6 7 8
Julie Lucifora1,2, David Durantel1,2,3,, Barbara Testoni4,5, Olivier Hantz1,2, Massimo Levrero4,5 and 9
Fabien Zoulim1,2,3,*. 10
11 12
1) INSERM, U871, 151 Cours Albert Thomas, 69003 Lyon, France; 13
2) Université Lyon 1, IFR62 Lyon Est, 69008 Lyon, France ; 14
3) Hospices Civils de Lyon, Hôtel Dieu Hospital, 69002 Lyon, France; 15
4) Department of internal Medecine and Laboratory of Gene Expression, Fondazione A. Cesalpino, 16
University of Rome La Sapienza, Rome, Italy 17
5) Laboratoire Associé INSERM, U785, Villejuif, France. 18
19
Keywords : 20
HBV, baculovirus, IFN, antiviral state 21 22 Contact information : 23 *Fabien Zoulim 24
Mailing address: INSERM, U871, 151 cours Albert Thomas, 69003 Lyon, France. 25
Phone: +33437497410. Fax: +33437497419. E-mail: fabien.zoulim@inserm.fr 26
27
List of abbreviations : 28
HBV (Hepatitis B Virus), IFN (interferon), ISG (interferon stimulated genes) 29
30
Financial support : 31
This work was supported by the French National Agency for Research against AIDS and viral hepatitis 32
(ANRS) and a grant from the European Community (ViRgil LSHM-CT-2004-503359). 33
34
Word count and figures number : 35
Abstract : 291 words (max 275) 36
Text including references and figure legends : 5332 words (max 5000) 37
Figures : 6 38
Abstract 40
HBV is currently viewed as a stealth virus that does not elicit innate immunity in vivo, 41
including type-I interferon antiviral response. This assumption has not yet been challenged in vitro 42
because of the lack of a physiologically relevant cell culture system able to efficiently replicate HBV. 43
The recently established HepaRG cell line which is permissive to infection with recombinant HBV has 44
opened new perspectives. Using recombinant HBV baculoviruses (Bac-HBV-WT) to efficiently initiate 45
an HBV replication cycle, we demonstrate that HBV is able to elicit in both proliferating and 46
differentiated HepaRG cells a strong and specific cellular antiviral response that result in a fast and 47
non-cytopathic clearance of intracellular HBV DNA. Challenge experiment shows that transduction 48
with Bac-HBV-WT, but not with the control baculovirus, leads to this antiviral state in HepaRG cells 49
whereas no antiviral state is observed in control HepG2 cells. Cellular gene expression analyses 50
showed that IFN-β and other interferon stimulated genes (ISGs) were up-regulated in both HBV- 51
transduced HepG2 and HepaRG cells, but not in cells transduced by control recombinant baculovirus 52
vectors. This up-regulation was associated with viral clearance in HepaRG, but not in HepG2, thus 53
confirming the non-functionality of the IFN pathway in this hepatoblastoma cell line. Interestingly, a 54
rescue of viral replication was observed when IFN- action was neutralized by antibodies and in 55
engineered HepaRG in which the type-I IFN receptor was down regulated by RNA interference. 56
Conclusions : Our in vitro data suggest that HBV is able to elicit a strong IFN response in HepaRG- 57
infected cells that is responsible for the transient pattern of replication. HBV replication can be 58
enhanced by down regulating the type-I IFN pathway. Modulation of the IFN-β pathway may be a 59
prerequisite to establish persistent HBV infection in vitro in non transformed hepatocytes. 60
Introductory statement 62
63
HBV is currently viewed as a non-cytopatic virus and HBV-associated liver damage is thought 64
to be the consequence of a long lasting cytolytic immune response against infected hepatocytes (1). 65
The outcome of HBV infection as well as the severity of HBV-induced liver disease varies widely from 66
one patient to another. In around 90-95% of adults, exposure to HBV leads to an acute infection 67
which is rapidly cleared without long-term consequences. The remaining 5-10% fail to control viral 68
infection that consequently evolves to chronicity. The latter predisposes patients to severe liver 69
disease, including cirrhosis and hepatocellular carcinoma (2). 70
The intracellular innate antiviral response to infection constitutes an early defense 71
mechanism that aims at stopping replication in already infected cells, as well as limiting the 72
spreading of infection to neighboring cells. This response takes place very early after infection of cells 73
and plays an important stimulatory role for the subsequent development of innate and adaptive 74
immune responses. In many cases, cells mounting this response produce type-I (IFN-α, β) (and type- 75
III; i.e. IFN-λ) interferons which are cytokines with pleiotropic functions that mediate both direct and 76
