Physical and genetic map of the Staphylococcus xylosus C2a chromosome
RÉSULTATS COMPLÉMENTAIRES
♦ Nous avions observé que les génomes de trois souches isolées de pathologies animales étaient plus grands d’environ 200 kb et contenaient cinq opérons ribosomaux contrairement à la souche commensale de la peau S. xylosus C2a et aux trois souches d’origine carnée ou isolée de l’environnement ce qui laissait supposer un lien entre l’origine des souches et le nombre de rrn. Afin de vérifier si ces observations pouvaient être généralisées, nous avons
évalué après restriction par l’endonucléase I-CeuI, la taille du chromosome et le nombre de
rrn chez 20 autres souches de S. xylosus. Dix sont des souches utilisées comme ferment et 10
ont été isolées de mammites bovines ou caprines. La taille du chromosome des souches varie de 3259 à 2807 kb avec une taille moyenne 2925 kb. La variation de taille de génome au sein de l’espèce S. xylosus est plus importante que celle que nous avions établie précédemment sur un nombre restreint de souches. Elle est d’environ 14% et donc du même ordre que la différence de taille des génomes séquencés dans le genre Staphylococcus (14%). Les chromosomes des souches isolées de pathologies animales sont en moyenne plus grands que les chromosomes d’intérêt technologique, laissant supposer l’acquisition de matériel génétique chez ces souches. La variation du nombre de rrn de 5 à 6 a été confirmée. Les souches d’intérêt technologique arborent 6 rrn. Le nombre d’opérons ribosomaux est variable chez les souches isolées de pathologies animales. Le nombre de rrn ne peut donc pas être corrélé à l’origine des souches.
♦ Une étude comparative entre le génome de S. xylosus C2a et les génomes de staphylocoques déjà séquencés a été réalisée sur la base des marqueurs génétiques de la carte de S. xylosus. Nous avons pu observé que la position de ces marqueurs semble assez conservée chez les autres espèces de staphylocoques (Figure 1). Au sein du groupe des staphylocoques à coagulase négative, S. xylosus appartient au groupe d’espèce S.
saprophyticus. Sur la base des 33 marqueurs génétiques et des opérons ribosomaux,
l’organisation du génome de S. xylosus C2a semble proche de celle de S. saprophyticus bien que le génome de ce dernier soit de plus petite taille (2516 kb).
S. aureus MW2 2,82 Mb S. xylosus C2a 2,87 Mb S. epidermidis RP62A 2,64 Mb S. haemolyticus JCSC1435 2,69 Mb S. saprophyticus ATCC 15305 2,52 Mb gyrA dnaA gyrA dnaA gyrA dnaA gyrA dnaA cudB scrA ureG fbp femA katA ccpA sodA2 hprK dltA gap ilvE cysE cudB scrA ureG ccpA sodA glkA femA katA gap hprK dltA ilvE cysE gyrA dnaA cudB scrA fbp ccpA sodA glkA femA katA gap dltA hprK ilvE cysE cudB ureG scrA1 scrA2 fbp ccpA sodA glkA femA katA dltA hprK gap ilvE cysE cudB ureG scrA fbp ccpA sodA femA glkA katA hprK gap ilvE cysE
Figure 1 : Comparaison de la carte génétique de S. xylosus C2a avec les chromosomes de S. aureus MW2 (Baba et al., 2002), S. epidermidis RP62a (Gill et al., 2005), S. haemolyticus JCSC1435 (Takeuchi et al., 2005) et S. saprophyticus ATCC 15305 (Kuroda et al., 2005).
L’alignement a été réalisé à partir de la position de l’origine de réplication déduite par la position des gènes dnaA et gyrA. Les flèches correspondent aux opérons ribosomaux.
C2a chromosome
Emilie Dordet-Frisoni, R ´egine Talon & Sabine Leroy
INRA, Centre de Clermont-Ferrand Theix, Unit ´e Microbiologie, Qualit ´e et S ´ecurit ´e des Aliments, Saint-Gene`s Champanelle, France
Correspondence: Sabine Leroy, INRA, Centre de Clermont-Ferrand Theix, Unit ´e Microbiologie, Qualit ´e et S ´ecurit ´e des Aliments, F-63122 Saint-Gene`s Champanelle, France. Tel.: 133 4 73 62 45 95; fax: 133 4 73 62 42 68; e-mail: sleroy@clermont.inra.fr Received 19 June 2006; revised 6 September 2006; accepted 20 October 2006. First published online 24 November 2006. DOI:10.1111/j.1574-6968.2006.00538.x Editor: Oscar Kuipers
Keywords
Staphylococcus xylosus ; chromosome map; genome size;rrn loci.
