HAL Id: hal-01858891
https://hal.archives-ouvertes.fr/hal-01858891
Submitted on 22 Aug 2018
HAL is a multi-disciplinary open access
archive for the deposit and dissemination of
sci-entific research documents, whether they are
pub-lished or not. The documents may come from
teaching and research institutions in France or
abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est
destinée au dépôt et à la diffusion de documents
scientifiques de niveau recherche, publiés ou non,
émanant des établissements d’enseignement et de
recherche français ou étrangers, des laboratoires
publics ou privés.
Peri-implantitis-associated methanogens: a preliminary
report
Souad Belkacemi, Anthony Mazel, Delphine Tardiyo, Patrick Tayitian,
Gregory Stephan, Giancarlo Bianca, Elodie Terrer, Michel Drancourt, Gerard
Aboudharam
To cite this version:
Souad Belkacemi, Anthony Mazel, Delphine Tardiyo, Patrick Tayitian, Gregory Stephan, et al..
Peri-implantitis-associated methanogens: a preliminary report. Scientific Reports, Nature Publishing
Group, 2018, 8, pp.9447. �10.1038/s41598-018-27862-8�. �hal-01858891�
Peri-implantitis-associated
methanogens: a preliminary report
Souad Belkacemi
1, Anthony Mazel
2, Delphine Tardivo
2, Patrick Tavitian
2, Grégory Stephan
2,
Giancarlo Bianca
3, Elodie Terrer
1,2, Michel Drancourt
1& Gérard Aboudharam
1,2Methanogens have already been described in periodontitis but not in peri-implantitis. Thirty peri-implantitis samples and 28 control samples were collected in 28 consenting peri-implantitis patients. PCR-sequencing of the 16S rRNA gene was used as a broad-spectrum screening method and results were further confirmed by real-time quantitative PCR targeting the mcrA genes. Results showed a methanogen community dominated by Methanobrevibacter oralis in 31/58 (51%) samples including 16/28 (57%) control samples and 15/30 (50%) peri-implantitis samples. Methanobrevibacter
massiliense was detected in 5/58 (8.6%) samples including 3/28 (1%) control samples and 2/30 (6.7%)
peri-implantitis samples. The prevalence of M. oralis or M. massiliense did not significantly differ in peri-implantitis and control samples (exact Fisher test, P = 0.61 and P = 0.67, respectively). Further ponderation of the methanogen load by the real-time quantitative PCR for actin human gene again indicated non-significant difference (Wilcoxon-Mann-Whitney test, P = 0.48 and P = 0.40, respectively). These data show that the prevalence of methanogens does not differ in peri-implantitis lesions and healthy sites, when individuals are their own control. These data do not allow assigning a specific pathogenic role to methanogens in peri-implantitis; methanogens rather are part of the commensal and normal flora of the oral cavity.
Peri-implantitis is an inflammatory disease characterized by the destruction of soft and hard tissues and the formation of pockets around osteo-integrated dental implants1. Contrasting with metagenomics studies which
failed to detect any methanogen in peri-implantitis lesions2,3, methanogen-targeting molecular investigations
detected DNA sequences specific for the methanogens Methanobrevibacter oralis, Methanobrevibacter smithii, Methanomassiliicoccus luminyensis, “Methanobacterium congolense/curvum” and Methanobrevibacter massiliensis in parodontitis pockets4,5. M. oralis, an oral cavity inhabitant6 has been more frequently found in parodontitis
pockets7 in association with anaerobes8 and its role was analyzed as moderate7. Yet, studies relying on the simple,
un-quantified molecular detection of sequences leaved unsatisfied the relative role of these methanogens in the pathogenesis of peri-implantitis9. We hypothetized that the relative load of methanogens among the total flora
in peri-implantitis lesions, would give an indication on the relative role of methanogens in the pathogenesis of peri-implantitis as previously showed for periodontitis10.