indirect antiviral effect (3-5). The direct antiviral effect of type-I IFNs is exerted by a variety of 77
effectors that are expressed by genes whose transcription is directly stimulated by IFNs, i.e. IFN- 78
stimulated genes (ISGs). Production of type-I IFNs can be triggered by virus components and/or 79
replication through cellular sensors that detect the presence of viral RNA, DNA or proteins (4). The 80
indirect antiviral effect of type-I IFNs is due to their stimulatory effect on different cells of the innate 81
and adaptive immune response. 82
Using experimentally-infected chimpanzees, microarray analyses suggested that HBV, early in 83
infection, does not modulate host cellular gene transcription and would neither induce innate 84
antiviral response in hepatocytes nor intrahepatic innate immune responses (6). Following this study, 85
HBV was qualified as a “stealth virus” (7). However a study from the same group showed that HBV 86
could be cleared from the livers of infected animals before any detectable adaptive immune 87
response (8), thus suggesting that innate immunity, i.e. antiviral response at level of infected cells 88
and innate response via specialized cells of immune system (e.g. NK, NKT), might play an important 89
role. 90
The study of antiviral response in HBV-infected cells was hampered by the difficulty to grow 91
the virus in cell culture systems. Only freshly prepared human primary hepatocytes (HPH) and 92
differentiated HepaRG cells can support a complete HBV life cycle, including early events of infection 93
(9, 10). HepaRG cells are liver bi-potent progenitor cells that are able to differentiate into both biliary 94
and hepatocyte-like cells (11). However the overall replication level in these cells is rather low, with 95
less than 20% of cells infected, which complicates the study of host/pathogen interaction (Hantz O., 96
submitted). One could hypothesize that the low level of replication might be the consequence of an 97
IFN response. In this case, the virus would be able to trigger a host antiviral response and would be 98
capable to disarm it in only a low percentage of cells. This low percentage of infected cells is an 99
obstacle for studying the potential ability of HBV to elicit an IFN response. Indeed, when a low 100
multiplicity of infection is used, which is likely the case with HBV, it is already documented that an 101
IFN response may occur in only a low percentage (< 30%) of infected cells (12), thus complicating its 102
analysis. Moreover, some viruses are particularly efficient to counteract this IFN response and may 103
therefore render the analysis of IFN response more difficult (13). In this respect, HBV was shown to 104
be very efficient to inhibit IFN signaling pathway (14-17). There are several hypothesis to reconcile 105
these observations; HBV may infect a low percentage of cell or all cells but very progressively and 106
with a weak intensity, or may be particularly efficient to counteract cellular responses. To gain data 107
in cell culture system on the potential ability of HBV to elicit and then disarm an IFN response, it 108
appears necessary to initiate a high HBV replication in a large number of cells. 109
One possibility to initiate a high intracellular HBV replication in vitro is to use a recombinant 110
baculovirus carrying full HBV genome to efficiently transduce hepatic cells. This approach led to 111
higher HBV replication levels compared to either transfection of cells or stable cell lines such as 112
HepG2.2.15 (18). In a previous study, we have improved this system by generating a new HBV 113
recombinant baculovirus in which the synthesis of pregenomic RNA was driven by a strong 114
mammalian promoter. The initiation of a complete HBV DNA replication cycle, followed by the 115
production of infectious particles was evidenced in transduced-HepG2 cells (19). However, HepG2 116
cells are not ideal for studying IFN response as they are transformed and therefore impaired for 117
many cellular pathways. 118
The goal of this study was to determine whether HBV could elicit an type-I IFN response in 119
the non-transformed/non-neoplastic HepaRG cells that are fully functional for type-I IFN signalling 120
pathway (20), and whether this IFN production could be responsible for the control of HBV 121
replication in this cell line. 122
Experimental procedures 123
Cell culture 124
HepG2 (ATCC) cells and HepaRG cells (10) were maintained in William’s medium (Invitrogen) 125
