Pax6 regulates genes important for glucose stimulated insulin biosynthesis and

In most species, preproinsulin exists as a single gene, whereas in the mouse and the rat, two non-allelic insulin genes are present. Yet, the regulatory elements on the insulin promoters which were extensively studied are conserved between rodents and human. This figure illustrates the rat insulin 1 and insulin 2 gene promoters with the transcription factors binding it. Importantly, for our study, Pax6, Pdx1 and MafA are able to bind and activate the transcription of both rodents and human preproinsulin transcription.

For this chapter, I did most of the intellectual thinking, the mass majority of the experiments, and the entire writing of this chapter. I collaborated with Yvan Gosmain who helped in preparing the primary rat islets and the immunostaining as well as Jacques Philippe who contributed to the design of the experiments.

In this study, we screened for target genes of Pax6 in β-cells. We found Pax6 to regulate transcription of insulin 1, insulin 2, GLUT2, GK, Pdx1, MafA and Nkx6.1, all playing a very important role in the glucose stimulated insulin secretion. We further demonstrate that reduced Pax6 expression in β-cells results in decreased glucose-stimulated insulin secretion.

Pax6 regulates genes important for glucose stimulated insulin biosynthesis and secretion

Abstract

Pax6 is important in the development of the pancreas and was previously shown to regulate pancreatic endocrine differentiation, as well as the insulin, glucagon, and somatostatin genes. Pax6 knockout mice have very few β-cells and heterozygous mutations in Pax6 results in glucose intolerance or diabetes in both human and mice. We aim to better understand the critical role of Pax6 in -cell differentiation and function, through the investigation of the implication of Pax6 in the transcriptional control of key pancreatic-genes. We developed three Pax6-deficient models using partial knock-down with siRNA in primary rat β-cells and in two cell-lines- βTC3 and HIT-T15 insulin-producing cells. Through candidate gene approach we investigated potential Pax6-regulated genes. We found Pax6 to directly regulate the transcription of insulin 1, glucokinase, Pdx1, MafA and Nkx6.1 through directly binding and activating their gene promoter. Furthermore, we demonstrate that Pax6 deficiency in β-cells results in decreased glucose-stimulated insulin secretion. We conclude that Pax6 is critical for insulin gene transcription and glucose stimulated insulin secretion via the control of insulin 1, GLUT2, glucokinase, Pdx1, MafA and Nkx6.1.

76 Introduction

Impaired glucose-stimulated insulin secretion (GSIS) is an early feature of type 2 diabetes characterized by elevated basal secretion and reduced responsiveness to glucose stimulation [225, 226]. Mutations, or even heterozygous mutations, in Pax6 result in impaired insulin secretion [124, 157, 227]. Therefore, we used β-cells isolated from rat islets or β cell lines deficient in Pax6 to study the transcriptional effects of Pax6 on genes involved in β-cell function and in particular insulin secretion in response to glucose.

In pancreas specific Pax6 knockout mice, very few β cells are present, supporting the notion that Pax6 in the pancreas is essential for normal β-cell function. Additionally, GLUT2 (facilitative glucose transporter 2) protein was not detected implicating Pax6 in the expression of the GLUT2 gene [153]. Studies in cell culture indicate that Pax6 regulates Pdx1 expression as Pax6-binding sites have been detected on the Pdx1 promoter [166]. And finally, Pax6 has been demonstrated to activate insulin gene transcription through binding to the C2 on its promoter [122, 228].

Due to the importance of GSIS in the development of type 2 diabetes, substantial work has been done to understand the whole process of GSIS in the β-cell: glucose enters the cytoplasm through facilitative glucose transporters (GLUT2), followed by the phosphorylation of glucose by glucokinase (GK) to obtain glucose-6-phosphate; this is the rate limiting step of glycolysis. ATP/ADP ratio is then increased resulting in membrane depolarization, KATP channel closure and Ca²⁺ influx, resulting in exocytosis of insulin granules [162, 229]. This process is related to a complicated molecular network in which some transcription factors play a crucial role.

