SeV expression vector and construction M fusion proteins
The pGem4-GFP-HA-Mwt sequence was obtained by Thierry Pelet from a pTM1-GFP plasmid by a standard PCR amplification of the GFP coding sequence with a primer containing at the 5’ extremity a SmaI site and another primer containing at the 3’
extremity a BamHI site. The HA-M coding sequence was obtained from HA-Mwt CB 11948Dr5 plasmid (Mottet, Mühlemann et al., 1996) by a standard PCR amplification of the HA-Mwt coding sequence with a primer containing at the 5’ extremity a BamHI site and another primer containing at the 3’ extremity a EcoRI site. The two PCR amplified coding sequences were ligated to each other by BamHI restriction sites and inserted into a pGem4 plasmid by SmaI and EcoRI restriction sites.
GFP-HA-Mwt was subsequently PCR amplified in order to add XhoI at the 5’ extremity of the coding sequence and it was inserted by XhoI/EcoRI sites into CB11936Dr5 plasmid, a SeV minigenome expression vector (Mottet, Muller et al., 1999). For cloning strategy reasons, this plasmid was then modified for the introduction of new restriction sites and elimination of others. A NcoI site overlapping the first ATG codon of GFP-HA-Mwt ORF was introduced (5’AGATGG3’ was replaced by 5’CCATGG3’). A ClaI site was introduced overlapping the Tyr-Arg-Phe amino acids of Mwt (residues 5-7) (5’TATAGATTC3’ was replaced by 5’TATCGATTC3’). Two NcoI sites were suppressed.
The first one overlapping the last GFP codon and the first two HA codons, namely Pro-Met-Ala amino acids (5’CCCATGGCT3’ was replaced by 5’CCGATGACT3’). The second one overlapping two amino acids, Pro-Trp, within the M ORF (residues 136-137) (5’CCATGG3’ was replaced by 5’CCGTGG3’). All these modifications didn’t affect the corresponding amino acids, and were done by standard fusion PCR techniques.
CB11936Dr5-GFP-HA-M30 plasmid was obtained by the replacement of a portion of M comprised between BstXI and HpaI unique sites of Svec CB11936Dr5-GFP-HA-Mwt plasmid by the same fragment coming from CB11936Dr5- HA-M30 (Mottet, Muller et al., 1999). CB11936Dr5-GFP-HA-MVRRT_4A, CB11936Dr5-GFP-HA-MYLDL_4A, CB11936 Dr5-GFP-HA-MYPNV_4A, and CB11936Dr5-GFP-HA-MIRKL_4A were obtained by standard PCR fusion techniques by the following sequence replacements, respectively:
5’GTGAGGAGGACT3’ by 5’GCGGCAGCGGCT3’ ; 5’TACCTAGATTTA3’ by
5’GCCGCAGCTGCA3’ ; 5’TACCCTAATGTT3’ by 5’GCCGCTGCTGCT3’ ;
5’ATCAGAAAGCTG3’ by 5’GCCGCAGCGGCG3’.
CB11936Dr5-GFP-HA-MDel1 was obtained by the deletion of a fragment comprised between ClaI and StuI. The open plasmid was ligated with a small oligomer duplex linker
composed of 5’GCCTATCGATTCCTCTTAAAGGCCTGCG3’ and
5’CGCAGGCCTTTAAGAGGAATCGATAGGC3’. The same strategy was used for CB11936Dr5-GFP-HA-MDel2 and CB11936Dr5-GFP-HA-MDel3 clones with respectively deletions between StuI and AvaI, and AvaI and EcoRI and insertions of the respective oligomer duplexes: 5’CGCAAAGGCCTGCGTGCACCTCGGGTTGGC3’ and
5’GCCAACCCGAGGTGCACGCAGGCCTTTGCG3’ ;
5’CGCACCTCGGGTAAAAGGTCGAATTCCAGC3’ and
5’GCTGGAATTCGACCTTTTACCCGAGGTGCG3’.