supplemented with 10 % fetal calf serum (Perbio), penicillin/streptomycin 50 U/mL (Invitrogen), 126
glutaMax (Invitrogen) 2mM, insulin bovine 5 µg/mL and 5 x 10-5 M hydrocortisone hemisuccinate 127
(Roche Diagnostics, Boehringer Mannheim) at 37°C in humidified incubators at 5% CO2. To obtain
128
differentiation of HepaRG, cells were maintained for two weeks in standard medium, then for at 129
least two more weeks in medium supplemented with 1,8 % of DMSO (cell culture grade, Sigma). 130
Spodoptera frugiperda (Sf-9) insect cells were cultured either in suspension or as monolayers, at 28°C 131
in Sf-900 II medium (Invitrogen) containing 10 % (v/v) of fetal calf serum (Perbio). 132
Baculovirus and transduction of Mammalian cells 133
Baculoviral constructions (Bac-HBV-WT, Bac-HBV-YPDD, Bac-βGal, Bac-GFP) as well as stock 134
production, titration, and concentration were performed as described previously (19). Baculoviral 135
transduction of mammalian cells has also been performed as previously described (19). Briefly, cells 136
were transduced at 80% confluency (i.e. 1-2.105 cells/cm2). Baculovirus was diluted in medium to 137
achieve the appropriate multiplicity of infection (m.o.i.). Baculovirus was absorbed to cells at 37°C 138
with gentle rocking every 15 min to ensure an even distribution. After 1h, the inoculum was 139
removed, cells were washed with phosphate-buffered saline (PBS) and cultured as described. 140
Analysis of viral DNA 141
Purification of HBV DNA from intracellular core particles and analysis/quantification by southern 142
blotting with radioactive probe were performed as previously described (21, 22). 143
Analysis of gene expression by qRT-PCR 144
Total RNA was extracted from cells with the “NucleoSpin RNA II” kit according to manufacturer’s 145
instructions (Macherey-Nagel). IFNβ genes expression was analyzed by qRT-PCR with the “SYBR 146
GreenER Two-Step qRT-PCR Kit for iCycler” according to the manufacturer’s instructions (Invitrogen). 147
Primers used for the qPCR step are the following : IFNβFR: 5’GCCGCATTGACCATGTATGAGA3’ and 148
IFNβRV : 5’GAGATCTTCAGTTTCGGAGGTAAC3’. 149
Analysis of secreted type I interferon 150
Three millions Huh7.5 cells, that are deficient for RIG-induced type-I IFN production (23), were 151
transfected with 10 µg of pISRE-Luc vector (Stratagene) in a 10 cm diameter dish using “Fugene6 152
tranfection reagent” according to manufacturer’s instructions (Roche). pISRE-Luc plasmid expresses 153
luciferase under type-I IFN inductible promoter. After 16h of incubation with transfection mixture, 154
cells were trypsinazed are re-seeded in 96 wells plate at around 3.104 cells /well in a volume of 100 155
µL. Six hours later, 100 µL of clarified (13.000g , 5 min) supernatants, that were collected from 156
transduced cells, was added to wells. To obtain a standard curve, dilutions of commercially available 157
type-I IFN (IFN-2a, Schering Plough) were applied to cells in the same volume. After 24 h incubation 158
at 37°C, cells of each well were washed with PBS and lysed with “1x passive lysis buffer” (Promega), 159
and luciferase activity monitored using the Renilla Luciferase Assay System (Promega). 160
161
Analysis of the IFN response by AB Low Density Arrays 162
Total RNA was extracted from cells with the “NucleoSpin RNA II” kit according to manufacturer’s 163
instructions (Macherey-Nagel) and retro-transcribed with the Invitrogen Superscript kit using random 164
examers as template. 200ng of cDNA were loaded in double on the Low Density Arrays (Applied 165
Bioystem) customized with 95 ISGs probes and 18s probe as a control. The LDAs were run on a AB 166
7900HT and real time PCR data were collected and analyzed through the SDS 2.2 program (Applied 167
Biosystem). 168
Neutralization of IFNβ 169
Neutralization of IFNβ produced in supernatant from cells was performed using a neutralisazing anti- 170
IFNβ antibody (ab9662, Abcam) with a final concentration of 0,5 ng/mL. 171
Construction of HepaRGshIFNR1 cell line 172
Five different lentivirus enabling the expression of 5 different short-hairpin RNAs (shRNA-1: 173
GCCAAGAUUCAGGAAAUUAUU ; shRNA-2: CCUUAGUGAUUCAUUCCAUAU ; shRNA-3:
174
CGACAUCAUAGAUGACAACUU ; shRNA-4: GCUCUCCCGUUUGUCAUUUAU ; shRNA-5:
175
GUUGACUCAUUUACACCAUUU) directed against the ifnr1 gene (that codes IFN receptor 1) were 176
obtained as titered-viral stocks from Sigma. HepaRG cells were seeded at 1.105 cells in 24 wells plate 177
and transduced with the 5 lentivirus (m.o.i. of 5 for each virus), as recommended by the 178