The Pdx1 transcription factor is crucial for pancreatic development. It plays an important role in the regulation of β-cell specific genes including insulin, GLUT2 and glucokinase [4, 230-232]. Heterozygous mutations in Pdx1 result in impairment of insulin secretion in response to glucose, including reduction of GLUT2 expression, reduced NAD(P)H, impaired mitochondrial function and reduced Ca²⁺ influx in response to glucose [233]. The effect of Pdx1 on GSIS could be mediated through either GLP1-R or TFAM (nuclear-encoded mitochondrial factor A )[234, 235]. In INS-1 cells, it was found that downregulation of Pdx1

reduced GLP1-R levels [234]. GLP1 is a well described stimulator of the GSIS [236]. Recently, TFAM was also found to be a direct target of Pdx1 [235]. TFAM is a ubiquitously expressed protein, overexpression of TFAM was shown to rescue the GSIS in Pdx1 activity-deficient rat islets [235]. Therefore, the down-regulation of GLP-1R or TFAM induced by Pdx1 deficiency may contribute to β-cell dysfunction.

Another transcription factor that seems to be important for β-cell response to glucose is MafA. This basic leucine zipper transcription factor is present in insulin-positive cells and activates the insulin gene promoter through its interaction with Pdx1 and Beta2/NeuroD1 in a synergistic manner [54]. Additionally, up-regulation of MafA alone was sufficient to improve endogenous insulin mRNA levels [141]. Furthermore, Zhang et al. [237] reported that mice deficient in MafA developed diabetes due to impaired insulin secretion. This study also revealed that MafA knock-out mice displayed reduced expression levels of Insulin1, Insulin2, Pdx1, Beta2/NeuroD1, and GLUT2. In agreement with those results, overexpression of MafA caused increased GSIS in addition to the up-regulation of important β-cell genes including GLUT2, Pdx1, Nkx6.1, GLP-1R, prohormone convertase 1/3 (PC1/3) and pyruvate carboxylase (PC) [238].

In adults, Nkx6.1, like Pdx1 and MafA is expressed solely in β-cells [130, 137-140, 239-241].

Nkx6.1 seems to be important for β-cell function. Knock-down of Nkx6.1 in primary rat islets and in INS-1 cells was accompanied by a significant decrease in GSIS relative to control cells, revealing a role for Nkx6.1 in the control of GSIS in islet β-cells [240]. Overexpression of Nkx6.1 in rat islets caused a clear enhancement of glucose-stimulated insulin secretion (GSIS), whereas overexpression of Nkx6.1 in human islets caused increased cell proliferation, along with complete retention of GSIS. It is therefore possible that Nkx6.1 is among the very rare factors capable of stimulating β-cell replication along with maintenance or even enhancement of β-cell function [242].

Insulin, GLUT2 and Pdx1 are major players in the GSIS and therefore β-cell function and were previously proposed or described to be regulated by Pax6. We therefore wanted to see if Pax6 is involved in the transcriptional regulation of other genes important for GSIS. In this study, we demonstrate that Pax6 deficiency in isolated rat islets β-cells, or in two different β

cell-lines results in an inhibition of the transcription of insulin1, insulin2, GLUT2, glucokinase, Pdx1, MafA and Nkx6.1. We further demonstrate Pax6 has binding sites on the Insulin1, GK, Pdx1, MafA and Nkx6.1. These binding sites are functional since in transactivation assays, Pax6 was able to activate transcription from these promoters. Finally, we demonstrate that Pax6 deficiency results in impaired GSIS. We conclude that Pax6 is important for β-cell function and control of GSIS through the control of several genes implicated in GSIS.

Materials and Methods Primary cells

Primary rat β cells were isolated by FACS as described previously [243]. Briefly, Islets of Langerhans were isolated by collagenase digestion of pancreas from male Wistar rats (150-200g) followed by Histopaque-1077 (Sigma) purification. β-cells were purified by autofluorescence-activated cell sorting (FACS) using a FACStar-Plus (BD Biosciences, NJ, USA). Sorted β-cells were washed in culture medium (DMEM, 10% FCS, 11.2mM glucose, 110mg/l Na pyruvate, 66U/ml penicillin, 66 μg/ml streptomycin, 50mg/l gentamycin) and allowed to recover overnight in suspension at 37°C in nonadherent 100-mm Petri dishes.

Cells were then collected, resuspended in culture medium at 600,000 cells/ml and plated in 60 μl droplets on plastic culture dishes coated with extracellular matrix derived from 804G (rat bladder carcinoma) cells to facilitate adhesion and spreading.

Cell culture

βTC3 [200] and HIT-T15 [244] cells were cultured in RPMI 1640 medium containing 11.1 mM glucose and supplemented with 10% (vol/vol) fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin. BHK21 (non-islet Syrian baby hamster kidney cells) cells were grown in RPMI 1640 medium supplemented with 5% fetal calf serum, 5%

newborn calf serum, 2 mM glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin.

