Article
Reference
Thapsigargin activates Ca²+ entry both by store-dependent, STIM1/Orai1-mediated, and store-independent,
TRPC3/PLC/PKC-mediated pathways in human endothelial cells
ANTIGNY, Fabrice, et al .
Abstract
The ER Ca²+ sensor STIM1 and the Ca²+ channel Orai1 are key players in store-operated Ca²+ entry (SOCE). In addition, channels from the TRPC family were also shown to be engaged during SOCE, while their precise implication remains controversial. In this study, we investigated the molecular players involved in SOCE triggered by the SERCA pump inhibitor thapsigargin in an endothelial cell line, the EA.hy926. siRNA directed against STIM1 or Orai1 reduced Ca²+ entry by about 50-60%, showing that a large part of the entry is independent from these proteins. Blocking the PLC or the PKC pathway completely abolished thapsigargin-induced Ca²+ entry in cells depleted from STIM1 and/or Orai1. The phorbol ester PMA or the DAG analog OAG restored the Ca²+ entry inhibited by PLC blockers, showing an involvement of PLC/PKC pathway in SOCE. Using pharmacological inhibitors or siRNA revealed that the PKCeta is required for Ca²+ entry, and pharmacological inhibition of the tyrosine kinase Src also reduced Ca²+ entry. TRPC3 silencing diminished the entry by 45%, while the double STIM1/TRPC3 invalidation reduced Ca²+ entry by more [...]
ANTIGNY, Fabrice, et al . Thapsigargin activates Ca²+ entry both by store-dependent,
STIM1/Orai1-mediated, and store-independent, TRPC3/PLC/PKC-mediated pathways in human endothelial cells. Cell Calcium , 2011, vol. 49, no. 2, p. 115-27
DOI : 10.1016/j.ceca.2010.12.001 PMID : 21193229
Available at:
http://archive-ouverte.unige.ch/unige:40242
Disclaimer: layout of this document may differ from the published version.
1 / 1
Cell Calcium49 (2011) 115–127
Contents lists available atScienceDirect
Cell Calcium
j o u r n a l h o m e p a g e :w w w . e l s e v i e r . c o m / l o c a t e / c e c a
Thapsigargin activates Ca 2+ entry both by store-dependent,
STIM1/Orai1-mediated, and store-independent, TRPC3/PLC/PKC-mediated pathways in human endothelial cells
Fabrice Antigny
a, Hélène Jousset
a, Stéphane König
b, Maud Frieden
a,∗aDepartment of Cell Physiology and Metabolism, University of Geneva Medical School, 1 rue Michel Servet, 1211 Geneva 4, Switzerland
bBasic Neurosciences, University of Geneva Medical School, 1 rue Michel Servet, 1211 Geneva 4, Switzerland
a r t i c l e i n f o
Article history:
Received 17 September 2010 Received in revised form 11 November 2010 Accepted 2 December 2010 Available online 28 December 2010
Keywords:
Store-operated Ca2+entry STIM
Orai TRPC PLC PKC
Endothelial cells
a b s t r a c t
The ER Ca2+sensor STIM1 and the Ca2+channel Orai1 are key players in store-operated Ca2+entry (SOCE).
In addition, channels from the TRPC family were also shown to be engaged during SOCE, while their precise implication remains controversial. In this study, we investigated the molecular players involved in SOCE triggered by the SERCA pump inhibitor thapsigargin in an endothelial cell line, the EA.hy926.
siRNA directed against STIM1 or Orai1 reduced Ca2+entry by about 50–60%, showing that a large part of the entry is independent from these proteins. Blocking the PLC or the PKC pathway completely abolished thapsigargin-induced Ca2+entry in cells depleted from STIM1 and/or Orai1. The phorbol ester PMA or the DAG analog OAG restored the Ca2+entry inhibited by PLC blockers, showing an involvement of PLC/PKC pathway in SOCE. Using pharmacological inhibitors or siRNA revealed that the PKCetais required for Ca2+
entry, and pharmacological inhibition of the tyrosine kinase Src also reduced Ca2+entry. TRPC3 silencing diminished the entry by 45%, while the double STIM1/TRPC3 invalidation reduced Ca2+entry by more than 85%. Hence, in EA.hy926 cells, TG-induced Ca2+entry results from the activation of the STIM1/Orai1 machinery, and from the activation of TRPC3.
© 2010 Elsevier Ltd. All rights reserved.
