Pax6 regulates the β-cell response to incretins and free fatty acids

Source: Adapted from [258].

The β-cell response to incretins and free fatty acids (FFA) is associated with amplification of glucose stimulated insulin secretion. Incretin and FFA receptors are seven transmembrane G-protein coupled receptors. GPR119, GLP1-R and GIP-R activate the Gsα subunit and hence lead to increased cAMP levels, activation of protein kinase A and increased insulin secretion.

GPR40 act through the Gqα subunit leading to increased intracellular calcium which is also resulting in increased insulin secretion.

For this chapter, I did most of the intellectual thinking, the mass majority of the experiments, and the entire writing of this chapter. I collaborated with Yvan Gosmain who helped in preparing the primary rat islets, Audrey Guerardel who did the promoter characterization of GPR40, EMSAs for GPR40 and transactivation of the GPR40 in heterologous cell-line, and Prof. Jacques Philippe who contributed to the design of the experiments.

We found Pax6 to regulate GLP1-R, the receptor for the incretin GLP-1 and GPR40, the receptor medium- to long-chain fatty acids.

GLP-1/GIP/GPR119 receptors GPR40

100

Pax6 regulates the β-cell response to incretins and free fatty acids

Abstract

The transcription factor Pax6 is important in the development of the pancreas and was previously shown to regulate pancreatic endocrine differentiation, as well as the insulin, glucagon, and somatostatin genes. Incretin and fatty acid receptors are expressed on β-cells and allow their ligands to potentiate the glucose stimulated insulin secretion. To investigate the role of Pax6 in insulin secretion, we studied potential target genes in primary rat β-cells transfected with Pax6 small interfering RNA as well as in βTC3 and HIT-T15 insulin producing cell-lines. We now report that Pax6 controls the expression of the GLP1-R and GPR40 genes.

By binding and transactivation studies, we found that Pax6 directly binds the promoters of the GLP1-R and GPR40 genes and transactivates their transcription. We conclude that Pax6 is critical for regulating the β-cell response to incretins and fatty acids through the control of their promoters.

Introduction

Both incretins and FFA (free fatty acids) increase β-cell insulin secretion in response to glucose. Since Pax6 seems to be extremely important for β-cell function, we studied the regulation of their receptors by Pax6. We report here that Pax6 regulates the transcription of both GLP1-R and GPR40, and therefore regulates the β-cell response to digestion and circulating fatty acids.

Two incretins have been identified: glucagon-like peptide 1 (GLP-1) [259, 260] and glucose-dependent insulinotropic peptide (GIP) [261, 262]. It is thought that incretins play an important role in glucose homeostasis by promoting insulin secretion immediately upon meal ingestion. Both GLP-1 and GIP receptors are seven transmembrane-spanning receptors coupled to G-protein, their signaling function via the G s /adenylylcyclase pathway [263, 264]. Their physiological importance has been demonstrated by the finding of glucose intolerance both in GLP-1 [265, 266] and GIP [267] receptor knockout mice. Stimulation of insulin secretion by the incretin hormones GLP-1 and GIP has been found to be diminished in

101

type 2 diabetes. Interestingly, this impairment of GSIS in response to GLP-1 and GIP is due to a defect at the receptor level induced by the diabetic state [268]. GLP-1 and GIP receptors expression are decreased with chronic hyperglycemia, and this decrease is likely to contribute to the impaired incretin effects found in diabetes [268].

The glucose stimulated insulin secretion (GSIS) is potentiated in β-cells by FFA. The FFA receptors on β-cells that seem to play a role in this improved GSIS are GPR40 and GPR119 [269-272]. Both GPR40 and GPR119 are seven transmembrane G-protein coupled receptors, and exert their activity via to G q, which increases cytosolic Ca²⁺ concentrations and G s

which increase cAMP, respectively [258, 273, 274]. GPR40 is activated by medium- to long-chain fatty acids, while GPR119 is activated by long-long-chain FFA amides such as oleoylethanolamide and lysophosphatidylcholine [270, 275]. However, in contrast to the stimulatory action of FFAs on insulin secretion, long-term exposure of islets to FFA results in impaired glucose-stimulated insulin secretion through lipotoxic action leading to progressive β-cell failure accompanied by intracellular accumulation of lipid signalling molecules that inhibit insulin secretion [276, 277].