RNA preparation and RT-PCR analysis

Levels of gene expression in primary -cells, HIT-T15 and βTC3 lines were quantified. Total RNA from transfected cells was isolated and controlled on the 2100 Bioanalyzer from Agilent. Reverse transcription reactions were then performed using 1-2μg of total RNA in the

presence of random hexamer primers and the MMLV-RT enzyme kit (Promega). Target genes were analyzed by real-time RT-PCR using a Power SYBR Green PCR Master Mix (Applied Biosystems) on an ABI Prism 7900 HT detection system (Applied Biosystems). PCR amplifications were controlled to display a single homogeneous melting curve together with the slope and error obtained with the standard curve. The raw CT values of each target genes, obtained from SDS 2.2.2, are normalized against that of three housekeeping genes.

These housekeeping genes are identified using the GeNorm method which defines a gene stability measure for all the internal control genes according to the principle that the expression ratio of two internal control genes has to be identical in all the samples. The quantification approach used is the comparative CT method also known as the 2-DDCT method. The CT values of the sample of interest and of the control are compared in the log linear amplification phase. Real-time PCR and data analysis were performed at the Genomics Platform (CMU, Geneva), NCCR ‘‘Frontiers in Genetics’’.

RNA interference

Two different specific sequences of siRNA (Stealth RNAi, 25 mers) were designed by Invitrogen against the hamster, rat and mouse Pax6 mRNA sequences. These siRNA were designed in two exons common for the Pax6 isoforms. Appropriate scramble siRNA were obtained at the same time (the percentage of GC content was identical to Pax6 siRNA). HIT-T15, or βTC3 cells grown in 6-well plates were transfected with 100nM of the siRNA cocktail (siPax6-614 and siPax6-1007) or scramble using 5μl Lipofectamine 2000 (Invitrogen, Carlsbad, CA) as recommended by the supplier. For primary rat β cells, 20000 cells were spotted on a lammin matrix and transfected with the same siRNA and lipofectamin concentrations. Transfections were performed twice sequentially in two different days. Total RNA and nuclear extracts were isolated after 72h for βTC3 and HIT-T15 cells or after 96h of the primary rat β cells.

Western blot analyses

Nuclear and total extracts were isolated from transfected HIT-T15, βTC3 or primary rat β cells. 10-15 µg of each protein extract were resolved on a 10% sodium dodecyl sulfate-polyacrylamide gel and transferred electrophoretically to polyvinylidene difluoride membranes. Immunoblotting was performed with polyclonal antibodies to rabbit Pax6

diluted 1/1000 (gift from Dr S. Saule), Pdx1 diluted 1/1500 (gift from Dr C. Wright), and goat anti-rabbit IgG conjugated with horseradish peroxidase diluted 1/2000 (#sc2030, Santa Cruz, CA). The signal was detected with Super Signal West Pico Trial Kit (Pierce Chemical Co., IL).

Protein loading was normalized by immunodetection of rabbit TFIIE- diluted 1/500 (#C17, Santa Cruz). At least three independent experiments were performed with nuclear or total cell extracts.

Immunofluorescence

Slides were prepared from cultured primary rat β cells, fixed with 4% paraformaldehyde for 10 min, and incubated with antibodies directed against insulin (1:500) or glucagon (1:500) (Sigma). DAPI was used to highlight cell nuclei.

Plasmids

The 410bp rat insulin 1 promoter was kindly provided by Dr. Fleenor (Duke University), the -2300bp Pdx1 promoter was kindly provided by Dr. Mellul (Hebrew University), the -1600bp glucokinase promoter was kindly provided by Dr. Pierreux (Louvain Unviersity), the -1106bp Nkx6.1 promoter was kindly provided by Dr. German (University of California) and the MafA -720bp was cloned into pGL2-Basic. The mouse Pax6 (p46) cDNA was subcloned into pSG5.

Promoter analysis

Cell extracts were collected 48h after transient transfection, and promoter activity was assessed by measurement of the luciferase (luc) activity as previously described [245] and normalized against placental alkaline phosphatase (PAP) since cells were cotransfected with a plasmid containing the human placental alkaline phosphatase gene (pSV2A-PAP) to monitor transfection efficiency. PAP and Luc activities were measured by spectrophotometer and luminometer, respectively. A minimum of three independent transfections were carried out, each of them in duplicate. The total amount of DNA used for transfection was kept constant by adding the pSG5 vector.

