Capture par la bactérie cible

Des expériences de mutagénèse dans des souches de E. coli ont montré que l'entrée des microcines E492, H47 I47 et M dans la bactérie cible passait par une interaction avec les récepteurs FepA, Fiu et Cir (9,93). Pour rappel, ces 3 récepteurs reconnaissent la DHBS, mais seul FepA interagit avec l'entérobactine (paragraphe III. 4. c. du chapitre concernant E. coli Nissle). Une souche dépourvue de Fiu ou Cir présente la même sensibilité aux sidérophores-microcines qu'une souche sauvage (93). Par contre, une souche mutée pour FepA présente une moindre sensibilité, qui est accrue pour un double mutant fepAfiu ou fepAcir. Mais seule une souche de E. coli dépourvue des 3 récepteurs FepA, Cir et Fiu est totalement résistante (9,93), ce qui indique que les sidérophores-microcines peuvent utiliser les 3 récepteurs pour entrer dans le périplasme, même si FepA semble avoir un rôle prédominant. De même, chez Salmonella, c'est le récepteur IroN des salmochélines et DHBS qui est le récepteur principal des sidérophores-microcines, suivi par Cir et FepA (9).

Le mode d'action des sidérophores-microcines a ainsi été qualifié de « Cheval de Troie » (74,108) : elles pénètrent dans la bactérie cible en utilisant les récepteurs spécifiques des sidérophores grâce à leur modification post-traductionnelle par un groupement dérivé de l'entérobactine. A ce titre, une sidérophore-microcine « non modifiée », c'est à dire dépourvue de groupement dérivé de l'entérobactine ne devrait pas pouvoir pénétrer dans la bactérie cible et serait donc inactive. La littérature concernant l'activité éventuelle des sidérophores-microcines non modifiées est cependant contradictoire.

Une forme de microcine E492 non modifiée a pu être purifiée à partir de cultures en milieu contenant des acides aminés casaminés (inhibant la production d'entérobactine, voir paragraphe III. 2. précédent) comme source d'acides aminés. Son activité antibiotique a été comparée à celle de la forme modifiée. La forme modifiée est active sur davantage d'espèces bactériennes : E. cloacae et K. pneumoniae en plus de E. coli et S. enteritidis. De plus, les concentrations minimales inhibitrices sont 2 à 8 fois plus faibles avec la forme modifiée. La modification post-traductionnelle de la microcine E492 augmente donc sensiblement son activité antibiotique, mais la microcine non modifiée est décrite comme ayant une activité antibiotique intrinsèque (89,102).

61 Une limite de ces études est qu'elles font appel à des formes purifiées et concentrées de microcines E492. Les concentrations testées pour établir la sensibilité aux microcines E492 modifiées ou non sont de 0,02 à 10 µM (89). Aucune donnée n'existe concernant les concentrations de microcines E492 synthétisées physiologiquement par la souche K. pneumoniae RYC492, et encore moins concernant les concentrations atteintes dans l'environnement immédiat des bactéries cibles. Il est donc difficile d'extrapoler l'activité in vivo d'une microcine à partir d'une concentration minimale inhibitrice qui est peut-être supra-physiologique. D'autre part, la microcine E492 non modifiée n'a aucune similarité structurelle évidente avec les sidérophores de la famille des catécholates qui pourrait expliquer qu'elle soit reconnue par les récepteurs spécifiques FepA, Fiu et Cir. Elle pourrait toutefois adopter une conformation tridimensionnelle lui permettant d'être reconnue par ces récepteurs (108).

Par ailleurs, cette interprétation d'une activité antibiotique de la microcine E492 non modifiée est contredite par une étude de l'activité antagoniste d'une souche porteuse de l'îlot microcine E492, mais incapable de produire de l'entérobactine. En effet, une souche de E. coli porteuse de l'îlot microcine E492 mais mutée pour entC ou entF produit une microcine E492 non modifiée, mais n'exerce pas d'effet antagoniste sur une bactérie cible (Figure 19) (109). L'activité antibiotique est évaluée en mettant en contact une goutte de concentration calibrée en bactérie productrice de microcines avec un tapis de bactéries sensibles. L'effet antagoniste est déterminé par la mesure du diamètre du halo d'inhibition éventuel autour de la bactérie productrice. Ce test se rapproche davantage des conditions in vivo de compétition entre les deux bactéries.

Figure 19 : Production de microcine E492 inactive par des bactéries portant des mutations dans les gènes de synthèse de l'entérobactine.