EBS-GFP-HA-Mwt and EBS-GFP-HA-M30 were produced by the replacement of GFP in a EBS-GFP plasmid (Mottet-Osman, Iseni et al., 2007) with HA-Mwt and GFP-HA-M30 ORF coming from CB11936Dr5-GFP-HA-Mwt and CB11936Dr5-GFP-HA-M30 by the use of SacI/KpnI sites.
CB11936Dr5-HA-Mwt and CB11936Dr5-HA-M30 were already described (Mottet, Muller et al., 1999). CB11936Dr5-HA-MVRRT_4A, CB11936Dr5-HA-MYLDL_4A, CB11936 Dr5-HA-MYPNV_4A, and CB11936Dr5-MIRKL_4A were all produced from the corresponding GFP-HA-M construct in CB11936Dr5 vectors by BamHI/EcoRI digestion and inserted in CB11936Dr5 plasmid by the same restriction sites.
All the EBS-HA-M mutant constructs were obtained with SacI/KpnI digestions of the corresponding CB11936Dr5-HA-M mutant constructs and inserted in a EBS-GFP plasmid in the place of GFP using the same restriction sites.
The pGem4-TAPtag-Mwt plasmid was obtained by Thierry Pelet by a standard PCR amplification technique of the TAPtag sequence from pBS1761 (Puig, Caspary et al., 2001) using a primer containing a SmaI site at the 5’ extremity and another primer containing a HincII site at the 3’ extremity. This PCR product was inserted in the pGem4-GFP-HA-Mwt plasmid in the place of the GFP-HA sequence that was removed by XbaI/EcoRV digestion.
TAPtag-Mwt was subsequently PCR amplified in order to add BamHI at the 5’ extremity of the coding sequence and it was inserted by BamHI/EcoRI sites into CB11936Dr5 plasmid. The CB11936Dr5-TAPtag-M30 was obtained in the same manner described above for CB11936Dr5-GFP-HA-M30. TAPtag-Mwt and TAPtag-M30 sequences were inserted in pEBS with the same strategy described above for GFP-HA- M constructs.
The various EBS-C clones and recSeV-TAP-GFP were a kind gift of Daniel Kolakofsky and were described elsewhere (Marq, Brini et al., 2007).
All constructs were sequenced.
Cells and treatments
All cells were grown at 37°C under 5% CO2 atmosphere. MDCK, A549 and 293T cells were grown in Dulbecco modified Eagle's medium (DMEM) supplemented with 5%
(MDCK and A549) or 10% (293T cells) fetal calf serum (FCS). BHK and BSR-T7 cells (a gift from K.K.Conzelmann) were grown in BHK-21 medium (Glasgow minimal essential medium; Gibco) supplemented with 5% FCS. For siRNA suppression experiments, A549 cells were grown in Dulbecco modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS). 293T cells transfected with EBS-TAP-M plasmids were grown as described above but were Hygromycin B (Invitrogen) treated with a final concentration of 100μg/ml every 72h during at least 18 days.
Transfections
A549 cells in 90mm-diameter dishes were transfected with 100 nM of human CHMP5 siRNA (target sequence: AAG GAC ACC AAG ACC ACG GTT, from Qiagen) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions, 48h before SeV infection. MDCK cells on coverslips in 24-wells dishes were transfected using ESCORTTMII Transfection Reagent (Sigma-Aldrich) according to manufacturer’s instructions with 1 μg of the different pEBS plasmids. The BSRT7 cells in 35mm-diameter dishes were transfected with FuGENE 6 transfection reagent (Roche) according to manufacturer’s instructions.
Mixed SeV stocks
Mixed SeV stocks refer to stocks containing DI (Defective Interfering) genomes (also called minigenomes), supported in their replication and assembly by functions provided by the ND (Non Defective, also called full-length SeV) genome (Roux & Holland, 1979).