Electrophoretic mobility shift assays (EMSAs)

EMSA reactions were performed as previously described [154]. Briefly, probes were labeled with γ-ATP (³²P) and approximately 50000 cpm of these 5'-end radio-labeled oligonucleotide probes were incubated with nuclear protein extracts (10g of proteins). The probes used in

this study: insulin 1 tctgggaaatgaggtgcaa; GK gactaatatttctctcacccctgcccctgcgttga; Pdx1 agctttgctttctgctgagagcctctt MafA ctggctttacgatcctggaacctcagaatctgcca; Nkx6.1 gctaaagagaggcagggaggggtgcaaatatttta, and their respective antisense sequences. After migration into 6% non-denaturating polyacrylamide gels, DNA-proteins complexes were visualized after an overnight exposition on an X-Ray film.

Chromatin immunoprecipitation assay (ChIP)

ChIP assays were performed according to Orlando et al [246]. Briefly, formaldehyde-crosslinked chromatin extracts were prepared from βTC3 and HIT-T15 cells and fragmented by enzymatic digestion (Enzymatic shearing kit, Active Motif Europe, Belgium). Fifty g of chromatin extract were first precleared with Protein A Sepharose beads (CL-4B, Pharmacia Biotech AB, Uppsala, Sweden) for 1h. After centrifugation, supernatants were incubated overnight at 4°C with 8 g of anti-Pax6 (serum 13) and -acetyl-Histone H4 antibodies (#06-866, Upstate, Lake Placid, NY), or rabbit IgG (#sc-2027, Santa Cruz). The immunoprecipitated DNA/protein complexes were bound to Protein A Sepharose beads after 3h of incubation at 4°C and washed in a low salt buffer, high salt buffer, LiCl buffer and Tris-EDTA buffer in succession as described by Duong et al[247]. Proteins were eliminated using proteinase K (200 g, Applichem) in the presence of 10 % SDS by overnight incubation at 37°C. After phenol extraction, the DNA was precipitated, suspended in water and used as a template for PCR. The sets of PCR primers used for analysis of binding contains the Pax6 putative binding site. Primer sequences: for insulin 1 ggaactgtgaaacagtccaagg and ccccctggactttgctgtttg; for GK- ctgtgacttgcccaggagat and aagcctctgactacccaacc; for Pdx1- agcgagcttgtttttctgct and caccccaggatgtttgctta; for MafA ggatctgagacaccgaagga and atgggactgcacagcagag; for Nkx6.1 cgctggctctagactggaa and cacaccttttgattggctga; for PC2 gctggactgccagatgtttag and gcatccttctagaggtgactcat; for Nkx2.2 gcctgggaggctaggatagt and ctctagcagtggcagggttc. PCR products were verified on ethidium bromide-stained 3% agarose gels and analyzed by real-time PCR using a Light-Cycler (Roche Diagnostics, Rotkreuz, CH).

Insulin secretion test

Primary rat β-cells transfected either with Pax6 siRNA or scramble RNA were preincubated for 1h at basal (2.8mM) glucose in Krebs-Ringer buffer (KRB), pH7.4, containing 20mM HEPES and 0.1% (w/v) BSA, followed by a second 1h incubation in KRB at 2.8-16.7mM glucose.

Samples of the supernatant were assayed for insulin. To determine total insulin content, insulin was extracted using 95:5 ethanol/acetic acid. Insulin was measured using a Rat Insulin ELISA kit (Mercodia, Sweden).

Results

The aim of the present study was to determine the target genes of Pax6 in pancreatic β-cells and thus better define its role in β-cell function. To define Pax6 target genes, we developed a Pax6-deficient model through partial knock-down in primary rat β cells and in insulin-producing cell lines; HIT-T15 and βTC3 with specific siRNA for Pax6 mRNA.

Knock-down of Pax6 in primary β-cells from rat

Rat islets were isolated by collagenase following trypsin treatment to disperse the endocrine cells. FACS sorting was applied, as described in [248] and the fraction corresponding to β- cells was then cultured. Immunofluorescence for insulin, glucagon and DAPI indicates that the β-cell fraction consists of over 90% insulin producing cells (Fig. 1A). Cells were then transfected with either Pax6 siRNA (siPax6) or control scrambled sequence. We obtained a 71% and 55% decrease in Pax6 mRNA and protein levels, respectively, in the cells transfected with Pax6 siRNA (Fig. 1B,C).