Abstract
Staphylococcus xylosus is a ubiquitous bacterium frequently isolated from mam-malian skin and occurring naturally on meat and dairy products. A physical and genetic map of the S. xylosus C2a chromosome was constructed by pulsed-field gel electrophoresis analysis after digestion with AscI, ApaI, I-CeuI, SfiI and SmaI enzymes and hybridization analysis. The chromosome size was estimated to be 2868 10 kb. Thirty-three genetic markers were mapped. The probable origin of replication (oriC) was positioned. Six rrn loci were located, and their orientation was determined. The chromosomes of six additional S. xylosus strains were also analysed by I-CeuI digestion, and an intraspecies diversity of the chromosome size and the number of rrn operons was shown.
Introduction
Staphylococcus xylosus belongs to the coagulase-negative group of staphylococci (CNS). It is used as a starter culture for meat and dairy products. It ensures colour development and contributes to typical aromas (Talon et al., 2002). S. xylosus is a ubiquitous bacterium that was first isolated from human skin (Schleifer & Kloos, 1975). It is frequently isolated in naturally fermented products and food-proces-sing environments (Irlinger et al., 1997; Rossi et al., 2001; Martin et al., 2006). Most S. xylosus strains are able to form biofilms (Planchon et al., 2006). This capacity could explain the presence of this species in food-processing plants. Historically, this species was first defined as a nonpathogenic bacterium and S. xylosus has received particular attention as a recombinant microorganism for development of an oral vaccine (Nguyen et al., 1995). However, this species shows a certain degree of diversity as some strains have been described as being involved in opportunistic animal infec-tions like mastitis or dermatitis (Forsman et al., 1997; Won et al., 2002; Malinowski et al., 2003; Thornton et al., 2003). In addition, several strains isolated from milk and goats were reported to produce enterotoxins (Bautista et al., 1988; Valle et al., 1990). The S. xylosus C2a strain used in this study is derived from the type strain DSM20267 cured of its endogenous plasmid pSX267 (G¨otz et al., 1983).
Transfor-mation systems have been developed for S. xylosus C2a strain (Br¨uckner, 1997) and allowed to study main meta-bolic staphylococcal-related pathways (Br¨uckner et al., 1993; Egeter & Br¨uckner, 1995; Bassias & Br¨uckner, 1998; Fiegler et al., 1999).
Despite the significance of S. xylosus as a fermenting agent and its occurrence in the food environment, there is little information on its genetic content, and the structural organization of its chromosome is still unknown. In the Staphylococcus genus, whole-genome information is avail-able for the four species recognized as opportunistic human pathogens: Staphylococcus aureus (Kuroda et al., 2001; Baba et al., 2002; Holden et al., 2004; Gill et al., 2005), Staphylo-coccus epidermidis (Zhang et al., 2003; Gill et al., 2005), Staphylococcus saprophyticus (Kuroda et al., 2005) and Staphylococcus haemolyticus (Takeuchi et al., 2005). Con-cerning the other staphylococcal species, only the chromo-some organization of Staphylococcus carnosus, also used as a starter culture, is known (Wagner et al., 1998).
To better understand the content and organization of the S. xylosus genome, the construction of the physical and genetic map of the chromosome of S. xylosus C2a strain provides a framework for studying structural conservation within this species. It is also an extremely valuable basis for starting a genome sequencing project. In this study, the physical map was constructed and 33 genetic loci were
mapped. The size of the circular chromosome was estimated and the number of copies and orientation of rrn operons were demonstrated. The chromosomes of six additional S. xylosus strains were analysed to determine the intraspecies diversity.
Materials and methods
Bacterial strains and growth conditions
The S. xylosus C2a strain was used in this study (G¨otz et al., 1983). Two S. xylosus strains were isolated from meat environment (S. xylosus S00290) or sausage (S. xylosus S03191) and one (S. xylosus S04002) is used as a meat starter culture. Staphylococcus xylosus S04009 and S. xylosus S04020 were isolated from mastitis, and S. xylosus 00-1747 from mouse dermatitis (Won et al., 2002). The strains were grown in brain-heart infusion medium at 37 1C.
