Material and Methods

III. 4. Material and Methods

Cell lines and media

Dictyostelium discoideum parental strain DH1-10 is grown in HL5 medium at 22°C and is referred as wild-type (WT) in the text (Caterina et al., 1994; Cornillon et al., 2000). phg1A knock-out (KO) strain was obtained and described previously (Cornillon et al., 2000). WT cells and phg1A KO cells expressing csA chimeras were maintained in HL5 supplemented with G418 (12.5 !g/ml). Although for simplicity these strains are referred to as WT and phg1A KO, for this study these strains were modified by introducing a plasmid encoding the Rep protein allowing replication of plasmids bearing the Ddp2 origin of replication (Shammat and Welker, 1999). Cells were diluted twice a week in order to maintain cultures at a density lower than 1.5x10⁶ cells/ml.

csA chimeric proteins

The csA-TM chimera was described previously (Froquet et al., 2012). The csA-SibA TM chimera was derived from the previously described csA-SibA (Froquet et al., 2012) by amplifying the

transmembrane domain with the following oligonucleotides:

ggattctctagattatgcggccgccatcgacctgcgccttaataagaaccaagcaccagcg and cgctggtgcttggttcttatta aggcgcaggtcgatggcggccgcataatctagagaatcc. The PCR fragment was subcloned in csA-0 plasmid digested by KpnI and XbaI. The sequences of the transmembrane domains of TM and csA-SibA TM are shown in figure 17. H0 and G3 are artificial transmembrane domains, their detailed sequence are shown in figure 29. The DNA sequences encoding these TMDs were subcloned in csA-0 after digestion by KpnI and XbaI. Plasmids were purified with PC Nucleobond kits (Macherey-Nagel).

Plasmids (20 !g) coding for the different constructs were introduced by electroporation in WT and phg1A KO cells (20x10⁶ cells). Cells were cultured in HL5 medium for 24 h then 12.5 !g/ml of G418 was added to the medium. Clones were usually visualized 10 to 15 days after the transfection.

Uncloned populations of transfected cells were used in all experiments, to avoid a possible bias due to isolation of single clones, and to ensure a wide range of expression levels.

Immunofluorescence

To detect in the same cells intracellular and surface csA, 10⁶ cells were harvested and washed with SB* (SB 1X, Sorbitol 100 mM, CaCl2 100 !M and HL5 0.5%), a medium found to preserve best the morphology of the cells while allowing optimal adhesion with its substrate (Smith et al., 2010).

Cells were allowed to adhere on a glass coverslip in SB* for 30 min. The cell surface csA was then labeled with a monoclonal antibody against native csA (41-17-21). Cells were then fixed with 4%

! (&!

paraformaldehyde in SB* for 30 min. The aldehyde was quenched by washing with 40mM NH4Cl in PBS. As secondary antibody, an Alexa 647-labeled anti-mouse (Biorad) was applied for 15 min.

After a –20°C methanol permeabilization, cells were incubated in PBS containing 0.2% BSA (PBS-BSA) for 5 min. To visualize intracellular csA the same first monoclonal antibody 41-17-21 was applied for 30 min followed by a Alexa 488-labeled anti-mouse (Biorad) for 30 min. Cells were either visualized at the confocal microscope or were detached from the coverslip and analyzed by flow cytometry.

In order to compare the intracellular localization of different csA chimeras with cellular markers, co-immunoflorescence was performed using antibodies against csA (41-17-21) and against markers of various intracellular compartment: protein disulfide isomerase (PDI), which is located in the ER, the p25 antigen (antibody H72) located in the membrane of recycling endosomes.

Stability of csA-constructs

To determine the turnover of csA, 5x10⁶ cells were incubated in HL5 containing 2mM cycloheximide. Aliquots of 1.5x10⁶ cells were collected after 0, 2 and 4 h and resuspended in 20 µl of sample buffer (0.103 g/ml sucrose, 5 x 10-2M tris, pH 6.8, 5 x 10-3M EDTA, 0.5 mg/ml bromophenol blue, 2% SDS, 10% !-mercaptoethanol). Samples were migrated on a 9% acrylamide gel, and transferred to nitrocellulose using a semi-dry transfer system (Invitrogen, Carlsbad, CA).