Patients and Methods
Twenty-eight patients diagnosed with peri-implantitis were prospectively included in this study from January 2016 to June 2016. This study was approved by the clinical research ethics committee of the IFR 48 of the University of Aix-Marseille approved (protocol No. 2016–011). All methods were performed in accordance with the relevant guidelines and regulations. The study protocol was explained to each patient and all patients signed an information document and an informed consent document. All patients were interviewed in order to collect their medical and dental history including the date of implantation. An intra-oral examination was performed to measure bleeding on probing (BOP), probing depth (PD), the surfaces with presence of plaque (%), the pres-ence of pus, the number of implants affected by the peri-implantitis, the prespres-ence of mobility and the verti-cal resorption of the supporting bone. In addition, a radiographic status and a 3D radiography were realized. Patient was then diagnosed with periimplantitis when the following criteria were met: (1) vertical resorption of the supporting bone ≥2 mm or (2) probing depth ≥5 mm or (3) bleeding or (4) pus or (5) motility of the implant according to the literature11. Subgingival dental plaque samples were collected from all peri-implantitis
pockets of each individual with sterile Gracey curettes 1/2 (Hu-Friedy, Rotterdam, Netherlands) and placed into
1Aix-Marseille Univ, IRD, MEPHI, IHU Méditerranée-Infection, Marseille, France. 2UFR Odontologie, Aix-Marseille
Université, Marseille, France. 3Private practice Marseille France, Marseille, France. Correspondence and requests for
materials should be addressed to M.D. (email: [email protected]) Received: 7 December 2017
Accepted: 7 June 2018 Published: xx xx xxxx
www.nature.com/scientificreports/
tubes containing 1 mL of the SAB anoxic transport medium for methanogens composed of 0.1 g/L; MgCl, 0.2 g/L; KH2PO4, 0.2 g/L; KCl, 0.1 g/L; CaCl2, 3 g/L; NaCl, 1.15 g/L; Na2HPO4, 1 g/L; ascorbic acid, 1 g/L; uric acid, 1 g/L;
glutathione, pH 7.5 with 0.3/0.6 g/L; KOH12. Negative control subgingival dental plaque samples were collected
from healthy gingival sites with another curette of Gracey sterile and places in the same medium. Each sample collected was suspended in 1 mL transport medium. After homogenization, a 250-μL aliquot was shaken with 0.3 g of acid-washed beads (≤106 mm; Sigma, Saint-Quentin-Fallavier, France) in a FastPrep-24 5 G
™
instrument (MP Biomedical Europe, Illkirch, France) at a speed of 6.5 m/s (full speed) for 90 s. The supernatant was incubated overnight at 56 °C with 180 μL lysis buffer and 25 μL proteinase K (20 mg/mL) in the Qiagen EZ1 DNA tissue kit (Qiagen, Courtaboeuf, France) and total DNA was then extracted using a kit NucleoSpin®
NucleoSpin®
Tissue kit (MACHEREY- NAGEL, Duren Germany; REF: 74095250). Extraction DNA realize after adding 200 μL B3 buffer, 10 μL synthetic plasmid and incubated for 60 minutes at 70 °C. DNA was then washed with 200 μL BW buffer and 600 μL B5 buffer (MACHEREY-NAGEL). After centrifugation for 1600 g, the DNA pellet was eluted in 100 μL of EB buffer (heated to 70 °C) (MACHEREY-NAGEL). As for PCR amplifications, negative controls con-sisting of sterile DNA-free water were introduced in all the manipulations. We have performed an amplification of the external synthetic plasmid to check for inhibitor absence in PCR. In the first broad-spectrum screening step, methanogen DNA was tentatively detected using PCR-sequencing of the methyl-coenzyme M reductase (mcrA) gene (primers mcrALuF 5′-GGTGGTGTMGGATTCACACARTAYGCWACAGC-3′ and mcrALuR 5′-TTCATTGCRTAGTTWGGRTAGTT-3′) and the 16S rRNA gene (primers: 