Preparation, restriction enzyme digestion and electrophoretic separation of DNA
Genomic DNA was prepared in agarose plugs as described previously (Morot-Bizot et al., 2003). The enzymes AscI, SfiI and I-CeuI, and SmaI and ApaI were from New England Biolabs and Promega, respectively, and were used according to the manufacturers’ instructions.
Digested DNA was subjected to pulsed-field gel electro-phoresis (PFGE) in 1% agarose gels in 0.5 TBE buffer at on a CHEF-DR III apparatus (Bio-Rad). The electrophoretic conditions are described in the Fig. 1 legend. Two-dimen-sional (2D) PFGE was performed as described by Cornillot et al. (1997). To investigate the presence of DNA fragments between 15 and 1 kb, all digests were resolved in conven-tional 0.7% agarose gels. Gels were analysed usingQUANTITY ONE QUANTITATIONSoftware (Bio-Rad).
Southern hybridization and DNA probes
The separated digested chromosomal DNA was passively transferred overnight to positively charged nylon mem-branes (Hybond-N, Amersham). All probes used in this study (Table 1) were labelled with random-primed DNA labelling using DIG-High Prime (Roche). Probes were amplified using the primers listed in Table 1. All the probes used were checked and sequenced with BigDye terminators according to the manufacturer in a DNA capillary sequencer ‘ABI PRISM 310’ (PE Applied Biosystems). Hybridizations and detections were performed using chemiluminescent detection following the supplier’s instructions (Roche).
The GenBank accession numbers for the sequences reported in this paper are DQ471958, DQ471959, DQ472004–DQ472011.
Results
Estimation of chromosomal size
The size of the genome of S. xylosus C2a was evaluated by PFGE of chromosomal DNA digested with the rare cutting enzymes ApaI, AscI, SfiI and SmaI. The homing endonu-clease I-CeuI, which recognizes sites located in bacterial rrl genes, was also used. SfiI cleaved the chromosome at a unique site (data not shown). The restriction patterns observed on PFGE are shown in Fig. 1a. The small fragments were detected by conventional electrophoresis (data not shown). In total, 13, 4, 6 and 12 bands were observed after digestion with ApaI, AscI, I-CeuI and SmaI, respectively (Table 2). The size of the largest fragment of the AscI pattern was underestimated due to the lack of accuracy of PFGE for fragment larger than 1.6 Mb. Its exact size was therefore determined after double digestion with SfiI. A higher
Fig. 1. (a) Macrorestriction fragments of Staphylococcus xylosus C2a chromosome. Lane 1: lambda DNA concatemers, lane 2: ApaI digestion, lane 3: AscI digestion, lane 4: SmaI digestion, lane 5: I-CeuI digestion and lane 6: Staphylococcus cerevisae chromosomal DNA (Bio-Rad). (b) AscI and I-CeuI partial restrictions. Lane 1: S. cerevisae chromosomal DNA; lane 2: lambda DNA concatemers (Promega), lane 3: AscI partial restric-tion (4 h of digesrestric-tion with 0.5 U), lane 4: I-CeuI partial restricrestric-tion (4 h of digestion with 1 U). PFGE were performed with switch times of 100 s for 12 h, 70 s for 16 h and 1–30 s for 13 h at 6 V cm1, 120 and 14 1C.
