DLK depletion in tissue engineered skin affects c-Jun, C/EBPα, MAPK pathways and late

expression.

Carolyne Simard-Bisson1_{, Danielle Larouche}1_{, Karine Zaniolo}1_{, Sylvain Guérin}1,2,3_{, Richard Blouin}5 _{and Lucie}

Germain1,4

1_{Centre de recherche en organogénèse expérimentale de l’Université Laval/LOEX; Axe médecine}

régénératrice and 2_{CUO recherche Centre de recherche du CHU de Québec-Université Laval;} 3_Département

d’ophtalmologie and 4_{Département de chirurgie, Faculté de Médecine, Université Laval, Québec, Qc, G1V}

0A6, Canada. 5_{Département de biologie, Université de Sherbrooke, Sherbrooke, Qc, J1K 2R1, Canada.}

Short title: DLK affects c-Jun, C/EBPα and LCE expression.

Abbreviations: AdDLK, adenoviral vector with DLK sequence; AdGFP adenoviral vector with Green Fluorescent Protein sequence; C/EBPα, CCAAT-enhancer-binding proteins; DLK, Dual Leucine zipper bearing Kinase; GSK3, Glycogen Synthase Kinase 3; KRT, keratin gene; LCE, Late Cornified Envelope; LV, lentiviral vector; MSK1, Mitogen and Stress activated protein Kinase 1; shRNA, short hairpin RNA; SPRR4, Small Proline-Rich protein 4; TES, Tissue Engineered Skin.

*Corresponding author: Lucie Germain, PhD LOEX Aile-R CHU de Québec 1401, 18e rue Québec, QC G1J 1Z4 Canada E-mail: lucie.germain@fmed.ulaval.ca

107

Abstract

Keratinocyte differentiation is a crucial process for skin barrier function. The Dual Leucine zipper-bearing Kinase (DLK) is known as an inducer of keratinocyte terminal differentiation. However, the mechanisms and signaling pathways involved in DLK capacity to regulate the expression of proteins involved in the keratinocyte differentiation process remained to be clarified. The objective of this study was to determine the impact of DLK depletion on the phosphorylation levels of various proteins within the cell and on gene global expression in a Tissue-Engineered Skin (TES) model. An important increase in ERK1/2 and JNK1/2/3 phosphorylation was observed in TES with reduced DLK expression. Downregulation of transcripts mostly associated to cornified envelope formation, keratinocyte differentiation, epidermal development and lipid synthesis or transport was also observed in DLK depleted TES. Reduced protein expression of c-Jun and C/EBPα was also observed at the nuclear level in TES with reduced DLK expression. Together, our findings identify the DLK as an important MAPK regulator and as a required component for proper expression of genes coding for proteins involved in late keratinocyte differentiation. They also suggest DLK to be involved in c-Jun and C/EBPα regulation during keratinocyte differentiation.

108

Introduction

Skin barrier function depends mainly on the keratinocyte capacity to differentiate and to form the cornified layer. During this process, keratinocytes assemble, beneath their plasma membrane, a cornified envelope that is composed of lipids and proteins such as filaggrin, late cornified envelope proteins (LCE), involucrin and loricrin that are tightly assembled together by isopeptide bounds mainly realized by the transglutaminase 1 enzyme [1]. The resulting envelope forms a barrier required for protection against pathogens, chemical insults and dehydration.

The Dual Leucine zipper-bearing Kinase (DLK) is a Mitogen-Activated Protein Kinase Kinase Kinase coded by the MAP3K12 gene and previously described as an inducer of keratinocyte differentiation and cornification. Indeed, the induction of DLK expression in normal human keratinocytes in culture (NHK) reduces cell proliferation [2], enhances filaggrin expression, transglutaminase activity and JNK phosphorylation [3]. Conversely, tissue-engineered skins (TES) with a reduced DLK expression show impaired keratinocyte differentiation and desmosomal ultrastructure [4]. However, downstream effectors involved in DLK-induced keratinocyte differentiation markers remain to be identified.

The objective of this study was to investigate the impact of DLK depletion in TES and to target potential effectors mediating such effects. Here, we took advantage of a TES model in which many aspects of keratinocyte differentiation are reproduced. DLK depletion in this model was performed by RNA interference [4]. Using multiple phospho-protein analysis, we point out DLK as an important MAPK regulator during keratinocyte differentiation. We also demonstrate, by microarray analyses, that DLK depletion in TES impairs the expression of late differentiation markers such as keratin 2, Small Prolin-Rich Protein 4 (SPRR4) and Late Cornified Envelope proteins (LCE). The presence of c-Jun and C/EBPα were also found to be reduced in nuclei of keratinocytes forming the shDLK TES. Reciprocally, DLK overexpression in cultured keratinocytes enhances c-Jun activity in cell nucleus. This study demonstrates that DLK expression is required to induce the transcription of cornified envelope precursors and also to ensure proper c-Jun and C/EBPα expression during keratinocyte differentiation.