In the present case, the DI genomes consisted of a nucleocapsid containing the RNA vector (CB11936Dr5-HA-M, CB11936Dr5-GFP-HA-M, or CB11936Dr5-TAP-M) carrying the open reading frame of the various wild-type M or M mutants. The methodology to generate these mixed SeV stocks has been described previously in detail (Calain & Roux, 1993; Mottet et al., 1996) and was not changed. Basically, BSRT7 cells were used for the SeV mixed stocks recovering by the transfection of plasmids encoding N, P, L and the SeV minigenome followed after 48h by a SeV ND infection (H strain). In cells infected with these mixed stocks viruses, the various M-fusion proteins expressed from the vector RNA co-exists with Mwt expressed from the ND genome.
Virus particles and cellular extracts
The virus particles were isolated from the clarified cell supernatants by centrifugation through a 25% glycerol cushion (Biofuge 13R (Heraeus), 1h, 13’000 rpm, 4°C) and directly resuspended in 1% β-mercaptoethanol, 2 % sodium dodecyl sulfate, 80 mM This-HCl pH 6.8, 10% glycerol and 0.005% bromophenol blue (SDS sample buffer). Infected cells (except for Tandem Affinity Purifications) were collected and disrupted in 300 μl of Lysing Buffer II (150 mM NaCl, 1% deoxycholate, 1% triton X-100, 0.1% sodium dodecyl sulfate, 10 mM Tris–HCl, pH 7.4) containing 1% aprotinin and 20 mM AEBSF as described before (Mottet, Portner et al., 1986). After 10 s of sonication (Branson Sonic Sonifer B-12, lowest speed), cell extracts were spun for 10 min at 12000 rpm in a microfuge. The supernatants were then processed for Western blotting analysis. The protein concentration of each sample was determined by a Bradford assay (Bio-Rad Protein Assay) and appropriately diluted at 1μg/μl.
Antibodies
Mouse monoclonal antibodies against the cytoplasmic β- and γ-actin isoforms, mAb 4C2 (IgG1) and mAb 2A3 (IgG2b) respectively, were obtained and characterized as described
by Dugina and co-workers (Dugina, Zwaenepoel et al., 2008). Antibodies used in this study include also an anti-SeV N (a rabbit serum raised against SDS-denatured N protein, α-NSDS), anti-SeV M (MAb 383 obtained from Claes Örvell (Laboratory of Clinical Virology, Huddinge Hospital, Huddinge, Sweden), two anti-influenza HA epitope (anti-HA) rat IgG1 monoclonal antibody (clone 3F10, Roche) and mouse IgG1 monoclonal antibody (clone 16b12, Covance), a rabbit polyclonal anti-GFP (Clontech).
Immune-fluorescence and confocal Laser Scanning Microscopy
For immune-fluorescence staining, cells, grown on glass coverslips, were rinsed with DMEM containing 20mM HEPES at 37°C, fixed in 1% PFA in pre-warmed DMEM for 30 min, followed by 3 min treatment with methanol at -20°C. Cells were subsequently incubated with the different primary antibodies, followed by incubation with appropriate secondary antibodies: Alexa488-conjugated goat anti-mouse IgG and Alexa568-conjugated goat anti-mouse IgG (Molecular Probes); FITC-Alexa568-conjugated donkey anti-rat IgG and TRITC-conjugated donkey anti-rat IgG (Jackson). After several washes in PBS, cells were mounted in Mowiol 4-88 (Calbiochem, 475904). Images were acquired using a confocal microscope (LSM510, Carl Zeiss, Oberkochen, Germany) equipped with oil immersion objectives (Plan-Neofluar 40x/1.3 and Plan-Apochromat 63x/1.4, Zeiss). A sequential scanning for different channels (multitrack function) was selected to avoid crosstalk between fluorescent dyes. For serial optical sections stacks with Z-step of 0.3-0.5 μm were collected. Stacks and Z sections were collected and processed using LSM 510 3D software for 3D reconstruction of the cells. Images were processed using Adobe Photoshop software.
Virus infections
Infections with Sendai virus (SeV) and its mixed stocks were performed at 33°C. Virus stocks were adequately diluted (moi indicated in the figure legends) in DMEM without FCS and laid over the cells for 1 hour. At the end of the infection period, the infectious mix was removed and replaced with fresh DMEM supplemented with 2% FCS.