Table 1. Probes derived from PCR amplified genes and used for physical and genetic mapping of Staphylococcus xylosus C2a
Gene Gene product Primer sequences (50–30)
Fragment size (kb) Accession no. Hybridizing fragments Reference ApaI AscI SmaI
Carbohydrate transport and metabolism
glkA Glucose kinase ACGGGAGAAGTAAACGGAGC ACACCTGTAGCAGATGCCAC
469 X84332 Ap1 As1 Sm1 Wagner et al. (1995) ccpA Catabolite control protein TGGCAACCGTTTCTCGTGTAG
TCATACCCACTGCACCAATGTC
830 X95439 Ap1 As1 Sm1 Egeter & Br ¨uckner (1996) malR Maltose-maltotriose utilization regulator AACCAAACCGAGCAGCGAGAAC TTTGTGGCGGGGATGCAAATG
800 X78853 Ap1 As1 Sm1 Egeter & Br ¨uckner (1995) lacH b-D-galactosidase (lactase) CTCCTGAAGAAATTGAGGAGAC
TCATGGGGCACCCTATTTG
301 Y14599 Ap2 As1 Sm4 Bassias & Br ¨uckner (1998) xylA Xylose isomerase TGTTGCGGAACGTGATTGGG
CTTCACGACCGCCCCAAAAAAC
385 X57599 Ap2 As1 Sm4 Sizemore et al. (1991) pstHI Phosphocarrier protein
general component of the phosphoenolpyruvate-dependent carbohydrate
AGCGTACCAAAATAAACGTGAG CCAGCCATTTCTCCGCACATAC
788 AF316496 Ap3 As1 Sm1 Br ¨uckner & Meyer (unpublished) scrA Sucrose-specific enzyme II
of the phosphotransferase system
TGTGCAACGCGCTTGAGACTTG TACCCATGAGCAAACCACCAGC
310 X69800 Ap7 As2 Sm7 Wagner et al. (1993) gap
Glyceraldehyde-3-phosphate dehydrogenase
TACACAAGATGCGCCACAC GATCGCCAACTGTCATAACAC
356 AF495486 Ap4 As1 Sm1 Liu et al. (unpublished) gusA b-Glucuronidase GTGAGCACGAATCATAGCAGAG
CACCTACAGCAGTCGTTTCATC
465 DQ472005 Ap10 As4 Sm7 This study fbp Fructose biphosphatase AGCCTTCCGTCCTAAAAATGCC
GCCACCAACTGCATACCAAAC
905 DQ472006 Ap10 As1 Sm11 This study scrB b-fructofuranosidase CGGAGTGGACAAAAGAGCAAC
TATCGGGCAAACCCATCCAC
898 X67744 Ap12 As3 Sm6 Br ¨uckner et al. (1993) glcU
gdh
Glucose uptake operon Amino acid transport and metabolism
GGCCAAACTATGTAAACTACGC CCTTTACCGCCCATAAATGC
328 Y14043 Ap12 As3 Sm6 Fiegler et al. (1999) ampS Leucyl aminopeptidase CGAGTAGATGGTAACGACCCAG
CCAAGAGCAATGTGGCATGAAG
514 DQ472010 Ap13 As3 Sm6 This study cudB Choline dehydrogenase TGAAACGACACCAGAACCAC
CCAGCCATTTCTCCGCACATAC
322 AF009415 Ap2 As1 Sm3 Rosenstein et al. (1999) ureG Urease ATCACGCACACCTACGCTTG
AGCAGCTAAATTGTCGCCACC
1000 Z35136 Ap5 As1 Sm3 Jose (unpublished) gltD NADPH glutamate
synthase
AGACGAAGCGGCACAACAAG TCACGCAATGCAGTAGCGAC
828 DQ472007 Ap6 As1 Sm12 This study cysE Serine O-acetyltransferase AGGTGCCCAAATCGGTAGAC
TGCTCGTAAATTGGGTCAGG
363 Y07614 Ap8 As1 Sm1 Fiegler & Br ¨uckner (1997) ilvE Branched-chain amino acid
aminotransferase
GCACAAACGAATGCATCAGCAC GACGTTCTTCCACTTCATAGCC
217 DQ472004 Ap8 As1 Sm1 This study arg Arginase GCATTGAGCATAACCATTTCCC
ACTAAACCTACTGCTTGCTCTG
615 DQ472008 Ap9 As2 Sm8 This study Genes near oriC
dnaA Replication initiation protein
GARGARTTYTTYCAYACNTTYAAC GARGARTTYTTYCAYACNTTYAAT ACWGTHGTRTGRTCYCTWCCWCC
530 DQ471958 Ap2 As1 Sm2 This study
gyrA DNA gyrase subunit A ATGCGTGAATCATTTTTAGACTATGCw GAGCCAAAGTTACCTTGACCw
300 DQ471959 Ap2 As1 Sm2 This study Inorganic ion transport and metabolism
sodA Superoxide dismutase TGCATTGGAACCACACATTGATC GTGTTCCCAAACATCTAATCCTAAG
468 AJ276960 Ap1 As1 Sm1 Barrie`re et al. (2001)
staining intensity of several ApaI and SmaI bands suggested the presence of comigrating fragments. Double digestion analysis with AscI and PFGE 2D indicated that the SmaI fragments of 100 and 48 kb were doublets (data not shown). After digestion with SfiI, the 444 kb ApaI fragment was revealed to be a doublet. The other broader ApaI fragments of 142, 72 and 53 kb were demonstrated to be doublets by hybridization with specific probes (see below). Hybridiza-tion experiments also revealed that the 3 kb SmaI band corresponded to six different restriction fragments (see below). The genome size of the S. xylosus C2a strain was estimated to be 2868 10 kb.