Des aliquots de cultures liquides de souches de E. coli sauvage (wt), dépourvue du gène entC (entC-) ou entF (entF-) portant le système de production de la microcine E492 (pJEM15) ont été déposés sur un tapis de bactéries sensibles (E. coli BL21). L'activité est évaluée par les diamètres des halos d'inhibition de croissance. D'après Mercado G. et al. (109)

pER307A as the template and the primers T7 and DomAR (5!TGGCGCTTA TGCCTTCAGTT3!). A construct with an E750A mutation in domain A of EntF was constructed by site-directed mutagenesis, using a QuikChange mutagenesis kit from Stratagene following the conditions suggested by the manufacturer, with an extension time of 16 min. The template used was pER311, and the primers employed were A-E750A-F (5!GGCCCGACGGCAGCGGCGGTA3!) and A-E750A-R (5!TACCGCCGCTGCCGTCGGGCC3!). The resulting plasmid was introduced into an entF strain, and mutants defective in enterochelin pro- duction were selected on chrome azurol S (CAS) plates and recloned into pACYC184 as described above for pACYC-EntF. All constructs were fully sequenced. Standard techniques for cloning, electroporation, restriction analysis, and plasmid and chromosomal DNA preparations were performed as described previously (2, 32, 39).

Growth conditions and MccE492 activity assay on plates.Bacterial growth was performed as previously described (24, 25, 45), with antibiotics used at the following concentrations: ampicillin, 100 "g/ml; kanamycin, 50 "g/ml; strepto- mycin, 20 "g/ml; tetracycline, 50 "g/ml; and chloramphenicol, 50 "g/ml.

Activity in plates was determined by mixing an aliquot of 0.2 ml of 2 # 107

cells/ml of the sensitive E. coli strain grown in LB (with the corresponding antibiotic) with 3 ml of soft agar and overlaying the mixture onto LB plates. Three-microliter aliquots of overnight cultures were seeded onto these plates, and the presence of active MccE492 was detected by the formation of growth inhibition halos. A lawn of the sensitive E. coli strain BL21(DE3) was routinely used as the indicator strain. Depending on the size of the inhibition halo pro- duced, in almost all cases the activity was assigned to one of the following three categories: low ($), medium ($$), and high ($$$). The evaluation of activity was performed after the observation of 6 to 20 inhibition halos for each case. This semiquantitative assay is comparative, and for comparison criteria, the activity produced by E. coli pJAM434 was considered low ($), that by S. enterica np133 was considered medium ($$), and that by S. enterica pJAM434 was considered high ($$$). There were two special cases in which the activity, although very low, was detectable by visual inspection, and the results were expressed as %.

CAS plates were prepared as described by Schwyn and Neilands (41). When chrome azurol binds to iron, a blue color is produced in the plates. Siderophore production was detected by the appearance of a yellow halo around the colonies after 24 h of incubation.

MccE492 purification, PAGE, and immunoblotting. MccE492 was extracted from 500 ml of supernatant of cultures of E. coli VCS257/pJEM15 or from different ent-defective hosts carrying pJEM15, using a similar procedure to one described previously (43). Cells were grown at 37°C in M9 medium supple- mented with citrate and glucose (34) with shaking at 220 rpm for 20 h, and the supernatant was collected by centrifugation at 17,000 # g for 30 min. The supernatant was loaded onto a Sep-Pak C8cartridge (Waters) previously equil-

ibrated with 5 ml of 0.1% trifluoroacetic acid (TFA) in nanopure water. The cartridge was washed with 5 ml 30% acetonitrile (ACN)-0.1% TFA, and MccE492 was eluted with 5 ml of 40% ACN-0.1% TFA. Polyacrylamide gel electrophoresis (PAGE) was carried out under the conditions described by Scha¨gger and von Jagow (40), and nitrocellulose membranes (Millipore) were used for immunoblot transference (2 h at 100 V and &20°C; chilled 25 mM Tris-HCl–190 mM glycine–20% methanol was used as transfer buffer). MccE492 was detected with a polyclonal antibody prepared in rabbits against the last 20 amino acids of the protein (antiserum dilution, 1:500) and with a horseradish peroxidase-linked anti-rabbit goat antibody (Pierce) (dilution, 1:20,000). The chemiluminescence reaction was performed in 100 mM Tris-HCl, pH 8.5, 1.25 mM luminol, and 0.2 mM p-coumaric acid. The reaction was started by the addition of an aliquot of 30% H2O2(final concentration, 0.01%). The membrane

was exposed to X-OMAT AR film (Kodak) for 2 to 5 min, depending on the signal obtained.