16SrDNA SDArch0333aS15-F 5′-TCCAGGCCCTACGGG-3′ and 16SrDNA SDArch0958aA19-R 5′-YCCGGCGTTGAMTCCAATT-3′) as previously described13. The PCR program was 94 °C for 30 s, 58 °C for 45 s and 72 °C for 30 s followed by 35cycles of 10 min at 72 °C for amplifying the16S rRNA gene; and 40 cycles at 95 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s followed by extension of 10 min at 72 °C for amplifying the mcrA gene. PCR product sequences were analyzed with the ChromasPro program, version 1.7: sequence similarity values were determined by BLAST program in the online analysis platform from NCBI (blast.ncbi.nlm.nih.gov). In the second step, spe-cific quantitative amplification of the M. oralis strain JMR014 DNA was achieved using a specific real-time PCR
assay targeting M. oralis heat-shock protein cnp60 gene as previously described3. Briefly, M. oralis cnp602P
probe (6-carboxyfluorescein (FAM)-5′AGCAGTGCACCTGCTGATATGGAAGG-3′) (Eurogentec, Seraing, Belgium), M. oralis-cnp602F primer (5′-GCTGGTGTAATCGAACCTAAACG-3′) and M. oralis-cnp602R primer (5′-CACCCATACCCGGATCCATA-3′) (Eurogentec) were incorporated into a PCR program comprising of 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 35 s and 45 °C for 30 s. The real-time PCR was regarded as positive for any cycle threshold (Ct) value ≤40. A calibration curve was established by measuring the Ct values for serial ten-fold dilutions of M. oralis (10E + 01 to 10E + 09). Stock inoculum of 109 M. oralis
organisms (as determined by optic density measurement = 0.4) was serially diluted in sterile PBS. Then, each dilution was run in triplicate in order to determine the calibrating curve. Further, specific quantitative ampli-fication of the M. massiliense DNA targeted the M. massiliense mcrA gene. Primer sequences were determined by using the software primer3 after alignment of the mcrA gene sequence from M. massiliense, M. oralis, M. smithii, M. arboriphilus, Methanobrevibacter ruminantium, Methanobrevibacter wolinii, Methanobrevibacter cuticularis, Methanobrevibacter filiformis, Methanobrevibacter millerae and Methanobrevibacter olleyae. This yielded a M. massiliense mcrA probe (6-carboxyfluorescein (FAM) 5′-TGG-CTG-TTC-CAC-TGC-ATT-CGCT -3′) and the primer pair M. massiliensis-mcrA F (5′-ACTCACTTTGGCGGATCTCA-3′) and M. massiliensis-mcrA R (5′-GTACATGGACAAGTACCATGC-3′). The PCR program was 95 °C for 5 min, fol-lowed by 40 cycles of 95 °C for 15 s, 60 °C for 35 s and 45 °C for 30 s. A calibration curve was established by measuring the Ct values of ten-fold serial dilutions of M. massiliensis (10E + 01 to 10E + 05). Furthermore, real-time PCR targeting the human actin gene was used as an internal calibrator using primer pair Actin F: 5′CATGCCATCCTGCGTCTGGA3′ and ActinR: 5′CCGTGGCCATCTCTTGCTCG3′ (Eurogentec) and the Actin P6FAM-probe: 5′CGGGAAATCGTGCGTGACATTAAG3′ (Eurogentec). The PCR program was 50 °C for 2 min, 95 °C for 3 min, followed by 45 cycles of 95 °C for 15 s, 60 °C for 30 s and 45 °C for 30 s. A calibration curve was established by measuring the Ct values of serial ten-fold dilutions of HL-60 cells (human leukemia cells) (4.10E + 00 to 4.10E + 05). Finally, the load ratio of M. oralis/human cell and M. massiliense/human cells was calculated by dividing the extrapolated number of methanogens in the sample by the extrapolated number of cells using actin quantification as a proxy.
Differences in the prevalence of methanogens in the peri-implantitis sample group and the control sam-ple group were analyses for statistical significance by using the Fisher exact test for discrete values and the Wilcoxon-Mann-Whitney test for ratios; a P ≤ 0.05 was used to infer significance.
Availability of data and materials.
