Remodeling of cytoplasmic actins during Paramyxovirus infections:
a process induced by the matrix protein to optimize virus particle production?
Vincent Miazza1, Christine Chaponnier2 and Laurent Roux1*
1Department of Microbiology and Molecular Medicine and 2Department of Pathology and
Immunology, Faculty of Medicine University of Geneva, CMU, 1 rue Michel‐Servet, 1211 Geneva 4, witzerland
S
*Corresponding author
2 all aspects of eukaryotic cell biology (16). In vertebrates, six actin isoforms have been described
3 encoded by distinct genes (35). Muscle actins (α‐skeletal and α‐cardiac and α‐ and γ‐smooth muscle) are organized in contractile units and are tissue specific, whereas cytoplasmic β‐ and γ‐actins (β‐actin and γ‐actin) are ubiquitous and essential for cell survival (20). All actin isoforms exhibit similar primary sequences, which slightly differ at N‐terminal amino acids. In particular, β‐ and γ‐actins differ only by four residues at positions 1, 2, 3 and 9. Despite the high similarity, specific functions have been suggested, mainly for muscle actin isoforms (7,22). For cytoplasmic actins, the definition of
distinctive functions has been hampered by the inability to document their subcellular localization due to the unavailability of specific γ‐actin antibodies.
Cytoplasmic actins are part of the various cellular components that have been found involved in virus life cycle, at early steps, during transport of the viral genome to the site of genetic expression and genome replication, or, at later steps, during formation of new virus particles [for a general textbook about viral multiplication cycle, see (13)]. Virus infections are generally altering infected cell shape.
They can induce a transient increase in actin polymerization as in the case of human respiratory syncytial virus [HRSV; (34)], and also remodeling of actin filament pattern. Growing actin filaments have been observed in budding virus particles (2), and many Paramyoxvirus particles have been shown to contain actin, such as measles virus, mumps virus, Sendai virus (SeV), Newcastle disease virus (NDV) and HRSV [(11,34); also reviewed in (32)]. Disruption of actin polymerization by the drug cytochalasin D has generally a deleterious effect on virus particle shedding (4,30), alluding to the fact that polymerized actin plays a positive role in virus production. Despite this body of descriptive work, little is known about specific functions of the cytoplasmic actins, and in particular about a possible differential role for β‐ and γ‐actins.
SeV is a prototype for the Paramyxovirus family. Newly formed virus particles bud from the plasma membrane and in polarized MDCK cells, budding occurs exclusively from the apical side [(3) and Fouillot‐Coriou and Roux, unpublished]. Early on, it was recognized to include actin in its particle (11,21,26), and later, SeV matrix protein (SeV‐M) was shown to directly interact with actin (18). More recently, it has been suggested that the C‐terminal amino acid of SeV‐M contains an actin binding domain and, since the deletion of this motif prevents M shedding into virus‐like particles, it was postulated that actin is actively involved in M shedding (31).
By taking advantage of newly prepared monoclonal antibodies against the cytoplasmic β‐ and γ‐actin isoforms (10), we investigated by confocal microscopy analysis the effect of SEV infection on the pattern of cytoplasmic actins in MDCK cells. We found that both β‐ and γ‐actin patterns were remodelled after infection to concentrate at the apical side of the plasma membrane. Such a remodeling was not observed upon infections with vesicular stomatitis virus (VSV) or the human parainfluenza virus 5 (HPIV5). β‐ and γ‐actins were both found associated with SeV particles and their
4 suppression by siRNA resulted in a decrease in virion production. As SeV particles exclusively bud from the apical side of the polarized MDCK cells, we propose that SeV infection induce remodeling of
5
6
7 mutants, HA‐M30 and HA‐MIRKL‐4A. HA‐M30 carries two mutations, T112M and V113E, which disrupt the
113VRRT116 motif well conserved among the Paramyxoviruses (23). This motif was shown essential for
8
9
10
irradiated with 30J/m2. Irradiation was performed using a TUV 6‐watt lamp (UVGL‐58, Omnilab), and the UV dose rate was measured by using a UVX radiometer (UVP). MDCK cells were either DMSO treated or Cytochalasin‐D (Sigma) treated at 2 hours post infection (pi).
