemsa-stained blood films showing the appearance of clustered or free merozoites in the PfICM1-null parasites. Bottom panel: DIC/GFP live microscopy still showing PfICM1-null schizonts and free merozoites after prolonged incubation at 37° C. Scale bar, 10 μM (B-C) Western blot showing levels of SERA5 P50 into culture supernatants of RAP-treated schizonts, while in contrast no SERA5 P50 was released into culture supernatants of RAP-treated pfpkg:cKO schizonts, consistent with a complete block in egress. GFP was used as a marker for

excision for PfICM1-null parasites, while a PKG antibody was used to show absence of endogenous PfPKG in the PfPKG-null parasites. DM, DMSO-treated, R1 and R2, two independent pficm1:cKO RAP treatments. R, RAP treated pfpkg:cKO.

Table S1.

Oligonucleotides used in this study

GFP_For CTATGGGACCTAGGTCTGTGAG

GFP_Rev CTTGCACACCTTTCTCGAGCTAG

wtpkg_For CTGGTGAAACCATTGTTAAACAAGG

L2_For CATCAGAAGAAATTGAAAAATCCG

L2_Rev GTAATAGTATTATAATACTTGTGTAAGAC

L2_HA CTAGCCCCGAATAACAAATCG

L1_For CTAAAATGGTTATCTAACATAGGG

L1_Rev CCTGATATCATTATTCTTTCATACC

5int_Rev CTATTTACATGCATGTGCATGCAC

exon1_For GAAGAAGATGATAATCTAAAAAAAGGG

PKGutr_Rev CCTTTCAATTATCATATCGCCC

453

AAGAAAAACGCTCGAGAGGCCTCTTTTTTTAATTGTAATTGTA ATTTATTGG

458 GAATTCGCGGCCGCGATATCAGTATTATTTTTTTAAAATGGT

459 TACGCCAAGCTTGTGTGTGTGCATTGAAACTT

464 GCTGGGCTGCAGTTTTATTAAAATAATAAATCAAAAAA

icm1 QCR1 TCGGGCACTGTTAAACCATCAGCT

icm1 QCR2 TGGTAAACACAAACTAAACAAAGGT

GW1 CATACTAGCCATTTTATGTG

GW2 CTTTGGTGACAGATACTAC

GW3 TTGATTTTTGGCAGGAAACC

Movie S1. PKG-null P. falciparum schizonts fail to egress.

Time-lapse video microscopy of WT parasites undergoing egress, whilst PfPKG-null parasites (expressing mCherry) remain trapped within the host red blood cells.

Movie S2. ICM1-null P. falciparum schizonts exhibit an egress defect.

Time-lapse video microscopy of DMSO- and RAP-treated pficm1:cKO parasites. DMSO-treated parasites egress normally (DIC) whilst PfICM1-null schizonts cannot undergo egress. As the GFP signal diminished very rapidly due to photobleaching, the corresponding still images at t=0 sec depict WT (no colour) and PfICM1-null parasites (expressing GFP).

Data S1.

Proteins identified from pull down and chemoproteomic experiments Data S2.

Multiple alignment of Plasmodium spp ICM1 Data S3.

Targeted proteome and phosphoproteome analyses of PKG inhibition in P. berghei gametocytes Data S4.

Proteome and phosphoproteome analyses of PKG and ICM1 deletion in P. falciparum schizonts