Heterozygous mutations in Pax6, in human, and rodents lead to defects in insulin secretion resulting in glucose intolerance [157, 227, 251]. In this chapter, studies in primary rat β-cells and β-cell lines suggest that the impaired glucose tolerance caused by mutations in Pax6 is at least partially mediated through the inhibition of transcription of the GLP1-R and GPR40 genes.

Several studies have examined the transcriptional regulation of the GLP1-R and GPR40 genes. The GLP1-R gene was found to be regulated by Pdx1, MafA [238, 278]. Whereas GPR40 was found to be regulated by Pdx1 and Beta2/NeuroD1 [279]. In chapter 2 of this thesis we demonstrate that Pax6 directly binds and regulates transcription of the Pdx1 and MafA genes in β-cells.

We conclude that Pax6 is critical for the β-cell response to FFA, incretins and glucose, acting directly and indirectly on the transactivation of the GPR40 and GLP1-R genes.

102 Materials and Methods

Primary cells

Primary β cells were isolated by FACS as described previously [243]. Briefly, Islets of Langerhans were isolated by collagenase digestion of pancreas from male Wistar rats (150-200g) followed by Histopaque-1077 (Sigma) purification. Β-cells were purified by autofluorescence-activated cell sorting (FACS) using a FACStar-Plus (BD Biosciences, NJ, USA). Sorted β-cells were washed in culture medium (DMEM, 10% FCS, 11.2mM glucose, 110mg/l Na pyruvate, 66U/ml penicillin, 66μg/ml streptomycin, 50mg/l gentamycin) and allowed to recover overnight in suspension at 37°C in nonadherent 100-mm Petri dishes.

Cells were then collected, resuspended in culture medium at 600,000 cells/ml and plated in 60μl droplets on plastic culture dishes coated with extracellular matrix derived from 804G (rat bladder carcinoma) cells to facilitate adhesion and spreading.

Cell culture

βTC3 [200] and HIT-T15 [244] cells were cultured in RPMI 1640 medium containing 11.1mM glucose and supplemented with 10% (vol/vol) fetal bovine serum, 2mM glutamine, 100U/ml penicillin, and 100μg/ml streptomycin. BHK21 (non-islet Syrian baby hamster kidney cells), and HEK293 (human embryonic kidney cells) cells were grown in RPMI 1640 medium supplemented with 5% fetal calf serum, 5% newborn calf serum, 2mM glutamine, 100U/ml penicillin, and 100μg/ml streptomycin.

RNA preparation and RT-PCR analysis

Levels of gene expression in primary -cells, HIT-T15 and βTC3 lines were quantified. Total RNA from transfected cells was isolated and controlled on the 2100 Bioanalyzer from Agilent. Reverse transcription reactions were then performed using 1-2μg of total RNA in the presence of random hexamer primers and the MMLV-RT enzyme kit (Promega). Target genes were analyzed by real-time RT-PCR using a Power SYBR Green PCR Master Mix (Applied Biosystems) on an ABI Prism 7900 HT detection system (Applied Biosystems). PCR amplifications were controlled to display a single homogeneous melting curve together with the slope and error obtained with the standard curve. The raw CT values of each target genes, obtained from SDS 2.2.2, are normalized against that of three housekeeping genes.

103

These housekeeping genes are identified using the GeNorm method which defines a gene stability measure for all the internal control genes according to the principle that the expression ratio of two internal control genes has to be identical in all the samples. The quantification approach used is the comparative CT method also known as the 2-DDCT method. The CT values of the sample of interest and of the untreated control are compared in the log linear amplification phase. Real-time PCR and data analysis were performed at the Genomics Platform (CMU, Geneva), NCCR ‘‘Frontiers in Genetics’’.

RNA interference

Two different specific sequences of siRNA (Stealth RNAi, 25 mers) were designed by Invitrogen against the hamster, rat and mouse Pax6 mRNA sequences. These siRNA were designed in two exons common for the Pax6 isoforms. Appropriate scramble siRNA were obtained at the same time (the percentage of GC content was identical to Pax6 siRNA). HIT-T15, or βTC3 cells grown in 6-well plates were transfected with 100nM of the siRNA cocktail (siPax6-614 and siPax6-1007) or scramble using 5μl Lipofectamine 2000 (Invitrogen, Carlsbad, CA) as recommended by the supplier. For primary rat β cells, 20000 cells were spotted on a lammin matrix and transfected with the same siRNA and lipofectamin concentrations. Transfections were performed twice sequentially in two different days. Total RNA and nuclear extracts were isolated after 72h for βTC3 and HIT-T15 cells or after 96h of the primary rat β cells.