1. Introduction
Store-operated Ca2+entry (SOCE) is a ubiquitous mechanism of regulated Ca2+influx, which is getting activated upon Ca2+store depletion[1]. By contributing to cytosolic Ca2+elevation and to the replenishment of the ER Ca2+ compartment[2,3], SOCE is a key regulator of many Ca2+dependent physiological processes[4].
Under physiological conditions, SOCE is induced by the activa- tion of cell surface receptors coupled to e.g. phospholipase C (PLC) that leads to the generation of inositol 1,4,5-trisphophate (IP3), and the release of Ca2+from the endoplasmic reticulum (ER)[5].
The extent to which SOCE is engaged during agonist stimulation might greatly vary depending on the level of ER Ca2+ depletion [6,7]. Experimentally, SOCE is frequently stimulated by blocking the sarco-endoplasmic reticulum Ca2+-ATPases (SERCA), with drugs
Abbreviations: SOCE, store-operated Ca2+ entry; IP3, inositol 1,4,5- trisphosphate; ER, endoplasmatic reticulum; SERCA, sarco-endoplasmic reticulum Ca2+ATPase; TG, thapsigargin; PKC, protein kinase C; DAG, diacylglycerol; PLC, phospholipase C; TRPC, canonical transient receptor potential.
∗Corresponding author. Tel.: +41 22 379 5198; fax: +41 22 379 5338.
E-mail address:[email protected](M. Frieden).
like thapsigargin (TG) that passively deplete the ER. During the last 20 years, the family of TRPC (canonical transient receptor poten- tial) channels has been proposed as candidates for SOCE. Number of reports has shown a reduced SOCE activity when TRPC expres- sion was knocked down or knocked out[8–11]. When exogenously expressed some TRPC channels displayed SOCE activity[12–14].
However, numerous studies also demonstrated that TRPC channels did not operate as SOCE channels, but rather are gated by sec- ond messengers like Ca2+or diacylglycerol (DAG;[15–17]). Hence, the involvement of TRPC channels in the SOCE mechanism is a controversial issue, and appears to dependent on the cell types investigated, and importantly on the expression level of the TRPC [14,18,19].
More recently, two major SOCE components have been iden- tified: the Stromal Interacting Molecule 1 (STIM1) [20–22]
predominantly located in the ER membrane and that senses the luminal Ca2+concentration, and the Ca2+channel Orai1 (also known as CRACM;[23–25]). Upon Ca2+store depletion, STIM1 oligomer- izes, translocates close to the plasma membrane and aggregates into punctate structures[2,21,26]. The interaction between STIM1 and Orai1 leads to channel opening and Ca2+entry[23,25,27]. An additional level of complexity emerged as several recent reports showed that STIM1 binds to TRPC1, TRPC4 and TRPC5 [28]and indirectly regulates TRPC3 and TRPC6 [29]. Furthermore, it was 0143-4160/$ – see front matter© 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.ceca.2010.12.001
Table 1
Sequences of siRNA and primers used for the real time RT-PCR (all sequences are oriented 5–3).
Sense Antisense From
siRNA
STIM1 GGCUCUGGAUACAGUGCUCtt GAGCACUGUAUCCAGAGCCtt Ambion
Orai1 CGUGCACAAUCUCAACUCGtt CGAGUUGAGAUUGUGCACGtt Ambion
TRPC1 CGGACUUCUAAAUAUGCUAtt UAGCAUAUUUAGAAGUCCGAAtt Oiagen
TRPC3 GCAGCAGCUCUUGACGAUCUGGUAU AUACCAGAUCGUCAAGAGCUGCUGC Invitrogen
TRPC4 UGUCUAUGUUGGAGAUGCUCUAUUA UAAUAGAGCAUCUCCAACAUAGACA Invitrogen
TRPC5 CCCAAGUCAUUUCUAUACCUUGGUA UACCAAGGUAUAGAAAUGACUUGGG Invitrogen
TRPC6 CCCAAGGAAUAUUUGUUUGAGUUGU ACAACUCAAACAAAUAUUCCUUGGG Invitrogen
PKC CCAGAUUUGUGGCUUAUAAtt UUAUAAGCCACAAAUCUGGtt Qiagen
PKC␦ GCCGGGACACUAUAUUCCAtt UGGAAUAUAGUGUCCCGGCUtt Ambion
PCR primers
STIM1 TGACAGGGACTGTGCTGAAG AAGAGAGGAGGCCCAAAGAG Invitrogen
Orai1 GCTCATGATCAGCACCTGCAC GGGACTCCTTGACCGAGTTG Invitrogen
TRPC1 GAGGTGATGGCGCTGAAGG GCACGCCAGCAAGAAAAGC Invitrogen
TRPC3 CTGGCTCTGCTTGTGTTCAATG AGTCAGTAACTGTGATATTGGATATTG Invitrogen
TRPC4 TCAGCACATCGACAGGTCAGAC CCACGGTAATATCATCCACTCGAC Invitrogen
TRPC5 CTCTGATTGCGGAAGCCTCT GCAACGAACTTAAAATGTTGGATATTG Invitrogen
TRPC6 AAGTATAAGGAGCTCAGAAATTTCCAT TCTGATATTGTCTTGGAGGATTATTGA Invitrogen
GusB CCACCAGGGACCATCCAAT AGTCAAAATATGTGTTCTGGACAAAGTAA Invitrogen
TBP GCCCGAAACGCCGAATATA CGTGGCTCTCTTATCCTCATGA Invitrogen
GAPDH GCACAAGAGGAAGAGAGAGACC AGGGGAGATTCAGTGTGGTG Invitrogen
EE-EF1 AGCAAAAATGACCCACCAATG GGCCTGGATGGTTCAGGATA Invitrogen
reported that Orai1 and TRPC proteins form complexes together with STIM1 that participate to Ca2+entry[30–35].
