Below are described all the materials and methods used in the Additional Results chapter that have not been previously described in the manuscript of the Results section.
Animal experimentation
WT, Arg2-/-, miR155-/-, Rag2-/-, OT-Itg CD45.1+/+ and its crossing with Arg2-/- mice are described above. OT-IItg and CD45.1+/+ mice were purchased from The Jackson Laboratory (004194 and 002014, respectively) and crossed and bred at Charles River (France). Unless stated otherwise, mice were bred under specific pathogen-free conditions and acclimatized for more than one week prior to experiments. Animal experimentation was authorized by the cantonal veterinary office of Geneva and performed according to Swiss animal protection laws. CD45 typing was done as described above.
Cell lines
B16-OVA and MC38-OVA cells were maintained as described above. DC2114 cells were cultured in IMDM (Gibco) supplemented with 10% foetal bovine serum, 50 U/mL penicillin and 50 µg/mL streptomycin, and 50 µM β-mercaptoethanol.
Mouse tumor models
In all tumor experiments, 0.5x106 B16-OVA cells resuspended in PBS were injected subcutaneously into the back of host mice. Unless stated otherwise, 6- to 12-week-old female mice were used for experiments and tumors were allowed to grow for different periods of time according to specific experimental designs. Tumor size was quantified using a calliper and tumor volume was calculated using a rational ellipse formula (α2 × π × β/6, α being the shorter axis and β the longer axis).
Parasite inoculation
Parental and derivative strains of Toxoplasma gondii (ME49) tachyzoites were grown in confluent human foreskin fibroblasts (HFFs) maintained in Dulbecco’s Modified Eagle’s
Medium (DMEM, Gibco) supplemented with 5% foetal calf serum (FCS), 2 mM glutamine and 25 mg/ml gentamicin. In all experiments, 6- to 12-week-old male mice were infected with freshly egressed tachyzoites from HFFs monolayers, at the indicated doses of parasite inoculum, by intraperitoneal injection of 200 µL of the inoculum in DMEM. Infection severity and its symptoms were monitored during the course of the infection.
Arginase 2 overexpression in dendritic cells
Arg2 cDNA was PCR-amplified and cloned into the bicistronic lentiviral pWPI vector, which contains a GFP expression cassette for assessing transduction efficiency292. Transduction of DC2114 cells was performed as previously described284,292 and transduced cells were FACS-sorted on the basis of GFP expression on a FACS AriaII (BD). Arg2 overexpression was assessed by Western blot and real-time PCR as described above.Arg2-overexpressing, Arg2+/+ and Arg2 -/-tumor cell in vitro proliferation assays were performed using the CellTiter 96® AQueous One Solution (Promega) according to the manufacturer’s instructions.
Mouse T cell isolation
Total CD8+ T cells were isolated as described above. Total CD4+ T cells were isolated from splenic and lymph node single-cell suspensions using a CD4+ T Cell Isolation Kit (Miltenyi Biotec) and subsequently separated by AutoMACS or LS Columns (Miltenyi Biotec). Cell purity (95% or above) was confirmed by flow cytometry.
Cell sorting
DC2114 and B16-OVA cells transduced with the pWPI vector were sorted by FACS based on GFP expression using a BD FACSAria II. B16-OVA cells transfected with the GeneArt®
CRISPR Nuclease Vector with OFP Reporter were batch-sorted by FACS based on OFP expression using a BD FACSAria II. For B16-OVA clones, after expansion of the batch-sorted cells transfected with sgRNA 2, single cells were sorted in separate wells using a MoFlow Astrios cell sorter (Beckman Coulter).