The datasets generated and/or analyzed during the current study are available within the manuscript.Results
Eight men and twenty women aged between 35 and 86 years diagnosed with peri-implantitis were prospec-tively included in the study. One control sample and one peri-implantitis sample were collected in each patient, except for patient no. 24 in whom three peri-implantitis samples were collected; giving a total of 28 control samples and 30 peri-implantitis samples. A total of 10 individuals had generalized bleeding while 18 had local-ized bleeding. The pocket depths ranged from 4 to 12 mm (x−: 7.14, σ: 1.99). The number of implants affected
by peri-implantitis ranged from 1 to 7 (x−: 2.64, σ: 1.80). In four implants diagnosed with peri-implantitis, pus
was observed. The vertical resorption of the supporting bone (% of implant length) ranged from 29% to 100% (100% in only one case) (x−: 54.64, σ: 17.69) (Table 1). In all PCR experiments, negative controls remained
neg-ative and the positive amplification of the external synthetic plasmid control demonstrated the absence of PCR inhibitors. Using methanogen-specific PCR amplification, 31/58 samples (53.4%) were positive for M. oralis with
100% gene sequence similarity with the reference 16S rRNA and mcrA gene sequences; comprising 16/30 (53%) peri-implantitis positive samples and 15/28 (53.6%) control samples. Further, 5/58 (8.6%) samples were positive for M. massiliense with 100% 16S rRNA and mcrA gene sequence similarity with reference sequences9 including
2/30 peri-implantitis samples and 3/28 control samples (Table 2). Altogether, methanogens were detected in 36/58 (62%) samples including 17/30 (57%) peri-implantitis samples and 19/28 (67.8%) control samples. Further M. oralis and M. massiliense-targeted PCR amplifications confirmed all the negative and positive results obtained by using methanogen-specific PCR amplifications. There was no statistically significant difference in the prevalence of methanogens in the peri-implantitis and control samples (M. oralis, P = 0.61; M. massilense, P = 0.67; all meth-anogens, P = 0.45).
Further detection of actin by qPCR extrapolated into 1.15E + 01–9.29E + 05 cells/sample (x−: 7.71E + 04,
σ: 1.89E + 05) (Tables 2 and 3). Actin measurement based deriving the load of host cells which calculated to be (x−: 1.04E + 05, σ: 2,33E + 05) in the peri-implantitis samples and (x−: 4.86E + 04, σ: 1,23E + 05) in the control
specimen for positive sample. Methanogen DNA was detected in 19/28 (67%) control samples with an average number of cells of (x−: 1.42E + 04, σ: 4.94E + 04) and in 17/30 (60%) in the peri-implantitis sample with an
average number of cells of (x−: 8.03E + 05, σ: 2,53E + 06). The mean load ratio of M. oralis or M. massiliense in
the peri-implantitis samples was not significantly different than in the control samples (P = 0.48 and P = 0.4, respectively).
Patient Sample Sexe BOP PD (mm)
Surfaces with presence of
plaque (%) Presence of pus
Number of implants affected
by periimplantitis Presence of mobility
Vertical resorption of the supporting bone (% of implant lenght) 1 P1 f Generalized 8 50 No 4 No 48 2 P2 f Generalized 7 100 Yes 2 No 70 3 P3 f Generalized 7 25 No 1 No 51 4 P4 m Localized 4 100 No 2 No 37 5 P5 m Localized 6 100 No 7 No 46 6 P6 f Localized 4 50 No 2 Yes 29 7 P7 f Generalized 7 50 No 3 Yes 69 8 P8 f Localized 8 25 Yes 1 No 51 9 P9 f Localized 5 25 No 2 No 64 10 P10 m Localized 4 25 No 1 No 46 11 P11 f Localized 7 100 Yes 2 No 71 12 P12 f Localized 12 25 No 1 Yes 100 13 P13 f Localized 10 50 No 5 No 60 14 P14 f Generalized 9 100 No 2 Yes 74 15 P15 f Localized 6 100 No 1 No 52 16 P16 m Generalized 5 100 Yes 6 No 35 17 P17 f Localized 7 25 Yes 7 No 67 18 P18 f Localized 8 100 Yes 1 No 60 19 P19 m Generalized 7 100 Yes 4 No 57 20 P20 f Localized 10 100 Yes 2 No 81 21 P21 f Localized 6 50 No 1 No 50 22 P22 m Localized 6 100 Yes 1 No 35 23 P23 f Localized 9 100 No 2 No 40 24 P24, P25, P26 f Generalized 10 100 No 4 No 85 25 P27 m Localized 6 100 No 2 No 36 26 P28 m Generalized 7 100 Yes 2 No 35 27 P29 f Generalized 9 50 No 4 No 46 28 P30 f Localized 6 50 No 2 No 35
Table 1. Clinical data collected in patients with periimplantitis. BOP, bleeding on probing; PD, probing depth.