Bioinformatic tools. The sequences of the crystallized proteins used in this work were taken from their respective Protein Data Bank (PDB) files, using the program Swiss-PDB Viewer V3.7 (http://expasy.org/spdbv). Sequence alignment was performed with the AlignX module of the VectorNT19 program (Informax), using the blosum62mt2 matrix under the standard conditions provided by the software. Three-dimensional analysis of the structures was performed using the VMD1.8.5 program (23), freely available at http://www.ks.uiuc.edu/Research /vmd/.

MALDI-TOF mass spectrometry (MALDI-TOF-MS).Samples were analyzed in a matrix-assisted laser desorption ionization–time of flight (MALDI-TOF)

Calibration was carried out with an external standard, using a mix of peptides between 5,000 and 20,000 Da (Bruker Daltonics Inc.).

RESULTS AND DISCUSSION

Production of active MccE492 requires the synthesis of en-

terochelin.

Two strains of E. coli carrying mutations in genes

involved in enterochelin synthesis (entC and entF) were trans-

formed with pJEM15, a plasmid that encodes the MccE492

system. The resulting strains did not produce antibacterial ac-

tivity on a sensitive lawn (Fig. 1A). The lack of activity was not

due to the absence of synthesis or secretion of MccE492 but

rather to the production of an inactive form, as established by

immunoblotting of purified samples from supernatant cultures

of these strains (Fig. 1B). These samples did not present an-

tibacterial activity even at protein concentrations equivalent to

or higher than those in preparations obtained from the wild-

type host. The mass of MccE492 isolated from the ent mutant

strains was determined by MALDI-TOF-MS and corre-

sponded to that of the unmodified form (7,887 Da), which had

the N terminus cleaved at the double-glycine-type motif during

export (24; M. Tello and R. Lagos, unpublished results). The

lesser secreted amount of unmodified MccE492 than of the

active form was consistently found in several preparations, but

the cause of this effect remains to be determined. The absence

of posttranslational modification has also been observed for

MccE492 exported by an aroB strain, with a host mutation that

affects the synthesis of enterochelin (44), but there is no report

about its activity. The lack of antibacterial activity in hosts

defective in enterochelin production (entA and entF mutants)

has been reported for MccH47 (3), and due to similarity with

MccE492 in the maturation genes and in the C-terminal re-

gion, this bacteriocin probably undergoes the same posttrans-

lational modification (36).

Enterochelin is needed as a precursor of the structural vari-

ant salmochelin (6, 21), which is used for the modification of

MccE492 at serine 84 (43). Salmochelins are derivatives of

enterochelin that are mono-, di-, or triglucosylated on the

FIG. 1. Production of inactive MccE492 in hosts carrying muta- tions in genes involved in the synthesis of enterochelin. (A) Aliquots (3 "l) of liquid cultures of E. coli VCS257 (wt), E. coli H5311 (entC), and

E. coli ER1100A (entF) carrying the MccE492 producer system

pJEM15 were seeded on a lawn of sensitive cells [E. coli BL21(DE3)], and activity was assessed by the appearance of growth inhibition halos. (B) Sodium dodecyl sulfate-PAGE and immunoblotting of samples of MccE492 purified from the strains mentioned in panel A (lane 1, entC mutant; lane 2, entF mutant; lane 3, wild type).

Des résultats similaires ont été obtenus avec des souches portant l'îlot microcine E492 mutées pour les gènes responsables des modifications post-traductionnelles mceC, mceI ou mceJ : ces souches perdent leur capacité à former un halo d'inhibition de croissance sur un tapis de bactéries sensibles (95). Ainsi, une souche incapable de modifier la microcine E492 après la traduction perd son activité antagoniste. Une observation similaire avait été réalisée concernant l'absence d'activité antibiotique d'une souche portant l'îlot microcine H47 mais incapable de synthétiser de l'entérobactine (101).

La question de l'activité éventuelle des formes de microcines E492, H47, I47 et M dépourvues de modification post-traductionnelle reste donc sans réponse définitive. Un élément décisif pourrait être l'étude de l'interaction entre ces microcines et les récepteurs FepA, Fiu et Cir (étude cristallographique par exemple) de façon à établir les groupements clés dans cette reconnaissance. Néanmoins, il est établi que la modification post-traductionnelle avec un groupement sidérophores augmente considérablement l'effet antibiotique des microcines.