Antibodies
Mouse monoclonal antibodies against the cytoplasmic β‐ and γ‐actin isoforms, mAb 4C2 (IgG1) and mAb 2A3 (IgG2b) respectively, were obtained and characterized as described in Dugina et al. (10).
Antibodies used in this study include also an anti‐SeV‐N (a rabbit serum raised against SDS‐denatured N protein, α‐NSDS), anti‐SeV‐M (MAb 383 obtained from Claes Örvell (Laboratory of Clinical Virology, Huddinge Hospital, Huddinge, Sweden), anti‐influenza HA epitope (anti‐HA) rat IgG1 monoclonal antibody (clone 3F10, Roche). The antibody raised against HPIV5‐NP was a gift from Randall RE (University of St. Andrews, Scotland, United Kingdom).
Plasmids
The pEBS‐H‐AM30 and pEBS‐H‐AMIRKL‐4A, were prepared by the replacement of the HA‐M gene of pEBS‐HA‐M (19) with HA‐M30 (24) or HA‐MIRKL‐4A, using SacI and KpnI restriction sites. The HA‐MIRKL‐4A was generated by a standard PCR technique in order to replace the last 4 codons (5’ATCAGAAAGCTG3’) coding for IRKL with 4 codons (5’GCCGCAGCGGCG3’) coding for AAAA. The pFL4‐HA‐M plasmid was obtained by the insertion of an HA tag just before the M ORF of the pFL4 plasmid (25) by a standard fusion PCR technique.
Viruses
Sendai virus H strain was prepared and characterized as before (27). Recombinant Sendai virus GP42 was a kind gift of Daniel Kolakofsky and was published (17). The recombinant SeV‐HA‐M was recovered as described previously (14) from pFL4‐HA‐M plasmid. In order to obtain persistently
11 infected cells, confluent MDCK cells were infected at a high multiplicity of infection (moi of 50) with DIH4 stocks (5) for 48 hours. The surviving cells were then split and grown as described for normal uninfected MDCK cells. The VSV‐GFP virus was a kind gift from Jacques Perrault (San Diego State University, USA). Human parainfluenza type 5 (HPIV5, WR strain) was a kind gift from Machiko Nishio (Mie University Graduate School of Medicine, Japan) and was propagated in Vero cells.
Immune‐fluorescence and confocal Laser Scanning Microscopy
For immune‐fluorescence staining, cells grown on glass coverslips were rinsed with DMEM containing 20mM HEPES at 37°C, fixed in 1% PFA in pre‐warmed DMEM for 30 min, followed by 3 min treatment with methanol at ‐20°C. Cells were subsequently incubated with the different primary antibodies, followed by incubation with appropriate secondary antibodies: FITC‐conjugated goat anti‐mouse IgG1 and TRITC‐conjugated goat anti‐mouse IgG2b (Southern Biotechnology Associates Inc., Birmingham, AL), for respectively the anti‐actin isoforms antibodies; Alexa488‐conjugated goat anti‐
mouse IgG and Alexa568‐conjugated goat anti‐mouse IgG (Molecular Probes); CYTM5‐conjugated goat anti‐rabbit, FITC‐conjugated donkey anti‐rat IgG and TRITC‐conjugated donkey anti‐rat IgG (Jackson);
DAPI was used for nuclear staining. After several washes in PBS, cells were mounted in Mowiol 4‐88 (Calbiochem, 475904). Images were acquired using a confocal microscope (LSM510, Carl Zeiss, Oberkochen, Germany) equipped with oil immersion objectives (Plan‐Neofluar 40x/1.3 and Plan‐
Apochromat 63x/1.4, Zeiss). A sequential scanning for different channels (multitrack function) was selected to avoid crosstalk between fluorescent dyes. For serial optical sections stacks with Z‐step of 0.3‐0.5 μm were collected. Stacks and Z sections were collected and processed using LSM 510 3D software for 3D reconstruction of the cells. Images were processed using Adobe Photoshop software.