FIG. 1: Pax6 silencing in primary rat β cells. A. Immunostaining of the β-cell fraction obtained after FACS sorting of primary rat β cells. Red-insulin, green-glucagon, DAPI-blue. B. Real-time quantitative RT-PCR from RNA obtained from primary rat β cells transfected with a scrambled (Sc) or Pax6 siRNA (siPax6) for 96 h. The results were corrected relative to three housekeeping mRNA levels. The relative mRNA levels are presented as the means ± standard errors of the means (SEM) of at least three independent experiments. *, P < 0.05; **, P <

0.01. C. Western blot analyses of Pax6 and TFIIE from total extracts of primary rat β cells transfected with scrambled or Pax6 siRNA for 96 h.

Since insulin is a well characterized target of Pax6 and the insulin 1 gene promoter is known to bind Pax6 through binding to the C2 element on its promoter [122, 228], we measured the insulin mRNA levels in primary β-cells in order to provide evidence that the partial decrease of Pax6 obtained is sufficient to reduce transcription of the insulin gene. We found that both insulin 1 and insulin 2 gene expression were decreased in cells treated with Pax6 siRNA (Fig. 2A).

Pax6 regulates the transcription of Insulin1 and Insulin2, GLUT2, GK, MafA, Pdx1 and Nkx6.1

We first investigated whether Pax6 regulates genes involved in glucose stimulated insulin secretion. The gene encoding the β-cell glucose transporter GLUT2 and the transcription factor Pdx1 were previously described to be regulated by Pax6 [122, 166, 228]. We confirm that Pax6 indeed regulates both the Pdx1 and GLUT2 genes (Fig. 2B). Protein levels of Pdx1 were also decreased (Fig. 2C).

We then measured the mRNA transcription levels of MafA, Pdx1, Nkx6.1 transcription factors and glucokinase (GK). The four genes were significantly decreased in Pax6 deficient primary rat β-cells, indicating that Pax6 regulates their expression (FIG. 2B). Nkx2.2 as well as the insulin receptor (IR) and the insulin receptor substrate (IRS1) levels were unchanged in rat β cells treated with Pax6 siRNA (Fig. 2B).

FIG. 2: Pax6 regulates the transcription of Insulin1 and Insulin2, GLUT2, GK, MafA, Pdx1 and Nkx6.1 in primary rat β cells. A, B. Real-time quantitative RT-PCR from RNA obtained from primary rat β cells transfected with a scrambled (Sc) or Pax6 siRNA (siPax6) for 96 h. The results were corrected relative to three housekeeping mRNA levels. The relative mRNA levels are presented as the means ± standard errors of the means (SEM) of at least three independent experiments. *, P < 0.05; **, P < 0.01. C. Western blot analyses of Pdx1 and TFIIE from total extracts of primary rat β cells transfected with scrambled or Pax6 siRNA for 96h.

Pax6-silencing in β-cell-lines results in decreased insulin, GK, MafA, Pdx1 and Nkx6.1 gene transcription

To further study the molecular mechanisms by which Pax6 regulates gene expression, we generated two other β cell-line models: βTC3 cells, an insulin producing cell-line from mice, transfected with siPax6 versus a scrambled sequence; in this system we had an 82%

decrease in Pax6 mRNA and a 72% decrease in Pax6 protein levels (Fig. 3A,B). The second cell-line was HIT-T15, an insulinoma cell-line from hamster, also transfected with siPax6 and control siRNA. After transfection with siPax6, we obtained a decrease of 72% and 65% in Pax6 mRNA and protein levels, respectively (Fig. 3A, B). Similarly to rat primary β cells, we quantified the insulin mRNA levels which were decreased. Indeed, both insulin 1 and insulin 2 mRNA levels were diminished in all three Pax6 deficient models (Fig. 3C).

FIG. 3: Silencing of Pax6 in. A,C. Real-time quantitative RT-PCR from RNA obtained from βTC3 and HIT-T15 cell lines transfected with a scrambled (Sc) or Pax6 siRNA (siPax6) for 72h. The results were corrected relative to three housekeeping mRNA levels. The relative mRNA levels are presented as the means ± standard errors of the means (SEM) of at least three independent experiments. *, P < 0.05; **, P < 0.01. B. Western blot analyses of Pax6 and TFIIE from nuclear extracts of βTC3 (left panel) and HIT-T15 (right panel) cells, transfected with scrambled or Pax6 siRNA for 72h.

We verified the results obtained in primary rat β cells in the two cell culture models. Similar to primary β cells, knockdown of Pax6 resulted in decreased transcription of the GK, Pdx1, MafA, and Nkx6.1 genes (Fig. 4A). We confirmed the decrease in Pdx1 mRNA levels results in

Dans le document The role of the transcription factor Pax6 in the development and function of pancreatic α- and β- cells (Page 75-100)