In vivo DC2114- OT T cell priming
Control (pWPI alone) or Arg2-overexpressing DC2114 cells were pre-activated for 4 hours at 37 °C in the presence of 200 ng/uL of CpG-B ODN 1826 (Invivogen) and either 5.00 µM of OVA257-264 or 1.69 µM of OVA323-339. Subsequently, DC2114 cells were washed twice with PBS, resuspended in PBS, and 2x106 cells were subcutaneously injected into the forelimb region of WT mice. One day later, CD4+ or CD8+ T cells were isolated from lymph nodes and spleens of OT-IItg CD45.1+or OT-Itg CD45.1+ naïve mice, respectively. After CFDA-SE labelling, and according to each experimental plan, OT transgenic cells were resuspended in PBS and adoptively transferred to the DC2114 recipient hosts, via intravenous injection. Thus, mice transferred with OVA323-339-loaded DC2114 received 2-5x106 OT-II CD4+ T cells, while mice transferred with OVA257-264-loaded DC2114 received 2-5x106 OT-I CD8+ T cells. Three days later,
dLNs, ndLNs and spleens of all mice were retrieved and processed into single-cell suspensions by mechanical disruption through 70 m nylon filters.
Arginase 2 inhibitors in human T cells
Human PBMC were enriched from blood samples of anonymous healthy donors (Centre de transfusion de Genève) using Ficoll-Paque gradients and stored at -80 °C. Subsequently, CD8+ T cells were magnetically isolated from thawed PBMC samples using a Human CD8+ T Cell Enrichment Kit (Stem Cell Technologies) and plated in NUNC Maxisorop 96 well plates, previously coated overnight with CD3 antibodies at 2 g/mL (OKT3, eBioscience).
Immediately after, human T cells were co-stimulated with the addition of soluble CD28 antibodies at 2 g/mL (CD28.6, eBioscience) and in the presence of the following Arginase inhibitors: ABH hydrochloride (SML1466, Sigma), BEC hydrochloride (SML1384, Sigma), N-ω-hydroxy-nor-L-arginine, diacetate salt or nor-NOHA (399275, Merck-Millipore), CB-1158 (206811, MedKoo Biosciences). Arginase inhibitors were tested at 1, 3, 10, 30 and 100 nM concentrations, in the presence or absence of TCR ligation.
Flow cytometry
For proliferation assays, CellTrace CFSETM (CFDA-SE) staining was performed at 5 M concentration for 15 min at 37 °C in PBS. Flow cytometry labelling procedures and the
monoclonal antibodies used for staining are indicated above. Intracellular staining of the CD3
chain (6B10.2 clone, ThermoFisher) was done for 45 min at 4 °C in Permeabilization Buffer.
Human in vitro activated T cells were stained using identical procedures used for mouse cells.
However, in this case, Fc receptors were blocked by incubation with human serum (1/100 dilution) for 15 min at 4 °C and cells were stained using the following monoclonal antibodies:
CD62L (DREG-56), CD8a (HIT8a), CD69 (H1.2F3), CD4 (SFCI12T4D11), CD3 (SK7), all from ThermoFisher.
In silico crRNA design and OFP vector generation
Three different crRNA sequences targeting the first exon region of Arg2 (sgRNA 1-3) and three different crRNA sequences targeting the miR-155 seed sequence region of Arg2 3’UTR (sgRNA 4-6) were designed using the algorithms available online at https://crispr.mit.edu. Off-target cleavage events were predicted using the algorithm available online at
https://cm.jefferson.edu/Off-Spotter/. crRNA sequences targeting loci with 4 or less mismatches were discarded. Selected crRNA pairs were synthesised as single-stranded DNA
oligonucleotides (Eurogentec) with the addition of 3’ overhangs complimentary to the 5’
overhangs of the linearized GeneArt™ CRISPR Nuclease Vector with OFP Reporter vector, according to the manufacturer’s instructions. Subsequently, ssDNA oligonucleotides were annealed and ligated to the vector. The vector was later transformed into E. coli HB101
competent cells. DNA from ampicillin-resistant colonies was analysed for correct insertion of the crRNA sequences by Sanger sequencing following the manufacturer’s instructions. DNA from correct transformant colonies was purified using GeneJET Plasmid Maxiprep kits
(ThermoFisher), and the plasmids were stored at -20 °C until transfection.