109

Results

Production of TES with reduced DLK expression

To evaluate the effects of DLK depletion on global gene expression and protein regulation during keratinocyte differentiation, TES were transduced with lentiviral vectors that express shRNAs directed against the DLK mRNA transcript (shDLK) in order to reduce DLK expression at day 0 of air-liquid interface culture. Samples were harvested 14 days following lentiviral transduction and DLK immunoperoxydase staining was performed in order to confirm DLK depletion in TES. As expected, shDLK TES show reduced DLK expression compared to control TES that were not exposed to the lentiviral vectors (TES w/o LV) or to TES transduced with empty lentiviral vectors (Empty LV TES) or with lentiviruses that express control shRNA sequence (shCtl TES) (Figure 4.1).

Kinase phosphorylation profile of shDLK TES

In order to determine the effect of DLK depletion on the phosphorylation status of various mediator proteins that belong to the major signal transduction pathways, protein samples form shCtl and shDLK TES were analyzed using the Proteome Profiler™ Human Phospho-Kinase Arrays (Figure 4.2a). Amongst the various targets studied, significant increases in ERK1/2, JNK 1/2/3, GSK3α/β, p53 and EGFR phosphorylation levels were observed in shDLK compared to shCtl protein samples (Figure 4.2b and c). Such results support an important role for DLK in protein phosphorylation and MAPK pathway regulation during keratinocyte differentiation.

Figure 4.1: Reduction of DLK expression in shDLK TES. DLK immunoperoxydase staining (brown) and Harris’ hematoxylin counterstaining in TES non exposed to a lentivral vector (TES w/o LV), or in TES transduced with either an empty lentiviral vector (TES empty LV), a lentiviral vector containing a scramble shRNA sequence (shCtl TES) or with a lentiviral vector that expresses an shRNA sequence targeting DLK expression (shDLK TES). Scale bar: 50 µm.

110

Figure 4.2: Multiple phospho-protein analysis of shCtl and shDLK TES. (a): Raw results generated by the Proteome Profiler™ Human Phospho-Kinase Arrays. (b): Staining of phosphorylated proteins mostly affected by DLK depletion in TES. (c): Quantification of phosphorylation levels of proteins illustrated in B is shown as the mean intensity of generated signals combined with associated standard deviation. This experiment was performed once using protein extracts from two different TES and reproduced in duplicate for each condition. * Student’s t-test: p≤0.05.

111 Figure 4.3: Comparative microarray analysis of empty LV, shCtl and shDLK TES. (a) Scatter plots of controls vs shDLK TES. (b) Heat map of genes commonly dysregulated in shDLK TES. (c) Venn diagram showing number of dysregulated genes in shDLK vs controls. (d) Heat map illustrating 55 of the most dysregulated genes in shDLK TES compared to controls. B2M and GOLGA1 transcripts are used as internal controls. MAP3K12 (DLK) is illustrated to confirm reduction of DLK mRNA expression. (e) Confirmation of microarray results for transcripts in red in d by qRT-PCR analysis. *Student’s t-test p≤0.05.

112

Microarray analysis of shDLK TES

Since DLK depletion significantly affects important regulators of gene expression such as the MAPK pathway [5], effects of DLK depletion on gene expression profile was assessed using microarray analysis. Scatter plot and heat map analysis reveal the existence of significant changes in a limited number of transcripts (Figure 4.3a and b). When comparing shDLK TES to Empty LV and shCtl TES, 128 genes were found to be significantly dysregulated (Figure 4.3c) in DLK depleted TES. Among the 55 most dysregulated genes, many of the upregulated genes code for proteins involved in cell metabolic activities (ALDOC, ATP6, ATP8, CYTB, ND3, ND4, ND4L and ND5). At the opposite, downregulated genes are associated to cornified envelope formation (BLMH, LCE1B, LCE2B, LCE2D, LCE5A, LCE6A and SPRR4), epidermal development and differentiation (ACER1, DAPL1, KRT2 and KRT32), lipid synthesis or transport (APOD, ELOVL3) (Figure 4.3d and Supplementary table 1). Quantitative RT-PCR was used to confirm microarray results (IL37, ADAM8, TFPI2 and KLF17) as well as the significant reduction of DLK (MAP3K12), KRT2, LCE1B and SPRR4 transcripts (Figure 4.3e).