The membrane was incubated overnight in PBS containing 0.1% Tween 20 and 7% milk, then incubated successively with a mouse anti-csA serum 33-294-17 (Bertholdt et al., 1985), and a horseradish peroxidase-coupled goat anti-mouse IgG. The signal was revealed by enhanced chemiluminescence.

Cell surface biotinylation

This protocol is adapted from Navin Gopaldass, laboratory of Thierry Soldati, Sciences II, Geneva.

To quantify the amount of csA protein present at the cell surface, 30.10⁶ cells were harvested and washed in 10 ml SB-Sorbitol (phosphate buffer Na2HPO4/KH2PO4 17 mM pH 6.0 containing 120 mM sorbitol). The pellet was resuspended in 2 ml of SB-Sorbitol pH 8.0 containing 1 mg of NHS-SS-biotin (Pierce) and incubated on ice for 10 min. Cells were harvested and resuspended in 10 ml PBS supplemented with 100 mM Glycine for 5 min on ice. Biotinylated cells were then washed four times in 10 ml SB-Sorbitol pH 6.0 and an aliquot of 500 !l was collected to analyze the total amount of csA. Cells were then lysed for 15 min in 1 ml RIPA buffer (Tris HCl pH 7.4 50 mM, NaCl 150 mM, Triton X100 1%, sodium deoxycholate 1%, SDS 0.1% + proteases inhibitors:

leupeptin, aprotinin, PMSF, IAA) and the lysate cleared by centrifugation (5 min, 10’000 rpm, 4°C).

After centrifugation, 900 !l of the supernatant was incubate with neutravidin beads overnight on a

! ('!

rotating wheel at 4°C. Beads were washed twice with 1 ml of RIPA buffer, incubated for 15 min at 4°C in 1 ml RIPA buffer, incubated in 1 ml of urea 6M for 15 min at 4°C, and washed three times with 1 ml RIPA buffer. Biotinylated surface proteins were eluted in 50 !l sample buffer for 15 min at room temperature followed by 5 min at 60°C. 20 !l of sample were loaded for each dilution on a 9% SDS-PAGE gel, transferred to nitrocellulose, and revealed with an antibody against denatured csA (33-294-17). Serial dilutions of the precipitated material were made to assess quantitatively the amounts of csA protein present.

Tac fusion proteins !

The vector encoding the alpha chain of the interleukin-2 receptor (Tac) used in this study contained a BglII site in the membrane-proximal area (Cosson et al., 1991) (Fig. 30). The indicated constructs were obtained by inserting the sequence coding for the TMDs of interest in this vector digested with BglII and XbaI. These plasmids were propagated in bacteria MC1061p3 after chemical transformation and selection on LB agar plates containing Ampicillin 100 mg/ml and Tetracyclin 12.5 mg/ml.

Association of Tac with Phg1

To assay quantitatively the potential of multiple constructs to interact with Phg1, we made a fusion protein of human Phg1A (TM9SF4) with $-galactosidase (Phg1-Gal), where the coding sequence of

$-galactosidase was introduced in-frame at the C-terminus of Phg1A (Cosson et al., 1991). To test the interaction of this protein with various Tac chimeric proteins, Hela cells were cotransfected with 10 !g of Phg1-$Gal vector and 10 !g of Tac vector by using the calcium phosphate transfection method (Graham and van der Eb, 1973). Transfected cells were allowed to recover for three days.

They were then scraped from the culture plate, pelleted and lysed for 15 min at 4°C in 1 ml of lysis buffer (PBS containing 0.5% triton X100 and proteases inhibitors (proteases inhibitors: leupeptin, aprotinin, PMSF, IAA). Cell lysates were centrifuged at 10’000 rpm in an eppendorf centrifuge for 15 min at 4°C and 800 !l of the cleared supernatant were incubated for 1h on a rotating wheel with protein A sepharose beads coated with anti-Tac antibody (7G7). The $ -galactosidase activity was assessed in the cell lysate and in the immunoprecipitated sample. To measure the galactosidase activity we used the substrate chlorophenol red- $-D-galactopyranoside and quantitated the product of the reaction by absorbance at 600nm (Eustice et al., 1991).

! ((!