Transfections
A549 cells in 35mm‐diameter dishes were transfected with 100 nM of human β‐actin siRNA (target sequence: AATGAAGATCAAGATCATTGC, from Qiagen) or human γ‐actin siRNA (target sequence:
AAGAGATCGCCGCGCTGGTCA, from Qiagen) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions, 48 hours before SeV infection. Transfection efficiency (≥ 90%) was estimated using BLOCK‐iT™ (Invitrogen). MDCK cells on coverslips in 24‐wells dishes were transfected using ESCORTTMII Transfection Reagent (Sigma‐Aldrich) according to manufacturer’s instructions with 1 μg of the different pEBS plasmids.
Virus infections and radiolabeling
Infections with Sendai virus (SeV), its various recombinants (rSeV), HPIV5 and VSV‐GFP were performed at 33°C. Virus stocks were adequately diluted (moi indicated in the figure legends) in
12 DMEM without FCS and laid over the cells for 1 hour. At the end of the infection period, the infectious mix was removed and replaced with fresh DMEM supplemented with 2% FCS. For radioactive labeling, cells were incubated with 50 μCi of 35S‐methionine and 35S‐cysteine (Pro‐mix‐
[35S] in vitro cell labeling mix, Amersham Biosciences) in DMEM containing 4/10th the normal methionine and cysteine content plus 0.8% FCS, from 12 to 30 hours pi. Culture medium and cells were harvested at the time indicated in the figure legends and analyzed as described below.
Virus particles and cellular extracts
The virus particles were isolated from the clarified cell supernatants by centrifugation through a 25%
glycerol cushion (Beckman SW55 rotor, 2 h, 50,000 rpm, 4°C) and directly resuspended in 1% β‐
mercaptoethanol, 2% sodium dodecyl sulfate, 80 mM This‐HCl pH 6.8, 10% glycerol and 0.005%
bromophenol blue (SDS sample buffer). Infected cells were directly resuspended in 150 μl of SDS sample buffer and sonicated for 10 seconds (Branson Sonic Sonifer B‐12, lowest speed).
SDS‐PAGE analyses, Western blotting, autoradiography and quantification
The total cellular extracts and the virus were analyzed by SDS‐PAGE. After electrophoresis, the proteins were transferred using a semi‐dry system onto polyvinylidene difluoride membranes (Millipore). Blots were then incubated with specific antibodies, followed by the appropriate horseradish peroxidase (HRP)‐coupled secondary antibodies. Protein detection was performed by using the enhanced chemiluminescence system (Amersham Biosciences). The radio labeled virus particle samples were analyzed by SDS‐PAGE and the gels, treated for enhanced fluorography (DMSO plus 5% 2,5‐diphenyloxazol, PPO), were exposed to Hyperfilm MP (Amersham Biosciences). The autoriadiographs were scanned and the intensity of the replication signal was measured using ONE‐
Dscan version 1.0 (Scananalytics; CSP).
Caspase‐3 assay
Infected and uninfected cells were harvested at increasing time post infection as indicated in figure legend. Cell extracts were processed and capase‐3 enzymatic reactions were run according to the manufacturer's instructions (Caspase‐3 Colorimetric Assay, R&D Systems, Inc.). Protein concentration of each cell extract was determined by a Bradford assay (Bio‐Rad Protein Assay) and 100 μg of protein were used for testing Caspase‐3 activity. Incubation reactions of increasing time periods were performed as described in the legend of figure 4.
Acknowledgements
The authors are indebted to Vera Dugina, Ingrid Zweanepoel and Isabelle Dunand‐Sauthier for technical advices, to Geneviève Mottet‐Osman for her constant support, to Thierry Pellet who was a
13 mentor for VM during his master degree and to Sophie Clément‐Leboube for careful reading of the manuscript and pertinent comments. CC and LR are supported by grants from the Swiss National Foundation for Scientific Research.