Figure 4.4: Reduction of DLK expression in TES impairs c-Jun localization to the nucleus in the granular layer. (a) c-Jun immunofluorescence staining (c-jun; red) of TES exposed or not (TES w/o LV) to a lentiviral vector containing a scramble shRNA sequence (shCtl TES) or a shRNA targeting DLK expression (shDLK TES). Scale bar: 50 µm. (b) Quantification of c-Jun positive nuclei in the granular layer of 11 control TES (7 TES w/o LV and 4 shCtl TES) and in 9 shDLK TES obtained from 3 independent experiments. Results are reported as mean and standard deviation * Student’s t-test p≤0.05.

113 Reduction of DLK in TES affects nuclear expression of c-Jun in the granular layer

As previously reported, reducing DLK expression in TES impairs LCE1B, LCE2B, LCE2D, LCE5A, LCE6A and SPRR4 mRNA expression. Those genes are located on a specific region of chromosome 1 called Epidermal Differentiation Complex (EDC) that necessitates the c-Jun/AP-1 factor for proper chromatin remodelling allowing gene expression [6]. For this reason and because of DLK capacity to regulate c-Jun activity in mice neurons [7, 8], we wanted to assess effects of DLK depletion in TES on c-Jun using immunofluorescence analysis. In TES w/o LV and shCtl TES, c-Jun staining was observed in the nuclei of cells located in the basal, low spinous and high granular layers, as previously reported [9]. However, a reduction of c-Jun positive nuclei was observed in the granular layer of shDLK TES compared to controls (Figure 4.4a). To confirm this observation, positive c-Jun nuclei were counted at the level of the granular layer of 11 control TES (7 TES w/o LV and 4 shCtl TES) and in 9 shDLK TES obtained from 3 independent experiments. A statistically significant reduction of 1.7 fold was observed in shDLK TES (Figure 4.4b) suggesting a role for DLK in the regulation of c- Jun nuclear distribution in the granular layer of the epidermis.

DLK overexpression in keratinocytes in culture affects c-Jun nuclear activity

Since reduction of DLK expression in TES negatively influences c-Jun expression in the nucleus of granular layer cells, we next investigated the effects of DLK expression on this factor. Normal human keratinocytes (NHK) were transduced with an adenoviral vector containing GFP (AdGFP) or DLK and GFP sequences (AdDLK) and fixed 72 hours later for further analysis. Whereas immunofluorescence labeling using c-Jun antibody revealed no difference between AdDLK and AdGFP cells (data not shown), a similar analysis conducted with an antibody that recognizes S73 phosphorylated form of c-Jun revealed an intense nuclear staining in many AdDLK cells (50±8%) that was rarely observed in AdGFP cells (5±4%) (Figure 4.5) pointing out DLK capacity to promote c-Jun activity in the nucleus.

C/EBPα levels are reduced in keratinocyte nuclei of shDLK TES

Since DLK expression is known to promote C/EBPα proper expression in the context of adipocyte differentiation [10], C/EBPα expression and distribution were studied in shDLK TES by immunofluorescence analysis. In control TES (TES w/o LV, shCtl TES), C/EBPα expression was observed from the basal to the lower granular layer but the staining was greatly reduced in shDLK TES (Figure 4.6). This result shows that DLK is required for proper C/EBPα expression in TES.

114

Figure 4.5: DLK expression in NHK induces c-Jun phosphorylation in the nucleus. (a) NHK were transduced or not (Nt cells) for 72 hours with AdGFP and AdDLK adenoviral vectors (transduced cells are in green), fixed and stained for phospho-c-Jun (phospho-c-jun; red). Nuclei were stained using Hoechst (blue). Scale bar: 50 µm. (b) Number of cells showing intense phospho-c-Jun staining in the nucleus of NHK transduced with AdDLK and AdGFP adenoviral vectors. * Student’s t-test p≤0.05.

Figure 4.6: shDLK TES show lower levels of C/EBPα. C/EBPα immunofluorescence staining of TES exposed or not (TES w/o LV) to a lentiviral vector containing a scramble shRNA sequence (shCtl TES) or a shRNA targeting DLK expression (shDLK TES). Scale bar: 50 µm.

115

Discussion

Our results propose an important role for DLK in keratinocyte differentiation since reducing its expression in TES significantly affects the MAPK pathway as well as the expression of genes coding for late components of keratinocyte differentiation such as LCEs, SPRR4 and KRT2. Our study also indicates that DLK expression is required for proper c-Jun and C/EBPα protein expression: two transcription factors linked to keratinocyte differentiation [6, 11]. These results suggest c-Jun and C/EBPα as potential effectors of DLK-induced keratinocyte differentiation.