manufacturer. After 16h of incubation at 37°C with transduction mixture, medium containing viruses 179
was replace by fresh medium containing 20 µg/mL of puromycin (Invivogen) to select for stably 180
transduced cells. Resistant cells were expanded in presence of 40 µg/mL of puromycin until the 181
constitution of a frozen stock of cells. The inhibition of the expression of IFNR1 mRNA was checked 182
by RT-PCR using the following primers IFNRI-FR: 5’AGTGTTATGTGGGCTTTGGATGGTTTAAGC3’ and 183
IFNRI-RV : 5’TCTGGCTTTCACACAATATACAGTCAGTGG3’. 184
Results 186
187
Kinetic of HBV replication in HepaRG cells after transduction with Bac-HBV. 188
First we sought to determine if baculoviruses could infect HepaRG cells and deliver a 189
transgene into the nucleus. To this end, HepaRG cells were transduced with a baculovirus (Bac-GFP) 190
expressing the green fluorescence gene. More than 70 % of cells expressed GFP when a multiplicity 191
of infection (m.o.i.) of 100 was used for the transduction (data not shown). This transduction 192
efficiency was comparable to that obtained in HepG2 cells (19). As the efficiency of tranduction was 193
even in both cell lines a direct comparison of the kinetic of HBV replication after transduction with 194
Bac-HBV-WT was possible. Both proliferating and differentiated HepaRG as well as HepG2 cells were 195
transduced at an m.o.i. of 100 pfu/cell with Bac-HBV-WT. Intracellular encapsidated viral DNA was 196
isolated at various time points post-transduction (p.t.) and analyzed by Southern Blot. HBV DNA was 197
detectable very rapidly after transduction in both HepG2 and HepaRG cells (fig. 1). Although the 198
amount of HBV intracellular encapsidated DNA was comparable at day 1 p.t. in both cell lines (upper 199
panel), kinetics of HBV replication were quite different, as its level decreased really slowly in HepG2 200
cells after 12 days, whereas a rapid and sharp decrease was observed in both proliferating and 201
differentiated HepaRG cells to become nearly undetectable at day 12 p.t. This difference in kinetics 202
could not be attributed to differences in kinetics of clearance of the baculovirus template (data not 203
shown), neither to differential cell death. The fast and non cytolytic elimination of intracellular 204
encapsidated DNA in HepaRG cells suggested that an antiviral response involving specific cellular 205
factors could be involved. 206
207
Establishment of an antiviral state in Bac-HBV-transduced HepaRG. 208
To characterize this antiviral state, cells were transduced twice (at day 0 and day 3) with Bac- 209
HBV-WT. As previously shown the amount of HBV intracellular encapsidated DNA was increased by a 210
second transduction in HepG2 cells (18), whereas it remained unchanged in HepaRG cells (fig. 2A). 211
This result strongly suggests that HepaRG cells were able to mount a sustained antiviral response 212
following the first transduction with Bac-HBV-WT. 213
To determine whether this antiviral response in HepaRG cells was due to the transgene 214
expression (i.e. synthesis of pgRNA, mRNA, and proteins) and replication of HBV genome, or was 215
induced by the baculovirus vector itself, HepG2 or HepaRG cells were first mock-transduced 216
(inoculation with medium only) or transduced with two different control baculoviruses, containing 217
either the β-galactosidase gene (Bac-βGal) or an HBV genome carrying a mutation in the catalytic 218
domain of the polymerase (Bac-HBV-YPDD). The latter baculovirus enables the production of HBV 219
proteins without genome replication (19). Three days after the first transduction, a second 220
transduction was performed with Bac-HBV-WT. Intracellular encapsidated viral DNA was isolated at 221
various time points after the first transduction and analyzed by Southern Blot. In HepG2 cells, HBV 222
intracellular encapsidated DNA was detectable in all experimental conditions (fig. 2B, upper panel), 223
thus confirming that no antiviral response was induced in these cell line after the first transduction. 224
In HepaRG cells, HBV intracellular encapsidated DNA was detectable in cells that were first mock- 225
transduced or transduced with Bac-βGal, but not in those first transduced by Bac-HBV-YPDD (fig. 2B, 226
bottom panel). This result clearly demonstrates that the antiviral response observed in HepaRG 227
following transduction is mediated by HBV itself and is independent of the baculovirus vector. 228
Moreover, as no reverse transcription step can occur with Bac-HBV-YPDD, this result also indicates 229
that the establishment of an HBV-mediated antiviral state was independent of HBV DNA replication, 230