Figure legends
Figure 1. Actin cytoskeleton remodeling following productive Sendai virus infection. MDCK cells, grown on glass coverslips, were mock infected or infected with SeVwt (moi. = 3). A) Eighteen hours
post infection, cells were fixed, permeabilized and processed for indirect immuno‐fluorescence staining using anti‐β‐actin (a,e) or anti‐γ‐actin (b,f) coupled, respectively, to FITC and TRITC secondary antibodies. a,b,c,e,f,g: projection confocal microscopy images. c,g: merges of the corresponding two stainings. Below each image, corresponding Z sections. d,h: single XY sections (merge images) with dotted white lines in c,g indicating the level of the sections. B) As in A), except that the cells, infected at moi ≅ 100, were fixed at 1 hour or 4 hours post infection, and that anti‐N antibodies were also used (coupled to Cyan‐5). The squared panels represent projection confocal microscopy images, with prepared as described in Methods and analyzed by SDS‐PAGE. A) Autoradiography of a SDS‐PAGE showing the total intracellular (IC) radiolabeled proteins, with the viral N protein visible over the cellular background. B) Autoradiography of a SDS‐PAGE showing the proteins found in virus particles (VP), with the viral proteins as indicated. C) The N protein levels in virus particles (B) were quantified and standardized to IC N protein levels to express the percent of virus particle production under the indicated suppression conditions. Error bars: deviation from the mean of 3 independent experiments. D) The levels of intracellular β‐actin were detected by Western blots (upper strip). The signals were quantified and graphically expressed with the deviation from the mean of 3
independent experiments. The numbers 1 to 8 correspond to the conditions shown in panels A and B. E) As in D), but for γ‐actin. F) The cells were either mock infected (lane 1), infected (moi = 3) with the variant SeV‐gp42 (lane 2) or with SeVwt (lane 3). At 40 hours post infection, cells (IC) and virus particles (VP) in the supernatants were analyzed by Western blots for their content in β‐actin and γ‐
14 actin. G) At 2 hours post infection, SeV infected (moi = 3) MDCK cells were either DMSO treated or treated with 1 μM, 5 μM or 10 μM of cytochalasin D (cytoD) diluted in DMSO. At 24 hours post infection, cells (IC) and virus particles (VP) in the supernatants were collected and processed for Western blot analysis using anti‐N and anti‐M antibodies. VP panel has been over‐exposed relative to IC panel, to allow detection of minor amounts of virus particles. For both F) and G), fractions corresponding to 1/100th the total cell protein amount (8 μg) and 1/6th the viral particle were analyzed. For D) and E), the same amounts as in A) were analyzed corresponding to 1/30th of the total cell protein amount.
Figure 3. Actin cytoskeleton remodeling as a function of the types of SeV infection. A. MDCK cells, grown on glass coverslips, were mock infected, infected with SeVwt (moi = 3) or infected with a SeV DI stock leading to cell survival and establishment of persistent infection prior to a challenge by SeVwt (see Methods). Eighteen hours post infection the cells were fixed and processed for confocal microscopy analysis as in figure 1B. Bars = 10 μm. N: images showing the viral N protein visualized with anti‐N antibodies coupled to cyan5 as in figure 1. B) Regular MDCK cells or SeV persistently infected cells were infected or challenged with SeV (moi = 10). At 30 hours post infection/challenge, cells (IC) and virus particles (VP) in the supernatants were collected and processed for Western blot analysis using anti‐N and anti‐M antibodies. The three lanes correspond to triplicates.
Figure 4. A) Stress induced actin cytoskeleton remodeling and B) apoptosis induction upon SeV infection. A) MDCK cells, grown on glass coverslips, were untreated or UV‐treated (see Methods).
Eighteen hours later, cells were fixed and processed for confocal microscopy analysis as in figure 1. B) MDCK cells, grown in 90 mm ∅ Petri dishes, were SeVwt infected. At the indicated times after infection, the cells were harvested and processed for the analysis of the caspase‐3 activity recorded in enzymatic reactions of increasing times (30, 60, 90 and 120 minutes) as described in Methods. The protein concentration for each cell sample was determined (see Methods) and 100μg of protein was used for the testing. The measurements were done in duplicate and deviation from the means is indicated. This experiment is representative of three independent experiments.