A closer look at the multiple phospho-protein analysis reveals an upregulation of p38α, JNK1/2/3 and ERK1/2 MAPK pathways suggesting DLK as an important component of cell signaling regulation. However, since DLK expression in NHK is known to promote ERK and JNK phosphorylation, phosphorylation levels of these MAPK were expected to be reduced in shDLK TES. Such an increase of ERK1/2 and JNK1/2/3 phosphorylation may be the result of a delayed keratinocyte differentiation process and/or an increase in cell activity following depletion of protein promoting cell differentiation (here, DLK). Such an hypothesis is supported by the upregulation of genes involved in cell metabolic activity (see microarray analysis) and by increased EGFR phosphorylation. As previously reported, the EGFR is known to promote ERK1/2 and JNK1/2/3 phosphorylation and activation [12, 13]. Increased EGFR and ERK1/2 phosphorylation in shDLK TES can be explained by reduced desmoglein 1 levels as previously observed in these samples [4]. Indeed, desmoglein 1, a transmembrane glycoprotein component of desmosomes in epithelial cells whose expression is reduced in shDLK TES, was previously reported as a suppressor of EGFR and ERK1/2 signaling [4, 14]. Interestingly, higher GSK3 phosphorylation can also explain desmosomal defects observed in shDLK TES [4]. Indeed, phosphorylation inhibits GSK3 activity, a process promoting desmosome assembly [15]. Increased GSK3 phosphorylation in shDLK TES may be due to enhanced EGFR phosphorylation and activity [16]. Higher phosphorylation levels of p53 and MSK1 could be the consequence of enhanced p38α and JNK1/2 (for p53 only) activity in shDLK TES [17]. Globally, EGFR activity is maintained or enhanced in shDLK TES which may result in an increase in ERK1/2, JNK1/2/3 and GSK3 phosphorylation.

The DLK was previously described as an inducer and a required component of keratinocyte differentiation [2- 4]. Indeed, formation of the cornified layer is impaired in DLK depleted TES [4]. In agreement with these results, our microarray analysis show reduced levels of cornified envelope protein-encoding transcripts such as LCE1B, LCE2B, LCE2D, LCE5A, LCE6A and SPRR4 in shDLK TES. These genes are members of the Epidermal Differentiation Complex, a chromosome 1 region containing almost 60 different genes involved in cornified envelope formation and whose regulation requires the AP-1 component c-Jun [6]. Interestingly, the increase in LCE protein expression coincides with the DLK strong expression as well as the return of c-Jun in the granular layer [3, 9, 18]. In the present study, DLK depletion in shDLK TES was found to significantly

116

impair c-Jun localization in cells nuclei of the granular layer. Conversely, phospho-c-Jun (ser73) levels are enhanced in the nuclei of AdDLK keratinocytes. Considering these facts, effects of DLK depletion on LCE and SPRR4 gene expression might be attributable to its capacity to regulate c-Jun activity. The importance of DLK in c-Jun regulation is in agreement with previous studies done in mice neuronal cells [7, 8].

The fact that DLK is also required for proper C/EBPα expression in the epidermis is noteworthy since this transcription factor is known to be involved and required for proper execution of keratinocyte differentiation process [11, 19]. Thus, regulation of C/EBPα by DLK provides additional clues concerning differentiation defects observed in shDLK TES. Such a result is also in agreement with previous reports describing DLK as a required element for proper C/EBPα expression in the context of adipocyte differentiation [10]. Interestingly, downregulation of C/EBPα could also explain previously described desmosomal defects observed in shDLK TES [4] since this transcription factor is known to promote the expression of desmocollin 1, a desmosomal cadherin [20]. In the future, quantification of C/EBPα and desmocollin 1 expression in shDLK TES should be performed in order to support this hypothetical mechanism concerning DLK effects on desmosomes.

In summary, DLK depletion in TES results in increased phosphorylation of EGFR, ERK1/2, JNK1/2 and GSK3 and in decreased expression of genes involved in late keratinocyte differentiation and in cornified envelope formation. Our results propose that c-Jun and C/EBPα proper regulation during keratinocyte differentiation process requires appropriate DLK expression. In the future, more studies should be performed to define more precisely DLK effects on MAPK pathways, EGFR, GSK3, c-Jun and C/EBPα.