Samples
Peri-implantitis Healthy control
M. massiliense
Load Human cells load M. massiliense/Actin ratio M. massiliense load Human cells Load M. massiliense/Actin ratio
4 2,06E + 02 7,31E + 02 2,82E − 01 1,08E + 02 8,87E + 02 1,22E − 01
8 7,02E + 03 6,31E + 01 1,11E + 02 5,08E + 03 2,21E + 02 2,30E + 01
18 N/A 6,89E + 05 N/A 3,33E + 03 1,80E + 04 1,85E − 01
www.nature.com/scientificreports/
Discussion
In this study, we detected the same prevalence of M. oralis and M. massiliensis’s DNA in control samples as in the peri-implantitis samples. Both types of samples originated from the same patient, which means that every patient was also his own control. Using this strict methodology and appropriate negative controls which remained negative in all experiments, we observed that the load of both methanogens was not significantly different in the peri-implantitis samples than in the control samples. These results agree with a previous study detecting M. oralis in 10 patients with aggressive periodontitis and in 10 periodontally healthy individuals6. In a more recent
study, M. oralis respresented 82% of cloned methanogen DNA in patients and 70.1% in healthy individuals6.
These results however differ from those previously reported using 16S rRNA gene clone library analysis, which failed to recover any methanogen sequences in peri-implantitis samples3. We proposed that differences in the
methodology partly account for differences in the reported results. Indeed, detecting M. oralis in peri-implantitis lesions is not surprising as M. oralis is the main methanogen detected in the oral cavity with a prevalence higher than 40%15. Here, M. oralis was detected in 53.4% (31/58) of samples. In addition, we also detected M. massiliense
previously reported in the oral cavity with prevalence <20%8,9.
However, we propose that the major difference between previous reports and our present report relies on the choice of the negative controls, i.e. using individuals as their own control as we invented here. Our choice to sample infected (diseased) and non-infected control site within the same person was based on the fact that “the controls are controls only if they are healthy”11. However, this choice exposes to the possibility of
overmatch-ing bias which occurs when controls become more like the cases about exposure than the general population11.
Indeed, sampled sites are in the same environment with similar exposure by the same microbiota as mentioned in the situation of overmatching bias16. Potential overmatching bias has to be taken into consideration to interpret
the data here reported. With the reserve of a potential overmatching bias, our analyses showed an absence of any difference in the prevalence and in the load of methanogens in peri-implantitis samples and control samples collected in the very same person. Furthermore; a study has shown that the environment in the sulcus depths of peri-implantitis is well adapted to the growth of obligate anaerobic bacteria which provides a specific signature during this infection, the microorganisms of the oral microbiota within the same oral cavity are not exposed to the same environment; oral microbiota and disease sites versus oral microbiota and healthy sites8. We argue that
Samples
Peri-implantitis
Samples
Healthy control
M. oralis load Human cells Load M. oralis/Actin ratio M. oralis load Human cells Load M. oralis/Actin ratio
1 N/A 2,00E + 01 1 5,74E + 02 1,66E + 02 3,46E + 00
2 6,53E + 04 6,10E + 01 1,07E + 03 2 1,33E + 05 1,96E + 01 6,79E + 03
3 N/A 2,74E + 00 3 N/A 9,11E + 01
4 N/A 7,31E + 02 4 N/A 8,87E + 02
5 1,52E + 08 1,51E + 01 1,01E + 07 5 3,92E + 02 1,17E + 02 3,35E + 00
6 4,22E + 03 7,07E + 01 5,97E + 01 6 N/A 2,56E + 01
7 N/A 2,26E + 01 7 5,04E + 04 1,15E + 01 4,38E + 03
8 N/A 6,31E + 01 8 N/A 2,21E + 02
9 1,86E + 04 1,81E + 01 1,03E + 03 9 5,98E + 05 1,37E + 01 4,36E + 04
10 2,69E + 02 3,80E + 01 7,08E + 00 10 1,47E + 02 2,89E + 01 5,09E + 00
11 2,08E + 05 2,51E + 01 8,29E + 03 11 1,50E + 03 2,87E + 01 5,23E + 01
12 N/A 2,21E + 01 12 7,09E + 02 1,51E + 01 4,70E + 01