but was rather due to HBV protein synthesis or RNA synthesis. 231
232
HBV elicits IFN-β production that subsequently induces ISGs expression in both HepG2 and HepaRG 233
cells. 234
As production of type-I interferons, in particular IFN-, is one of the first cellular antiviral 235
defense (4), we first tested whether the ifn-β gene was activated in HepG2 and HepaRG cells 236
(proliferating or differentiated). Cells were transduced with Bac-βGal or Bac-HBV-WT and qRT-PCR 237
performed 24 and 48h p.t. The amount of mRNA encoding IFNβ was strongly increased in cells 238
transduced with Bac-HBV-WT, but not in those transduced with the control baculovirus (Bac-βGal) 239
(fig. 3A). This indicates that HBV, and not the vector, is responsible for the induction of IFN-β 240
expression. Using a functional assay, we also demonstrated that biologically active type-I interferons 241
were produced in the supernatant of Bac-HBV-WT transduced cells (fig. 3B). Taken together, these 242
results suggest that the production of type-I inteferons may be, at least in part, responsible for the 243
antiviral state established in transduced HepaRG cells. 244
Genes activated by type-I IFNs are well known, and their expression represents a signature of 245
the IFN pathway (4). To determine whether the pattern of induction after transduction with Bac- 246
HBV-WT was similar to that already described, HepG2 and HepaRG (proliferating or differentiated) 247
cells were transduced with and Bac-βGal or Bac-HBV-WT . Expression of 96 ISGs was evaluated by 248
qRT-PCR analyses (fig. 3C). The control baculovirus did not induce significant changes in the pattern 249
of expression of the genes, thus confirming that the vector is not responsible for the observed IFN 250
response. In contrast, many of the analyzed genes were overexpressed in HepG2 as well as in 251
proliferative and differentiated HepaRG cells 24 and 48h after transduction with Bac-HBV-WT. 252
Many of the overexpressed genes, including viperin, mx1, isg15, oas1, isg56, have antiviral 253
properties and could therefore be responsible for the inhibition of HBV replication in HepaRG. 254
However, these genes were also activated in HepG2 cells in which the replication of HBV was not 255
inhibited as compared to that observed in HepaRG. 256
257
Inhibition of type-I IFN pathway results in enhanced HBV replication in HepaRG cells, 258
The next step was to inhibit the IFN pathway in HepaRG cells to determine whether HBV 259
replication could be enhanced. First, proliferating HepaRG cells were transduced with Bac-HBV-WT 260
and immediately treated with a neutralizing anti-IFNβ antibody. Intracellular encapsidated viral DNA 261
was isolated at various time points post-transduction (p.t.) and analyzed by Southern Blot. Results 262
showed that neutralization of IFNβ clearly increased amount of intracellular encapsidated HBV DNA 263
in proliferating HepaRG (fig. 4), thus confirming the crucial role of IFN-β in mediating the observed 264
antiviral response in this cell line. It worth noting that neutralizing anti-IFNβ antibody did not 265
improve HBV replication in HepG2 cells, suggesting that this pathway is not fully functional in this cell 266
line (data not shown). 267
To further demonstrate the role of type-I IFN in inhibiting HBV replication in HepaRG cells, 268
we invalidated the expression of the ifnar1 gene, which codes for subunit 1 of the type-I IFN 269
receptor, using short hairpin RNA strategy. The down regulation of the gene in the resulting cell line, 270
i.e. HepaRGshIFNR1, was verified by RT-PCR (fig. 5A). This down regulation of the expression of type-I 271
IFN receptor is expected to be associated with an inhibition of the amplification of the IFN pathway. 272
To confirm that we significantly invalidated type-I IFN pathway, the expression of ISGs was analysed 273
by qRT-PCR. We showed that a poly-IC stimulation did not increase the expression of ifn-β, oas1 and 274
isg56 genes (fig. 5B). Moreover the levels of mRNA encoding IFNβ, 2OAS or ISG56 were decreased by 275
up to 80 % in HepaRGshIFNR1 after transduction with Bac-HBV-WT compared to parental cell line 276
(fig. 5C). Finally, multiplex RT-PCR analyses confirmed that the expression of most ISGs analysed was 277
not dramatically changed after Bac-HBV-WT transduction (Table 1). 278
If type-I IFN pathway is crucial for the control of HBV replication, its inhibition should result in 279
an increased HBV replication. Both HepaRG and HepaRGshINFR1 were transduced with Bac-HBV-WT