Western blot analyses

Nuclear and total extracts were isolated from transfected HIT-T15, βTC3 or primary rat β cells. 10-15µg of each protein extract were resolved on a 10% sodium dodecyl sulfate-polyacrylamide gel and transferred electrophoretically to polyvinylidene difluoride membranes. Immunoblotting was performed with polyclonal antibodies to rabbit Pax6 diluted 1/1000 (gift from Dr S. Saule), and goat anti-rabbit IgG conjugated with horseradish peroxidase diluted 1/2000 (#sc2030, Santa Cruz, CA). The signal was detected with Super Signal West Pico Trial Kit (Pierce Chemical Co., IL). Protein loading was normalized by immunodetection of rabbit TFIIE- diluted 1/500 (#C17, Santa Cruz). At least three independent experiments were performed with nuclear or total cell extracts.

104 Promoter analysis

Cell extracts were collected 48h after transient transfection, and promoter activity was assessed by measurement of the luciferase (luc) activity as previously described [245] and normalized against placental alkaline phosphatase (PAP) since cells were cotransfected with a plasmid containing the human placental alkaline phosphatase gene (pSV2A-PAP) to monitor transfection efficiency. PAP and Luc activities were measured by spectrophotometer and luminometer, respectively. A minimum of three independent transfections were carried out, each of them in duplicate. The total amount of DNA used for transfection was kept constant by adding the pSG5 vector.

Electrophoretic mobility shift assays (EMSAs)

EMSA reactions were performed as previously described [154]. Briefly, probes were labeled with gamma-ATP (³²P) and approximately 50000 cpm of these 5'-end radio-labeled oligonucleotide probes were incubated with nuclear protein extracts (10g of proteins).

After migration into 6% non-denaturating polyacrylamide gels, DNA-proteins complexes were visualized after an overnight exposition on an X-Ray film. EMSAs were also performed using the following sequences: GLP1-R -737_-719 caggcccagggacagcaaggggtggacagggaaca;

GPR40 -2102_2075 tgaagctttcaatcaagcctgaagtctccaaaga; GPR40 -1942_-1907 gtcaacagctttgctgaggcgtgaagagcaggtgg and their antisense sequences. The sequence correspond to promoter regions including conserved putative Pax6 binding sites, using in silico analyses of binding site search with the Genomatix software (Matinspector, http//www.genomatix.de). Each probe was incubated with nuclear extracts from BHK-21 cells overexpressing mouse Pax6 (p46). An anti-Pax6 antibody was used to determine the specificity of Pax6 binding. Mutated Pax6 putative binding site oligonucleotides were also used for cold probe competition.

Chromatin immunoprecipitation assay (ChIP)

ChIP assays were performed according to Orlando et al. [246]. Briefly, formaldehyde-crosslinked chromatin extracts were prepared from InR1G9 cells and fragmented by enzymatic digestion (Enzymatic shearing kit, Active Motif Europe, Belgium). Fifty g of chromatin extract were first precleared with Protein A Sepharose beads (CL-4B, Pharmacia Biotech AB, Uppsala, Sweden) for 1h. After centrifugation, supernatants were incubated

105

overnight at 4°C with 8 g of anti-Pax6 (serum 13) and -acetyl-Histone H4 antibodies (#06-866, Upstate, Lake Placid, NY) as well as rabbit IgG (#sc-2027, Santa Cruz). The immunoprecipitated DNA/protein complexes were bound to Protein A Sepharose beads after 3h of incubation at 4°C and washed in a low salt buffer, high salt buffer, LiCl buffer and Tris-EDTA buffer in succession as described by Duong et al. [247]. Proteins were eliminated using proteinase K (200 g, Applichem) in the presence of 10% SDS by overnight incubation at 37°C. After phenol extraction, the DNA was precipitated, suspended in water and used as a template for PCR. The sets of PCR primers used for analysis of binding correspond to highly conserved regions of the GLP1-R and GPR40 gene promoters (containing the Pax6 putative binding site). Primer sequences: for GLP1-R agggcaaaggtgtggtgtag and ggttgaggctggattctgtt for GPR40, gctggcctcaaattcagaaa and cagcccttcatttaaacagca. PCR products were verified on ethidium bromide-stained 3% agarose gels and analyzed by real-time PCR using a Light-Cycler (Roche Diagnostics, Rotkreuz, CH).