13 2,42E + 02 3,13E + 02 7,73E-01 13 N/A 7,86E + 01
14 N/A 1,01E + 04 14 N/A 1,62E + 01
15 N/A 1,86E + 02 15 N/A 1,63E + 04
16 N/A 6,19E + 04 16 N/A 2,14E + 02
17 2,27E + 09 1,74E + 04 1,30E + 05 17 3,83E + 03 3,05E + 03 1,26E + 00
18 1,06E + 02 6,89E + 05 1,54E-04 18 N/A 1,80E + 04
19 N/A 5,91E + 05 19 1,19E + 03 1,12E + 05 1,06E-02
20 1,23E + 09 3,61E + 02 3,41E + 06 20 6,58E + 05 3,31E + 05 1,99E + 00
21 6,58E + 05 6,89E + 02 9,55E + 02 21 2,43E + 05 7,61E + 02 3,19E + 02
22 N/A 7,41E + 02 22 N/A 3,05E + 03
23 N/A 4,04E + 04 23 7,15E + 06 4,55E + 04 1,57E + 02
24 N/A 2,04E + 05 24 N/A 3,40E + 05
25 4,48E + 05 2,71E + 05 1,65E + 00 25 7,99E + 04 1,17E + 03 6,83E + 01
26 N/A 9,49E + 05 26 N/A 6,14E + 02
27 4,40E + 05 2,04E + 03 2,16E + 02 27 6,23E + 07 2,91E + 02 2,14E + 05
28 N/A 2,85E + 03 28 5,74E + 02 4,87E + 05 1,18E-03
29 6,99E + 07 2,38E + 05 2,94E + 02
30 1,46E + 02 3,37E + 04 4,33E − 03
these controls are of better value than control samples collected in another individual, as previously reported in studies of peri-implantitis and in studies of periodontitis6. The possibility that methanogens from diseased tissues
did contaminate healthy tissues cannot be ruled out in our study. This would obviously temperate the conclusions here reported.
Methanogens have been previously detected in another, closely related situation of periodontitis; and that their load was significantly associated with the severity of the periodontal lesions. The results here reported therefore mirror and extend previous data to a yet un-explored situation of peri-implantitis. Indeed, the micro-bial flora recovered from peri-implantitis lesions differs from that of periodontitis. The genus Olsenella, Sphingomonas, Peptostreptococcus and unclassified Neisseriaceae are more abundant in peri-implantites whereas the genus Desulfmicrobium is lower. The methanogens, although unable to detect species, are more important in peri-implantitis than periodontitis but without significant difference13. In these situations, it has been postulated that
the particular metabolism of methanogens, which reduces CO2 with H2 as the electron donor for methanogenesis,
favors the growth of pathogenic bacteria in anaerobic gingival pockets6. Also, methanogens including M. oralis and
M. smithii have been detected and cultured in anaerobe abscesses, including several cases of life-threatening brain abscess17 and in one case of muscular abscess18. These clinical observations along with experimental data in M. oralis
–challenged mice17 undoubtedly indicate that methanogens are opportunistic pathogens (Table 4).
Here, we observed that the methanogen load but not the sole detection of methanogens, was not significantly associated with peri-implantitis. This observation differs from that drawn from a previous comparative study of peri-implantitis sites, healthy implant sites and healthy sites9. In latter study, authors found a significant
differ-ence in the prevaldiffer-ence of methanogens in peri-implantitis sites (48%) and in healthy implants (16%) and natural teeth (8%). Nevertheless, we argue that detecting the presence of methanogens alone is not sufficient to diagnose peri-implantitis, which is probably due to their universal presence in the oral cavity, producing an unavoidable contamination of samples. Only a strict quantification of those methanogens would allow us to overcome this issue. Indeed, we previously made exactly the same observation as for periodontitis7.
Further studies are warranted to ensure that the observations here reported are not restricted to our center. Indeed, other populations with other geographical and nutritional backgrounds may exhibit different reper-toires of methanogens. Cumulative studies will refine our knowledge of the potential role of methanogen in mixed infection with anaerobes in the pathology of peri-implantitis, guiding therapeutic proposals. In any case, peri-implantitis is a complex pathology which definite diagnosis does not rely on the detection of any single microorganism.