Construction of an I-CeuI, AscI andSfiI backbone
Partial I-CeuI digestions were performed to organize the six I-CeuI fragments. After partial digestion, two additional fragments were observed (Fig 1b). We could deduce that the fragment 4 2000 kb could only be obtained with the combination of Ce1 (1460 kb)1Ce2 (1138 kb). The 225 kb
fragment could only correspond to the combination of Ce3 (125 kb)1Ce4 (100 kb). According to this, the linkage of Ce1 with Ce2 and Ce3 with Ce4 was deduced but the order between Ce3 and Ce4 could not be established. Because of the large size of Ce1 and Ce2 fragments, no partial digestions including Ce5 (50 kb) could be distinguished. However, the combinations Ce31Ce41Ce5, Ce31Ce5 or Ce41Ce5 were not detected; this indicated that Ce5 is not linked to Ce3 or Ce4 and was positioned between Ce1 and Ce2 in the large partial restriction fragment. The small fragment Ce6 (5 kb) was placed by a combination of double digestion AscI/SfiI and consecutive digestion with I-CeuI. After digestion with I-CeuI, the largest fragment from the double digestion AscI/ SfiI gave three fragments of 810, 475 and 48 kb (Ce5) and one fragment of 5 kb (Ce6), which was not detected directly after electrophoresis because of its low DNA concentration. Hy-bridization experiments revealed the presence of this small fragment (see below). This led to the linkage of Ce6 fragment with Ce5 but it was not possible to determine their order. To carry on the construction of the backbone, restriction with enzyme AscI was performed. We ordered AscI fragments by
Table 1. Continued
Gene Gene product Primer sequences (50–30)
Fragment size (kb) Accession no. Hybridizing fragments Reference ApaI AscI SmaI
katA Catalase CAGTGGTTAACACCCAAACGG CAGGCGAACGTGGTGCAGG
762 AJ295151 Ap6 As1 Sm2 Barrie`re et al. (2002) rrn operon
rrs 16S rRNA gene CCTATAAGACTGGGATAACTTCGGG CTTTGAGTTTCAACCTTGCGGTCG
780 AY688108 Ap6, Ap9, Ap11, Ap13, Ap15, Ap16 As1, As2, As3 Sm5, Sm6, Sm8, Sm10, Sm12, Sm19 Becker et al. (2004) rrl 23S rRNA gene CTGTCTCAACGAGAGACTC
ACTAAGTCCGTCTTTCGACCC 400 DQ472009 Ap8, Ap9, Ap12, Ap14, Ap15, Ap16 As1, As2, As3 Sm13, Sm14, Sm15, Sm16, Sm17, Sm18 This study Other genes
femA Formation of pentaglycine side chain of staphylococci peptidoglycan
GTGAGGTATTGGAAAATGCAGG TTCCACCCGCATAATACACTAC
614 AF099965 Ap1 As1 Sm1 Vannuffel et al. (1999) mprF Putative membrane protein CCGTCTTTTGCTATTGCACTC
CCCGCTTTTTCTTCCCTGAC
905 AF145698 Ap1 As1 Sm1 Peschel et al. (2001) bap Biofilm-associated protein CCCTATATCGAAGGTGTAGAATTGCAC
GCTGTTGAAGTTAATACTGTACCTGC
970 DQ008304 Ap2 As1 Sm4 Tormo et al. (2005) asx Putative bifunctional
autolysin
CAACAGTCGCAACACGTTCTGC CCACTCGTACTACCTGAAG
692 AJ401468 Ap3 As1 Sm1 Hell et al. (unpublished) dltA D-alanine-D-alanyl carrier
protein ligase
TGGACCTACAGAAGCGACAG CATCCTCGGCAATCTGCTTAC
575 AF032440 Ap4 As1 Sm1 Peschel et al. (1999) hprK HPr kinase (operon urvA) GCCAGATGAAGAACGTAAAGGACG
CTGTTAGTATCGATCCAGCGCC
376 AJ243915 Ap4 As1 Sm1 Huynh et al. (2000) gehM Lipase precursor ACATACGAAGCGAGCGTTGG
TAGTGGAGAAATCTCACCGCC
300 AF208229 Ap6 As1 Sm2 Rosenstein & G ¨otz (2000) ycgM Fumarylacetoacetate
hydrolase
TTTTTACCGCCAGTCACGCC ATTCATACCTGCACCAACGCC
566 DQ472011 Ap17 As1 Sm1 This study
Degenerated primers were used, deduced from highly conserved region of the DnaA protein Richter & Messer (1995). w
Primers were designed from a consensus sequence observed in coagulase-negative staphylococci Dubin et al. (1999).