In endothelial cell lines, several studies have demonstrated that TRPC1[36]and TRPC4[37,38]participate to SOCE. On the contrary, a recent study showed in primary human umbilical vein endothelial cells (HUVECs) that SOCE is mediated almost exclusively by the STIM1/Orai1 machinery[39].
In the current study, we investigated the molecular candidate of SOCE in a human umbilical vein endothelial cell line, the EA.hy926.
To this aim, we evaluated the involvement of STIM1, Orai1 and TRPCs proteins in TG-induced Ca2+entry. We showed that STIM1, Orai1 or TRPC3 invalidation reduced Ca2+entry by about 50%, while the combination of STIM1 and TRPC3 knockdown reduced the entry by 85%. Moreover, indirect evidence is provided that TRPC3 is get- ting activated following a PLC/PKC signaling pathway initiated by the addition of TG.
2. Material and methods 2.1. Materials
DMEM, penicillin and streptomycin were obtained from Invit- rogen. Fetal calf serum (FCS) was from PPA Laboratories (Linz, Austria). Thapsigargin, U73122, U73343, PP1, Src inhibitor-1, stau- rosporine, chelerythrine, rottlerin, PMA and OAG were obtained from Sigma. Acetoxylmethyl ester form of Fura-2 (Fura-2/AM) was from Molecular probes Europe (Leiden, the Netherlamds).
The myristoylated peptide PKCeta was from Calbiochem and GF103209X from Tocris.
2.2. Cell culture and transfection
Experiments were performed on the human umbilical vein endothelial cells derived cell line EA.hy926 at passages > 45. Cells were grown in DMEM containing 15% FCS, 0.5% fungizone, 1%
HAT (5 mM hypoxanthin, 20M aminopterin, 0.8 mM thimidine), 50 units/ml penicillin, 50g/ml streptomycin, and were main- tained at 37◦C in 5% CO2atmosphere.
2.3. siRNA knockdown
EA.hy926 cells were transfected in suspension by incubating 3×105cells in a solution containing 6l of lipofectamine RNAiMax
(Invitrogen) and 100 nM of a specific siRNA (Ambion, Invitro- gen or Qiagen) according to manufacturer protocols (Invitrogen).
Experiments using one gene invalidation (Ca2+imaging, QRT-PCR, Western blot analysis) were performed 48 h post-transfection, while for the double STIM1/TRPC3 knockdown experiments, the siSTIM1 was transfected 24 h before siTRPC3 (72 h and 48 h post- transfection for STIM1 and TRPC3, respectively). Sequences of the different siRNA are summarized inTable 1. The siRNA scramble from Ambion was used as negative control. The siRNA transfec- tion efficiency was approximately 90%, estimated by Block-iT Alexa Fluor Red Fluorescent Oligo (Invitrogen).
2.4. Quantitative real-time PCR
Real-time experiments were performed at the genomics plat- form of the NCCR Frontiers in Genetics (Geneva). For each PCR reaction, 1/20th of the cDNA template was PCR amplified in a 7900HT SDS System using Power SYBR Green PCR master mix (both from Applied Biosystems, Foster City, CA, USA). We obtained raw threshold-cycle (Ct) values using SDS 2.0 software (Applied Biosytems). A mean quantity was calculated from triplicate PCR reactions for each sample, and this quantity was normalized to the average of four endogenous control genes (glucuronidase B, GAPDH, TBP and EE-EF1) as described by[40]. Primers used for the real-time PCR are described inTable 1.