References
1. Pérez-Chaparro, P. J. et al. The Current Weight of Evidence of the Microbiologic Profile Associated with Peri-Implantitis: A Systematic Review. J. Periodontol. 87, 1295–1304 (2016).
2. Heuer, W. et al. Metagenomic analysis of the peri-implant and periodontal microflora in patients with clinical signs of gingivitis or mucositis. Clin. Oral Investig. 16, 843–850 (2012).
3. Koyanagi, T. et al. Comprehensive microbiological findings in peri-implantitis and periodontitis. J. Clin. Periodontol. 40, 218–226 (2013).
Archaeal genus/species Detection Methods Infections Prevalence in patients Prevalence in healthy subjects References
Methanobrevibacter oralis Culture, PCR, FISH Periodontitis nt 04/10 19 18/50 00/8 20 11/49 00/17 21 44/102 00/65 22 12/25 03/25 9 02/30 nt 23 03/12 nt 24
PCR Culture Brain Abscess + nt 17
Methanobrevibacter smithii Culture, PCR Periodontitis + nt 25 09/20 nt 26 + nt 27 Chronic paravertebral muscle abscess + nt 18
Methanosphaera stadtmanea Culture Periodontitis + nt 25
Methanosarcina spp./M. mazeii Culture, PCR Periodontitis 01/17 nt 28
+ + 6
Thermoplasmata spp./Thermoplasmatales PCR Periodontitis + − 15
03/30 nt 23
Methanobacterium curvum/congolense PCR Periodontitis 04/25 02/25 9
+ + 6
Table 4. List of studies reporting the tentative detection of methanogens in diseased and healthy subjects.
www.nature.com/scientificreports/
4. Vianna, M. E., Conrads, G., Gomes, B. P. F. A. & Horz, H. P. Identification and Quantification of Archaea Involved in Primary Endodontic Infections. J. Clin. Microbiol. 44, 1274–1282 (2006).
5. Huynh, H. T. T., Pignoly, M., Drancourt, M. & Aboudharam, G. A new methanogen “Methanobrevibacter massiliense” isolated in a case of severe periodontitis. BMC Res. Notes 10 (2017).
6. Matarazzo, F., Ribeiro, A. C., Feres, M., Faveri, M. & Mayer, M. P. A. Diversity and quantitative analysis of Archaea in aggressive periodontitis and periodontally healthy subjects: Archaea in periodontitis and health. J. Clin. Periodontol. 38, 621–627 (2011). 7. Huynh, H. T. T., Pignoly, M., Nkamga, V. D., Drancourt, M. & Aboudharam, G. The Repertoire of Archaea Cultivated from Severe
Periodontitis. Plos One 10, e0121565 (2015).
8. Tamura, N., Ochi, M., Miyakawa, H. & Nakazawa, F. Analysis of Bacterial Flora Associated with Peri-implantitis Using Obligate Anaerobic Culture Technique and 16S rDNA Gene Sequence. Int. J. Oral Maxillofac. Implants 28, 1521–1529 (2013).
9. Faveri, M. et al. Prevalence and microbiological diversity of Archaea in peri-implantitis subjects by 16S ribosomal RNA clonal analysis: Archaea in peri-implantitis subjects. J. Periodontal Res. 46, 338–344 (2011).
10. Bringuier, A., Khelaifia, S., Richet, H., Aboudharam, G. & Drancourt, M. Real-Time PCR Quantification of Methanobrevibacter oralis in Periodontitis: Table 1. J. Clin. Microbiol. 51, 993–994 (2013).
11. Million, M., Diallo, A. & Raoult, D. Gut microbiota and malnutrition. Microb. Pathog. 106, 127–138 (2017).
12. Khelaifia, S. et al. Aerobic culture of methanogenic archaea without an external source of hydrogen. Eur. J. Clin. Microbiol. Infect. Dis.
35, 985–991 (2016).