Plasmids

The GLP1-R promoter (positions -1093 to +30), cloned in pGL2-Basic was kindly provided by Dr Lankat-Buttgereit, Marburg University [280], The GPR40 promoter (positions -2096 to +100) cloned in pGL3-Basic was kindly provide by Dr. Walker, Weitzmann institute [279]. The mouse Pax6 (p46) cDNA was subcloned into pSG5.

Insulin secretion test

Primary rat β-cells transfected either with Pax6 siRNA or scramble RNA were preincubated for 1h at basal (2.8mM) glucose in Krebs-Ringer buffer (KRB), pH7.4, containing 20mM HEPES and 0.1% (w/v) BSA, followed by a second 1h incubation in KRB at 16.7mM glucose in the presence or absence of 10nmol/l exendin 4. Samples of the supernatant were assayed for insulin. To determine total insulin content, insulin was extracted using 95:5 ethanol/acetic acid. Insulin was measured using a Rat Insulin ELISA kit (Mercodia, Sweden).

106 Results

We wanted to investigate whether Pax6 regulates the β-cell response to incretins and FFA, as Pax6 appears critical for the regulation of GSIS through the activation of the GLUT2 and glucokinase genes.

Silencing of Pax6 transcription and expression in β-cells

Similarly to chapter 2 in the results section, we used primary rat β-cells, as well as βTC3 and HIT-T15 cells transfected with Pax6 siRNA. We obtained a decrease of 71%, 76% and 65% in Pax6 mRNA levels in primary rat β cells, βTC3 and HIT-T15 cells, respectively and a decrease of around 50% in protein levels. As demonstrated in chapter 2, insulin 1 and insulin 2 mRNA levels were decreased in all three cell-types transfected with Pax6 siRNA.

Pax6 regulates transcription of GLP1-R and GPR40

We then measured the mRNA levels of both incretin receptors, GLP1-R and GIP-R in the three siPax6-treated cell types (Fig. 1A). GLP1-R mRNA levels were decreased by 61%, 63%

and 67% for primary rat β cells, βTC3 and HIT-T15 cells, respectively. No significant decrease in GIP-R levels were detected (Fig. 1A). Similarly, in order to see whether Pax6 regulates the transcription of the receptors to FFA which were previously described to amplify the GSIS in β cells-GPR119 and GPR40, we measured their mRNA levels by real-time RT PCR. We found a decrease of 86%, 78% and 83% in the mRNA levels of GPR40 in primary rat β cells, βTC3 and HIT-T15 cells, respectively, but no significant effect on GPR119 transcription.

107

FIG. 1: Pax6 regulates the transcription of GLP1-R and GPR40 in β-cells. A, B. Real-time quantitative RT-PCR from RNA obtained from primary rat β-cells, βTC3 or HIT-T15 transfected with a scrambled (Sc) or Pax6 siRNA (siPax6). The results were corrected relative to three housekeeping mRNA levels. The relative mRNA levels are presented as the means ± standard errors of the means (SEM) of at least three independent experiments. *, P < 0.05;

**, P < 0.01.

108

GLP1-R and GPR40 promoters contain binding sites to Pax6 and Pdx1

In order to determine whether Pax6 directly interacts with the GLP1-R and GPR40 gene promoters, we consulted the Genomatix, Matinspector (http://www.genomatix.de) database to find putative pancreatic transcription factor binding sites (Fig. 2A). For both promoters, we screened 3Kbp upstream of the transcription initiation site and at the 5’

untranslated region, and looked for Pax6 binding sites which are conserved between human, mice and rat. We found putative binding sites of Pax6 on both the promoters of GLP1-R (positions -737_-721) and of GPR40 (two binding sites, positions -2094_-2081 and -1933_-1920).

EMSA assays with probes containing each identified putative Pax6 binding sites were performed (Fig. 2). DNA-proteins complexes were observed with extracts from BHK-21 cells overexpressing mPax6. To verify the nature of these complexes, an antibody raised against Pax6 was used. We obtained a supershift of the complexes, indicating that Pax6 can interact with each of these promoter regions. Cold wild-type and mutant oligonucleotides were also added at a 200-fold excess to further verify specificity; while wild-type Pax6-binding sites disrupted the complexes, mutant sites did not, indicating that Pax6 binds specifically the GLP1-R and GPR40 gene promoters (Fig. 2B).