Figure 5. Actin cytoskeleton and VSV and HPIV5 infections. MDCK cells, grown on glass coverslips, were mock infected, infected with SeVwt (moi = 3), VSV‐GFP (moi = 100, panel A) or with HPIV5 (moi
= 5, panel B). At 24 hours post infection for SeV and HPIV5, and at 12 hours post‐infection for VSV‐
GFP, the cells were fixed and processed for microscopy analysis as in figure 1B. Bars = 10 μm. The cells were analyzed by confocal microscopy. The extent of the infections were monitored by visualization of N for SeV, of GFP for VSV (images d and g, panel A), and of N for HPIV5 (image b,
15 panel B), using an Axiovert‐200 microscope (objective 63x) with a DAPI staining (images a and c,
panel B). The β‐actin and γ‐actin protein localization were checked by confocal microscopy as described in figure 1. White bars = 10μm.
Figure 6. SeV‐M cellular localization in relation with the actin cytoskeleton. MDCK cells, grown on glass coverslips, were mock infected or infected with rSeV‐HA‐M (moi = 3). Eighteen hours post infection, the cells were fixed and processed for confocal microscopy as in figure 1, except that both
actin isoforms were visualized with an Alexa488‐conjugated goat anti‐mouse IgG while HA‐M was visualized using a TRITC‐conjugated donkey anti‐rat IgG. A) β‐actin and HA‐M localization. B) γ‐actin and HA‐M localization. a‐f: projection images, with Z sections presented below each image. g: XY sections of the corresponding merge images, with dotted white lines in f indicating the level of the filaments in budding of measles virus: studies on cytoskeletons of infected cells. Virology 149:91‐106.
3. Boulan, E. R. and D. D. Sabatini. 1978. Asymmetric budding of viruses in epithelial monlayers:
a model system for study of epithelial polarity. Proc.Natl.Acad.Sci.U.S.A 75:5071‐5075.
4. Burke, E., L. Dupuy, C. Wall, and S. Barik. 1998. Role of cellular actin in the gene expression and morphogenesis of human respiratory syncytial virus. Virology 252:137‐148.
5. Calain, P., J. Curran, D. Kolakofsky, and L. Roux. 1992. Molecular cloning of natural paramyxovirus copy‐back defective interfering RNAs and their expression from DNA. Virology 191:62‐71.
6. Casciola‐Rosen, L., D. W. Nicholson, T. Chong, K. R. Rowan, N. A. Thornberry, D. K. Miller, and A. Rosen. 1996. Apopain/CPP32 cleaves proteins that are essential for cellular repair: a fundamental principle of apoptotic death. J Exp.Med 183:1957‐1964.
16 7. Chaponnier, C. and G. Gabbiani. 2004. Pathological situations characterized by altered actin
isoform expression. J Pathol. 204:386‐395.
8. Chen, Benjamin J. and Lamb, R. A. Mechanisms for enveloped virus budding: Can some viruses do without an ESCRT? Virology 372(2), 221‐232. 2008.
Ref Type: Magazine Article
9. Cooper, J. A. 1987. Effects of cytochalasin and phalloidin on actin. J Cell Biol 105:1473‐1478.
10. Dugina, V., I. Zwaenepoel, G. Gabbiani, S. Clément, and C. Chaponnier. 2008. Beta and gamma‐cytoplasmic actins display distinct distribution and functional diversity. submitted.
11. Fagraeus, A., D. L. Tyrrell, R. Norberg, and E. Norrby. 1978. Actin filaments in paramyxovirus‐
infected human fibroblasts studied by indirect immunofluorescence. Arch.Virol 57:291‐296.
12. Fernandes‐Alnemri, T., G. Litwack, and E. S. Alnemri. 1994. CPP32, a novel human apoptotic protein with homology to Caenorhabditis elegans cell death protein Ced‐3 and mammalian interleukin‐1 beta‐converting enzyme. J Biol Chem. 269:30761‐30764.