partial digestion, which gave three transitional fragments (Fig. 1b). The 580 kb fragment was attributed to the sum of the fragments As2, As3 and As4, the 530 kb fragment to the sum of As2 and As3 and the 420 kb fragment to the sum of As2 and As4. According to this, we could conclude that As2 was flanked by As3 and As4 fragments. Double restriction analyses were performed to align the AscI and I-CeuI skeletons (Table 3). Double digestions with the single restriction site enzyme SfiI, which cut As1 into 13351 935 kb fragments and Ce1 into 9301530 kb fragments, indicated that As1 overlapped the Ce1 fragment (data not shown). The order was established for all the fragments generated, except for Ce6. The Ce6 fragment linked to Ce5 was arbitrarily positioned after Ce5. The I-CeuI, AscI and SfiI backbone was thus achieved (Fig. 2). These results demon-strated the circular nature of the S. xylosus C2a chromosome, as always observed in Staphylococcus.
Positioning of genetic markers and extension to the physical map to includeApaI andSmaI fragments
Based on the I-CeuI, AscI and SfiI backbone, a genetic map was constructed by hybridization of restriction fragments of
S. xylosus C2a chromosome with specific probes (Table 1). Thirty-three genetic markers were localized on the physical map (Fig. 2). The gyrA and dnaA probes allowed orientation of the map (Fig. 2). The use of genetic markers was essential to complete the physical map for SmaI and ApaI restriction fragments. Double digestions with SfiI restriction enzyme allowed to locate the Sm1 fragment (9301530 kb) and the Ap3 fragment (380170 kb) within the Ce1 and As1 frag-ments (Fig. 1b). The ApaI and SmaI restriction sites were colocalized with all the I-CeuI sites (Table 3). Analysis of the size of SmaI and ApaI fragments allowed their location within AscI and I-CeuI (Table 2, Fig. 2), and genetic markers were used to determine their order (Table 1).
The gyrA, xylA and cudB probes assigned the Sm2, Sm3 and Sm4 fragments within Ap2 (Table 1). Sm4 was not restricted by ApaI and thus surrounded by Sm2 and Sm3. Hybridization with the katA and gehM probes revealed that Sm2 also overlapped Ap6. This fragment overlapped Sm12 from the results of hybridization using a gltD probe. The location of the ureG probe revealed that Sm3 partly covered Ap5. The linkage of Sm12-Sm2-Sm4-Sm3 and Ap6-Ap2-Ap5 was thus established (Fig. 2). The position of Sm11 in Ap10 and As1 fragment was determined using the fbp probe. More-over, the gusA probe colocalized Ap10 with Sm7 and As4 fragments (Table 1). The scrA probe hybridized to Sm7, Ap7 and As2, indicating that these fragments were colocalized (Table 1). The Ap10 and Ap7 fragments were thus linked and overlapped Sm11-Sm7 and As1-As4-As2 (Fig. 2). The position of the Sm9 fragment was established by double digestion with AscI enzyme and 2D PFGE analysis. The As2 fragment was restricted by SmaI giving four fragments of 135 (Sm5), 90, 65 and 49 kb (Sm9) (data not shown). Given the circular nature of the chromosome, the remaining Sm5 fragment was posi-tioned in the free portion between Sm9 and Sm8. The remaining small SmaI fragments (Sm13 to Sm17) were positioned by hybridization with the rrl probe (see below).
The hybridization of different probes with Ap1, Ap3, Ap4, Ap8 and Ap16 fragments showed the overlap of these fragments within the Sm1 fragment (Table 1). Owing to the position of Ap3 linked to the SfiI restriction site, Ap1 was thus mapped upstream from the Ap3 fragment in the clockwise orientation of the map. The rrl probe hybridized to Ap8 (Table 1). Thus, this fragment was positioned close to the junction between Ce1 and Ce5. The Ap4 fragment could only be located between Ap8 and Ap3. Different locations were possible for Ap16. This fragment was arbitrarily posi-tioned between the Ap4 and Ap3 fragments.
Copy number, position, orientation and organization ofrrn loci
To position rrn loci inside the S. xylosus C2a chromosome,