We then carried out ChIP experiments to confirm in vivo the binding of Pax6 on the GLP1-R and GPR40 promoters using the Ins1 promoter amplicon as a positive control for Pax6 binding [122] and the PC2 promoter amplicon as a negative control since it was previously described to contain no Pax6 binding sites [245]. Indeed, we found Pax6 to bind the Ins1, GLP1-R and GPR40, but not the PC2 promoters in both βTC3 and HIT-T15 cell lines (Fig. 2C, D).

109

FIG. 2: Pax6 binding sites are present on the GLP1-R and GPR40 gene promoters. A.

Schematic representation of the mouse GLP1-R and GPR40 gene promoters. Putative binding sites of Pax6 are represented by boxes. B. EMSAs were performed with labeled oligonucleotides containing Pax6 putative binding sites on the GLP1-R and GPR40 gene promoters in the presence of nuclear extracts from BHK cells overexpressing the empty vector (pSG5) or Pax6. 1-Radio-labelled probe alone, 2-Probe+BHK-21+pSG5, 3-Probe+BHK-21+mPax6, 4- Probe+BHK-21+mPax6+x200 cold probe, 5- BHK-21+mPax6+Pax6 antibody, 6- BHK-21+mPax6+x200 mutated probe. C, D. ChIP analysis, histograms represent the relative binding of the Pax6 protein to the indicated gene promoter in βTC3 (C) and HIT-T15 (D) cells.

Binding intensity data are expressed relative to IgG immunoprecipitation (nonspecific binding) and are presented as the means ± the standard errors of the means (SEM) for at least three independent experiments. *, P < 0.05; **, P < 0.01.

110

Pax6 and Pdx1 activate GLP1-R and GPR40 promoters

In order to determine the functionality of the identified transcription factor binding sites, we transiently transfected the -1093 GLP1-R and -2096 GPR40 promoters linked to a Luc reporter into the heterologous BHK21 cell line together with Pax6. We found Pax6 to be a potent activator of these promoters (Fig. 3).

FIG. 3: Pax6 transactivates the GLP1-R and GPR40 gene promoters. BHK-21 cells were transfected with the indicated promoters, in the presence of Pax6 or the empty vector.

Results represent relative Luc and PAP activities over the basal level for each construct. *, P

< 0.05; **, P < 0.01 compared to the transfection of the promoter with pSG5.

111

Silencing of Pax6 in primary rat β-cells results in no amplification of insulin secretion in response to glucose

In a first pilot experiment, we measured insulin secretion from primary rat β-cells transfected with siPax6 or scrambled siRNA. Insulin secretion was normalized to insulin content to control for any differences in cell number or viability. At high glucose concentrations (16.7mM glucose), exendin 4 (GLP-1 analog) lead to potentiating of the GSIS in cells transfected with a scrambled siRNA, while the insulin secretion was much lower in cells transfected with siPax6 and did not increase in the presence of exendin 4 (Fig. 4).

FIG. 4: Effect of Pax6 silencing on the amplification of glucose-induced insulin secretion in response to GLP-1. Primary rat β-cells transfected with siRNA against Pax6 or scrambled were incubated 1h in 16.7mM glucose in the presence or absence of 10nmol/l exendin 4.

Date represent insulin secretion over insulin content.

112 Discussion

The present and previous results demonstrate the importance of Pax6 as a major regulator of insulin biosynthesis [122] and insulin secretion by the activation of genes implicated in heterologous cell-line, Pax6 is able to activate the promoter of both GLP1-R and GPR40 (Fig.

4).

The observation that the decrease of GLP1-R and GPR40 mRNA levels is even greater than the decrease we obtain for Pax6 in our system, indicates that the observed effect of Pax6 is not only a direct affect. A possible explanation for that is a synergistic effect of Pdx1 or MafA with Pax6 on the promoters of GPR40 and GLP1-R, Pdx1, MafA and Nkx6.1 were previously shown to be able to form heterodimers with Pax6 and to act in a synergistic manner on promoters of their target genes [135, 201, 245, 281]. In chapter 2 of this thesis we demonstrated that these factors are direct targets of Pax6 which decrease upon Pax6 silencing. Hence, the hypothesis that the major decrease observed for these receptor gene expression is indeed due to the transcription regulation of GLP1-R and GPR40 was previously described to be regulated by Pdx1 for both, in addition to MafA for GLP1-R [238, 278, 279].

Dans le document The role of the transcription factor Pax6 in the development and function of pancreatic α- and β- cells (Page 100-179)