13. Flint, S. J., L. W. Enquist, V. R. Racaniello, and A. M. Skalka. 2004. In: Principles of Virology, Molecular Biology, Pathogenesis, and Control of Animal Viruses. Second edition ed. ASM Press, Washington, D.C.
14. Fouillot‐Coriou, N. and L. Roux. 2000. Structure‐function analysis of the Sendai virus F and HN cytoplasmic domain: different role for the two proteins in the production of virus particle.
Virology 270:464‐475.
15. Fuller, S. D., C. H. von Bonsdorff, and K. Simons. 1985. Cell surface influenza haemagglutinin can mediate infection by other animal viruses. EMBO J. 4:2475‐2485.
16. Furukawa, R. and M. Fechheimer. 1997. The structure, function, and assembly of actin filament bundles. Int.Rev Cytol. 175:29‐90.
17. Garcin, D., G. Taylor, K. Tanebayashi, R. Compans, and D. Kolakofsky. 1998. The short Sendai virus leader region controls induction of programmed cell death. Virology 243:340‐353.
18. Giuffre, R. M., D. R. Tovell, C. M. Kay, and D. L. J. Tyrrell. 1982. Evidence for an interaction between the membrane protein of a paramyxovirus and actin. J Virol 42:963‐968.
19. Gosselin‐Grenet, A. S., J. B. Marq, L. Abrami, D. Garcin, and L. Roux. 2007. Sendai virus budding in the course of an infection does not require Alix and VPS4A host factors. Virology 365:101‐112.
20. Karabinos, A., H. Schmidt, J. Harborth, R. Schnabel, and K. Weber. 2001. Essential roles for four cytoplasmic intermediate filament proteins in Caenorhabditis elegans development.
Proc.Natl.Acad.Sci.U.S.A 98:7863‐7868.
21. Lamb, R. A., B. W. Mahy, and P. W. Choppin. 1976. The synthesis of sendai virus polypeptides in infected cells. Virology 69:116‐131.
22. Lambrechts, A., T. M. Van, and C. Ampe. 2004. The actin cytoskeleton in normal and pathological cell motility. Int.J Biochem Cell Biol 36:1890‐1909.
17
25. Mottet‐Osman, G., F. Iseni, T. Pelet, M. Wiznerowicz, D. Garcin, and L. Roux. 2007.
Suppression of the Sendai Virus M Protein through a Novel Short Interfering RNA Approach Inhibits Viral Particle Production but Does Not Affect Viral RNA Synthesis. The Journal of Virology 81:2861‐2868.
26. Orvell, C. 1978. Structural polypeptides of mumps virus. J Gen Virol 41:527‐539.
27. Roux, L. and J. J. Holland. 1979. Role of defective interfering particles of Sendai virus in persistent infections. Virology 93:91‐103.
28. Roux, L. and F. A. Waldvogel. 1981. Establishment of Sendai virus persistent infection:
biochemical analysis of the early phase of a standard plus defective interfering virus infection of BHK cells. Virology 112:400‐410.
29. Roux, L. and F. A. Waldvogel. 1982. Instability of the viral M protein in BHK‐21 cells persistently infected with Sendai virus. Cell 28:293‐302.
30. Stallcup, K. C., C. S. Raine, and B. N. Fields. 1983. Cytochalasin B inhibits the maturation of measles virus. Virology 124:59‐74.
31. Takimoto, T., K. G. Murti, T. Bousse, R. A. Scroggs, and A. Portner. 2001. Role of matrix and fusion proteins in budding of Sendai virus. J Virol 75:11384‐11391.
32. Takimoto, T. and A. Portner. 2004. Molecular mechanism of paramyxovirus budding. Virus Research 106:133‐145.
33. Tuffereau, C. and L. Roux. 1988. Direct adverse effects of Sendai virus DI particles on virus budding and on M protein fate and stability. Virology 162:417‐426.
Figure 1
18
Figure 2
19
Figure 3
20
Figure4
21
22 Figure 5
Figure 6
23
Figure 7
24