SeV mixed sotcks are usually 108 pfu/ml with roughly 5 to 10 fold more viral particles.
For technical reasons and because M when inserted in a minigenome can create some
interference, the pfu were not determined for the present SeV mixed stocks. When the DI interference levels were normal, the cells where approximately infected with a moi of 10.
SDS-PAGE analyses, Western blotting, Coomassie Blue staining and quantifications The total cellular extracts and the purified virus particles were analyzed by SDS-PAGE.
After electrophoresis, the proteins were transferred using a semi-dry system onto polyvinylidene difluoride membranes (Millipore). Blots were then incubated with specific antibodies, followed by the appropriate horseradish peroxidase (HRP)-coupled secondary antibodies. Protein detection was performed by using the enhanced chemiluminescence system (Amersham Biosciences). After the Tandem Affinity Purifications, SDS-PAGE gels were stained with a 0.2% coomassie blue staining solution. For quantifications, the films were scanned and the intensity of the proteins signal was measured using ONE-Dscan version 1.0 (Scananalytics;CSP).
Analysis of encapsidated RNAs
Confluent BHK cells in 9 cm Petri dishes (2 × 107 cells) were infected with 10 pfu/cell of ND stocks and an equivalent amount of viral protein for DI stocks. 40h post-infection, the cells were collected, and Post-nuclei supernatants were made in 5 mM EDTA and loaded onto linear 20–40% (w/w) CsCl gradients (Beckman SW60). After centrifugation (40 000 r.p.m., 12 °C, overnight), the nucleocapsidsbanding in the CsCl gradient sent to the pellet were collected as describedpreviously (Calain & Roux, 1995), the nucleocapsid RNAs were phenol-extracted and ethanol-precipitated. The resulting RNAs were characterized by Northern blotting using a biotinylated riboprobe (Biotin RNA Labeling Mix, Roche) generated in vitro by Sp6 RNA polymerase transcription of the minus strand complementary to nucleotides 4’483–4’859 of the (+) ND genome (sequence overlapping the end of M ORF and its 3’UTR). RNA detection was performed by using Chemiluminescent Nucleotide Acid Detection Module (Pierce) according to manufacturer’s instructions.
Tandem Affinity purification and Buffers
The Tandem Affinity Purification method was described by Séraphin and colleagues (Rigaut, Shevchenko et al., 1999;Puig, Caspary et al., 2001). Basically, the Tandem Affinity Purification (TAP) consist of a first step where ProtA binds tightly to an IgG matrix overnight at 4°C, after which a TEV protease step is necessary to elute material under native conditions at room temperature during 3h. The eluate of this first affinity purification step is then incubated with calmodulin-coated beads in the presence of calcium for 3h at 4°C. After washing in order to eliminate any contaminants and the TEV protease, the bound material is released under mild conditions with EGTA at room temperature (see also Figure 4 of results Part II). Finally, the purified proteins were concentrated by a standard Acetone precipitation. 300μl of Calmoduline SepharoseTM beads, 300μl of IgG SepharoseTM beads (Amersham-Biosciences), 150 units of AcTEV protease (Invitrogen), and 2 Poly-Prep Chromatography Columns (Bio-Rad laboratories) were utilized for the different steps of the Tandem Affinity Purification (TAP) for each sample. The following buffers were used: Lysis Buffer (150mM NaCl, 20mM Tris pH 8.3, 2mM EDTA, 0.6% NP40, 0.5mM AEBSF), Equilibration IgG Buffer (150mM NaCl, 20mM Tris pH 8.3, 2mM EDTA, 0.1% NP40), TEV cleavage Buffer (150mM NaCl, 20mM Tris pH 8.3, 05mM EDTA, 0.1% NP40, 1mM DTT), Calmodulin binding Buffer (150mM NaCl, 20mM Tris pH 8.3, 1mM MgAcetate, 10mM β-Mercaptoethanol, 1mM Imidazole, 2mM CaCl2, 0.1% NP40), and Elution Buffer (150mM NaCl, 20mM Tris pH 8.3, MgAcetate 1mM, 10mM β-Mercaptoethanol, 1mM Imidazole, 4mM EGTA, 0.1%
NP40).