117

Material and methods

Cell culture

This study was conducted in accordance with our institution’s guidelines and the Declaration of Helsinki. All protocols were approved by the institution's committee for the protection of human subjects (Comité d'éthique de la recherche du CHU de Québec-Université Laval). Normal human keratinocytes (NHK) were isolated from newborn foreskin as described [2]. NHK were cultured on irradiated mouse 3T3 fibroblasts as described [21]. Experiments involving NHK was reproduced at least 3 times.

Production of in vitro TES

TES were produced as described [22]. Briefly, human fibroblasts were cultured for 28 days in 25 cm2 culture flasks (BD Biosciences, Mississauga, Canada) with DMEM supplemented with 10% FBS, 50 µg/ml of ascorbate (Sigma, Oakville, Canada) and antibiotics (100 IU/ml penicillin and 25 µg/ml gentamicin). Two resulting sheets (cells within organized extracellular matrix) were superimposed and cultured in submerged conditions for 7 days. Newborn foreskin NHK were then seeded on top and kept 7 days in submerged culture conditions. To produce shDLK TES , 0.8 mL of DME-Ham’s F12 supplemented medium without EGF and containing 8 µg/mL of polybrene (Sigma) and the appropriate lentiviral vector at an approximative Multiplicity of Infection (MOI) of 2,5 was dropped on TES epidermis at day 0 of culture at the air-liquid interface, and incubated for a 2 hour period. ShCtl TES were produced using the same method by incubating a mix of 3 lentiviral vectors encoding 3 different scramble shRNA sequences. After 2 washes with PBS, TES were cultured at the air-liquid interface for 14 days and then harvested. DLK silencing in TES was reproduced in 4 independent experiments for a total of at least 11 samples per condition.

Lentiviral vector production and TES transduction

Lentiviral vector were produced as previously described [4]. Briefly 293FT cells were cotransfected with the plasmid of interest, the envelope protein expressing vector pMD2.G (12259; AddGene, Cambridge, MA) and the packaging protein expressing vector psPAX2, (12260; AddGene) in Opti-MEM (Gibco, now ThermoFisher Scientific, Burlington, Canada) using lipofectamine 2000 (Invitrogen, Burlington, Canada). Culture medium containing lentiviral particles was harvested and filtered 72h following the transfection. Plasmids used were the pLKO.1-based lentiviral human DLK shRNA vector (clone TRCN0000001000, Open Biosystems now GE Healthcare Dharmacon, Ottawa, Canada) or pLKO.1 (Addgene 10878) [23] based scramble shRNA vector containing one of the following sequences: GCACACCAACCGTTAAACAAA, AAACCCACGACCATCAATAA or GCCAACAAACCACAACGTATA.

118

Multiple phospho-protein analysis

Protein samples of two shCtl and two shDLK were analyzed in duplicata using the Proteome Profiler Human Phospho-Kinase Array Kit (R&D systems, Minneapolis, MN) according to manufacturer’s instructions. The levels of protein phosphorylation shown in Figure 4.2c correspond to the mean of signal intensity of 4 bands generated by the experiments with their corresponding standard deviation. Student’s t-tests were performed and the level of statistical significance (*) was set at p≤0.05.

RNA extraction and microarray analysis

Total RNA was isolated from at least two TES samples for each condition (Empty LV TES, shCtl TES and shDLK TES) using the RNeasy Mini Kit (QIAGEN,Toronto, Canada). Cyanine 3-CTP labeled cRNA targets were prepared from 50 ng of total RNA, using the Agilent One-Color Microarray-Based Gene Expression Analysis kit (Agilent Technologies, Mississauga, Canada). Then 600 ng cRNA was incubated on a G4851A SurePrint G3 Human GE 8x60K array slide (60 000 probes, Agilent Technologies). Slides were then hybridized (Agilent protocol), washed and scanned on an Agilent SureScan Scanner according to the manufacturer’s instructions. Data were finally analyzed using the ArrayStar V12 (DNASTAR, Madison, WI) software for scatter plots and generation of the heat maps of selected genes of interest. All data generated from the arrays were also analyzed by RMA (‘Robust Multiarray Analysis’) for background correction of the raw values. They were then transformed in Log2 base and quantile normalized before a linear model was fitted to the normalized data to obtain an expression measure for each probe set on each array. All microarray data presented in this study comply with the Minimum Information About a Microarray Experiment (MIAME) requirements. The gene expression data have been deposited in NCBIs Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series accession number (GSE # will be provided at time of publication)

Adenoviruses and infection of NHK

Recombinant adenoviruses expressing the control GFP (AdGFP), alone or together with the T7 epitope-tagged wild-type DLK (AdDLK) [24] were amplified in BMAdE1 cells [25]. NHK subconfluent monolayer cultures were