Lipofectamine transfection of B16-OVA cells
One day prior to transfection, 10 x103 B16-OVA cells were seeded in 24-well plates. The next day, 2 g of purified plasmid DNA complexed with 1.50 L of Lipofectamine (ThermoFisher) and 2 L of P3000TM Reagent per well were transfected into B16-OVA cells, following the manufacturer’s protocol. 48 hours later, OFP expression were analysed by FACS for assessment of the optimal transfection conditions or batch-sorted as indicated above.
Analyses of DNA cleavage in B16-OVA cells
The first exon region of Arg2 (forward primer: TTGGTGGCTTAGGCATCG, reverse primer:
TAGGCTTAGTGTCCCGTCA) and the 3’ UTR region of Arg2 (forward primer,
GCAGAGGGCTTTCTGATTG; reverse primer CAGTTGTGAGAGTGCACAG) were PCR-amplified and enzymatically digested using the GeneArt™ Genomic Cleavage Detection Kit (ThermoFisher), following manufacturer’s instructions. Digested and undigested PCR products were electrophoretically separated and band intensities were quantified using a Bioanalyzer (Agilent) at the Genomics Platform of the University of Geneva. Sanger sequencing was performed at Fasteris, Geneva, using the forward primer indicated above.
Mice carrying the Arg2 3’UTR mutation
Prior to microinjection in mouse embryos, the cleavage efficiency of three different crRNA sequences (sgRNA 4, sgRNA 5 and sgRNA 6) was tested in B16-OVA cells as described above.
Selected crRNA pairs were synthesised as single-stranded DNA oligonucleotides (Eurogentec) with the addition of specific overhanging nucleotides: a 5’CACCG on the 5’ end of the top sgRNA was added, while a 5’AAAC on the 5’ end and an extra C were added at the 3’ end of the bottom sgRNA. Subsequently, ssDNA oligonucleotides were annealed by incubating at 95 °C for 3 minutes and allowed to cool down at room temperature for 1 hour. The px330 vector was digested with BbsI for 3 hours at 37 °C, run on a 1% agarose gel, and DNA was purified from the 8.5 kb band using the GeneJET Gel Extraction Kit (ThermoFisher). Purified vector and
aligned crRNAs were ligated for 5 minutes at room temperature and transformed into DH5α E.
coli cells. DNA from transformed colonies was screened by Touch-PCR (forward primer: the bottom oligo sgRNA; reverse primer: GGTATTTCCCATGATTCC). DNA from colonies with correct ligation of the insert was purified using GeneJET Plasmid Maxiprep kits
(ThermoFisher), and analysed by Sanger sequencing using the reverse primer used in the Touch-PCR.
The donor single-stranded oligodeoxynucleotide (ssODN) used for HDR-driven recombination was synthesised (IDT) mirroring the 5’ DNA strand (not targeted by the
sgRNAs). This 100 nt ssODN encoded the 7 bp substitution and spanned 50 nt upstream and 51 nt downstream from the miR-155 seed sequence. The two vectors encoding sgRNA 4 and sgRNA 6 were mixed with the ssODN in TE buffer, at 2.5 ng/µL for each vector and 10 ng/µL for the ssODN, and stored at -20 °C. Approximately 10 picolitres of the DNA mix were microinjected into two-pronuclear B6D2F1 hybrid zygotes, which were later implanted into NMRI foster dams by the Transgenic Core Facility of the University of Geneva.
Newborn mouse biopsies were screened for the presence of the substitution using primers specific for this 7 bp-substituted sequence, PCR amplifying in both upstream and downstream directions of the miR-155 seed sequence. The following primers were used for upstream amplification (forward: GCACCTTTCACAACCTACGG, reverse:
GGAACAGCAACAAGACCAGTAT) and for downstream amplification (forward:
CCTTTCACAACAGCATTACAGAG, reverse: GTGAAGGAACAGCAACAAGAC).