In gel digestion
This part was done by the Core Facility Proteomic, Centre Médical Universitaire, 1 rue Michel-Servet, 1211 Genève 4.
Fragments of the gel containing proteins of interest were cut out for digestion with trypsin by using the following procedure. Gel fragments obtained after one-dimensional electrophoresis (1-DE) were first destained by incubation in 100 μl of 50 mM ammonium bicarbonate and 30% acetonitrile (AcN) for 15 min at room temperature. Destaining solution was removed and fragments were then incubated for 35min at 56°C in 50 μl of
10 mM DTT in 50 mM ammonium bicarbonate. DTT solution was then replaced by 50 μl of 55 mM iodoacetamide in 50 mM ammonium bicarbonate and the gel fragments were incubated for 45 min at room temperature in the dark. Gel pieces were then washed for 10 min with 100 μl of 50mM ammonium bicarbonate and for 10 min with 100 μl of 50 mM ammonium bicarbonate and 30% AcN. Gel pieces were then dried for 30 min in a Hetovac vacuum centrifuge (HETO, Allerod, Denmark). Dried pieces of gel were rehydrated for 45 min at 4°C in 5–20 μl of a solution of 50 mM ammonium bicarbonate containing trypsin at 6,25 ng/μl. After overnight incubation at 37°C, gel pieces were dried in high vacuum centrifuge before being rehydrated by the addition of 20 μl of H2O and finally dried again. Elution of the peptides was performed with 20 μl of 1% TFA for 20 min at room temperature with occasional shaking. The TFA solution containing the proteins was transferred to a polypropylene tube. A second elution of the peptides was performed with 20 μl of 0.1% TFA in 50% AcN for 20 min at room temperature with occasional shaking. The second TFA solution was pooled with the first one. The volume of the pooled extracts was reduced to 1–2 μl by evaporation under vacuum. Control extractions (blanks) were performed using pieces of gels devoid of proteins.
Protein identification by peptide fragmentation sequencing
This part was done by the Core Facility Proteomic, Centre Médical Universitaire, 1 rue Michel-Servet, 1211 Genève 4.
Peptides extracted following in-gel digestion were dissolved in 9 μL 5% CH3CN, 0.1%
formic acid and 5 μL was loaded for liquid chromatographic mass spectrometric analysis
(LC-MS/MS). A precolumn (100 μm inner diameter, 2-3.5 cm long) was connected directly to an analytical column (75 μm inner diameter, 9-10 cm long). Both columns were packed in-house with 5 μm, 3 Å Zorbax Extend C-18 (Agilent). A gradient from 4 to 56% solvent B in solvent A (Solvent A: 5% CH3CN, 0.1% formic acid, Solvent B:
80% CH3CN, 0.1% formic acid) was developed over 15 min at a flow rate of approximately 300 nl/min. The concentration of solvent B was increased to 98% before returning to start conditions for re-equilibration of the column. The eluate was sprayed directly into the nanoESI source of an LCQ DecaXP ion trap mass spectrometer (Thermo Finnigan, San Jose, CA, USA) with a spray voltage of 1.8-2.2 kV. Data dependent
acquisition was used to automatically select 2 precursors for MS/MS from each MS spectrum (m/z range 400-1600). MS/MS spectra were acquired with normalized collision energy of 35%, an activation Q of 0.25 and an isolation width of 4 m/z. The activation time was 30 ms. Dynamic exclusion was applied with a repeat count of 2, an exclusion time of 30 s, and an exclusion peak width of ±1.5 Da. Wideband activation was also applied. Maximum injection times of 50 ms and 200 ms were used for MS and MS/MS acquisitions, respectively, and the corresponding automatic gain control targets were set to 108.
MS/MS database search and validation
This part was done by the Core Facility Proteomic, Centre Médical Universitaire, 1 rue Michel-Servet, 1211 Genève 4.