13. Maruyama, N. et al. Intraindividual variation in core microbiota in peri-implantitis and periodontitis. Sci. Rep. 4, 6602 (2014). 14. Khelaifia, S., Garibal, M., Robert, C., Raoult, D. & Drancourt, M. Draft Genome Sequencing of Methanobrevibacter oralis Strain
JMR01, Isolated from the Human Intestinal Microbiota. Genome Announc. 2, e00073-14–e00073-14 (2014).
15. Li, C. L. et al. Prevalence and molecular diversity of Archaea in subgingival pockets of periodontitis patients. Oral Microbiol. Immunol. 24, (343–346 (2009).
16. Wacholder, S., Silverman, D. T., McLaughlin, J. K. & Mandel, J. S. Selection of controls in case-control studies. II. Types of controls. Am. J. Epidemiol. 135, 1029–1041 (1992).
17. Drancourt, M. et al. Evidence of Archaeal Methanogens in Brain Abscess. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 65, 1–5 (2017).
18. Nkamga, V. D., Lotte, R., Roger, P.-M., Drancourt, M. & Ruimy, R. Methanobrevibacter smithii and Bacteroides thetaiotaomicron cultivated from a chronic paravertebral muscle abscess. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 22, 1008–1009 (2016).
19. Ferrari, A., Brusa, T., Rutili, A., Canzi, E. & Biavati, B. Isolation and characterization of “Methanobrevibacter oralis” sp. nov. Curr. Microbiol. 29, 7–12 (1994).
20. Lepp, P. W. et al. Methanogenic Archaea and human periodontal disease. Proc. Natl. Acad. Sci. 101, 6176–6181 (2004).
21. Yamabe, K. et al. Distribution of Archaea in Japanese patients with periodontitis and humoral immune response to the components. FEMS Microbiol. Lett. 287, 69–75 (2008).
22. Vianna, M. E., Holtgraewe, S., Seyfarth, I., Conrads, G. & Horz, H. P. Quantitative Analysis of Three Hydrogenotrophic Microbial Groups, Methanogenic Archaea, Sulfate-Reducing Bacteria, and Acetogenic Bacteria, within Plaque Biofilms Associated with Human Periodontal Disease. J. Bacteriol. 190, 3779–3785 (2008).
23. Horz, H. P., Seyfarth, I. & Conrads, G. McrA and 16S rRNA gene analysis suggests a novel lineage of Archaea phylogenetically affiliated with Thermoplasmatales in human subgingival plaque. Anaerobe 18, 373–377 (2012).
24. Mansfield, J. M., Campbell, J. H., Bhandari, A. R., Jesionowski, A. M. & Vickerman, M. M. Molecular Analysis of 16S rRNA Genes Identifies Potentially Periodontal Pathogenic Bacteria and Archaea in the Plaque of Partially Erupted Third Molars. J. Oral Maxillofac. Surg. 70, 1507–1514 (2012).
25. Belay, N., Johnson, R., Rajagopal, B. S., Conway de Macario, E. & Daniels, L. Methanogenic Bacteria from Human Dental Plaque. Appl. Environ. Microbiol. 54, 600–603 (1988).
26. Brusa, T., Conca, R., Ferrara, A., Ferrari, A. & Pecchioni, A. The presence of methanobacteria in human subgingival plaque. J. Clin. Periodontol. 14, 470–471 (1987).
27. Langendijk-Genevaux, P., Kulik, E. M., Sandmeier, H., Meyer, J. & van der Hoeven, J. S. Isolation of Desulfomicrobium orale sp. nov. and Desulfovibrio strain NY682, oral sulfate-reducing bacteria involved in human periodontal disease. Int. J. Syst. Evol. Microbiol.
51, 1035–44 (2001).
28. Robichaux, M., Howell, M. & Boopathy, R. Methanogenic Activity in Human Periodontal Pocket. Curr. Microbiol. 46, 0053–0058 (2003).
Acknowledgements
The authors acknowledge the expertise of Olga Cusack in editing the manuscript.
Author Contributions
E.T., M.D., G.A. conceived the study and designed the methodology. S.B., A.M., D.T., P.T., G.S., G.B. performed the experiments and E.T., G.A. and M.D. analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.
Additional Information
Competing Interests: The authors declare no competing interests.
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and
institutional affiliations.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International
License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre-ative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not per-mitted by statutory regulation or exceeds the perper-mitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.