After MS/MS acquisition, the peak lists were generated using Bioworks Browser version 3.1 (ThermoFinnigan, CA, USA) and the resulting dta files from each analysis were automatically combined into a single text file with an in-house software. The database searches were performed with MASCOT software version 2.2.03 (Matrix Science, London, UK) against UniProtKB (Release 14.3 composed of the UniProtKB/Swiss-Prot Release 56.3 of 14-Oct-2008: 399749 entries, and the UniProtKB/TrEMBL Release 39.3 of 14-Oct-2008: 6678831 entries) with the following parameters: taxonomy, homo sapiens; enzyme selected, trypsin with one missed cleavage allowed; one fixed modification: carboxymethylated cysteine, one variable modification: oxidation of methionine; the average mass selected, a precursor mass error of 2.0 Da; and a peptide mass error of 1.0 Da.
The protein hits were validated using the MudPIT scoring. Only proteins that were identified with at least two high scoring peptides from Mascot were considered to be true matches. “High scoring peptide” correspond to peptides that were above the threshold (p<0.05) in Mascot searches. In this condition, the threshold of significance was given by a score of 39 or higher by Mascot.
Two-hybrid
The yeast two-hybrid assays were performed by Pierre-Olivier Vidalain and colleagues as previously described (Caignard, Guerbois et al., 2007b). Basically, the DB (DNA binding domain) and AD (transactivation domain) of the yeast transcription factor Gal4p were used as “bait” and “prey” for this screening. The different M clones were fused to the GAL4-BD protein and a human spleen cDNA library cloned in the Gal4p-AD vector was used for the screening. HIS3 was used as a reporter gene and the [His+] colonies were picked and purified for 3 weeks by culturing on selective medium in order to eliminate false positives. The AD-cDNAs were PCR amplified, sequenced and identified by blast analysis.
Results
PART I:
Structure-function analysis of SeV Matrix protein
Introduction
The matrix protein (M) has been known for a long time to be very important for Sendai virus (SeV) budding, but the way M functions is still poorly understood. Most probably, the majority of the roles attributed to M are dependent on its capacity to reach the plasma membrane (PM) where budding occurs. One important question we would like to answer is how M is targeted to the PM and if any motif or region in its primary sequence would be sufficient and necessary for it. Until now, M has never been crystallized and therefore, the lack of its tertiary structure has not allowed a clear mutagenesis strategy in order to point out the critical regions of M. As explained in the general introduction, some putative interesting motifs have already been identified and more or less characterized. The mutant M30 previously described in our laboratory (Mottet, Muller et al., 1999) was designed in order to study the relevance of a well conserved motif, namely VRRT (amino acid residues 113-116). The disruption of this motif by two substitutions (Thr112Met and Val113Glu) was studied in an infection context using SeV minigenomes, and demonstrated that essential functions of the protein were abrogated, including its targeting to the PM. More recently, a YLDL motif (amino residues 50-53) was mutated by Irie and colleagues into alanines and studied in the context of viral like particles (VLPs) production (Irie, Shimazu et al., 2007). In this particular context, it was shown that the mutated M protein was impaired for VLPs production and that the YLDL motif could be responsible for an interaction with the cellular protein Alix (AIP1), a protein implicated in the multivesicular bodies machinery
(MVB). However, these results were difficult to reconcile with data published by Gosselin-Grenet and co-workers (Gosselin-Grenet, Marq et al., 2007), showing that this cellular machinery was dispensable for SeV budding. The only motif within a Paramyxovirus protein clearly identified that could recruit a partner of the MVB machinery was found within the matrix protein of PIV5 (Schmitt, Leser et al., 2005).
Interestingly, this motif, ∅-P-x-V (∅ indicates any aromatic residue), is also predicted in SeV M protein (amino acids residues 334-337, YPNV). Finally, the last five amino acids KIRKL of SeV M protein, when deleted were also shown to almost completely abort the ability of M to produce VLPs. None of these mutants (except for M30) were analyzed for their intracellular localization.
Thus, very little is known about the matrix structure and the little that is known
Thus, very little is known about the matrix structure and the little that is known