2.5. Cytosolic calcium measurements
For Ca2+imaging, cells were plated on 30 mm glass cover slips.
The changes in cytosolic Ca2+concentration were measured with Fura-2. Cells were loaded with 2M Fura-2/AM plus 1M pluronic acid for 30 min in the dark at room temperature in a medium con- taining (in mM): 135 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 10 Hepes acid, 2.6 NaHCO3, 0.44 KH2PO4, 10 glucose with 0.1% vitamins and 0.2%
amino acids, pH adjusted to 7.45 with NaOH. Cells were washed twice and equilibrated for 10–15 min in the same buffer to allow de-esterification. Ratiometric images of Ca2+signals were obtained using a microscope (Axio Observer, Zeiss) equipped with a Lambda GD4 illumination system (Sutter Instrument Company, Novato, CA, USA), which rapidly changed the excitation wavelengths between 340 nm (340AF15; Omega Optical) and 380 nm (380AF15; Omega Optical). Emission was collected through a 415DCLP dichroic mir-
F. Antigny et al. / Cell Calcium49 (2011) 115–127 117
Fig. 1.Effect of STIM1 and Orai1 knockdown on TG-induced Ca2+entry. (A) Cytoplasmic Ca2+was assessed on EA.hy926 cells loaded with 2M Fura-2. SOCE was triggered by depletion of the stores with 1M thapsigargin (TG) in the absence of external Ca2+(1 mM EGTA). 2 mM Ca2+was then re-added to the extracellular medium as indicated.
The control experiment without stimulation, showed a minimal Ca2+entry. (B) Cells were transiently transfected with control siRNA (scramble, siControl), or siRNA against STIM1 or Orai1. Each trace represents the Ca2+entry phase following store depletion, and is the mean of a representative coverslip. (C) Quantification of the effects of siSTIM1, siOrai1 and siSTIM1/Orai1 on the initial slope of ratio increases, after Ca2+re-addition. Bars are mean±SEM. The number of cells is written on the bar graph.
ror, and a 510WB40 filter (Omega Optical), by a cooled, 12-bit CCD camera (CoolSnap HQ, Ropper Scientific, Trenton, NJ, USA). Image acquisition and analysis were performed with the Metafluor 6.3 software (Universal Imaging, West Chester, PA, USA). Experiments
were performed at room temperature in Hepes-buffered solution containing (in mM): 135 NaCl, 5 KCl, 1 MgCl2, 2 CaCl2, 10 Hepes, 10 glucose, pH adjusted at 7.45 with NaOH. The Ca2+-free solution contained 1 mM EGTA instead of 2 mM CaCl2. Due to the high trans-
Fig. 2.Effect of STIM1 and Orai1 knockdown on mRNA and protein levels. (A) C mRNA levels were assessed by quantitative RT-PCR 48 h after transfection with siSTIM1 (A) or siOrai1 (C) (mean±SEM,n= 3 or 4 independent experiments). (B and D, left panels) Western blots showing the decrease of the STIM1 or Orai1 bands 48 h after the transfection with siSTIM1 (B) or siOrai1 (D).␣-Tubulin was used as a loading control. Right panels: quantification of Western blots from 4 to 5 different experiments.
fection efficiency, cytosolic Ca2+measurements were performed on the whole cell population.
2.6. Western blots
Western blots were performed as previously described[41].
Briefly, the endothelial cells were lysed using modified NP40 cell lysis buffer (Invitrogen), 50 mM Tris pH 7.4, 250 mM NaCl, 5 mM EDTA, 50 mM NaF, 1 mM Na3VO4and 1% Nonidet P40.
Total proteins were separated on SDS-PAGE and transferred to nitrocellulose membranes. Membranes were incubated in T-TBS (0.1% Tween 20, 20 mM Tris–HCl, pH 7.5, 137 mM NaCl) and 5% non- fat milk. Blots were incubated with the primary antibodies diluted in T-TBS and nonfat milk as follows: rabbit polyclonal anti-STIM1 antibody (1:1000; Sigma), rabbit polyclonal anti-Orai1 antibody (1:1000; Sigma), rabbit polyclonal anti-PKCeta antibody (1:700;
Santa Cruz Biotechnology), rabbit polyclonal anti-TRPC3 antibody (1:1000; Sigma) and mouse monoclonal antibody against ␣- tubulin (clone DM1A, Sigma) 1:10,000. Blots were incubated with horseradish peroxydase (HRP)-conjugated goat anti-mouse diluted 1:10,000 (BioRad) or with HRP-conjugated goat anti-rabbit diluted 1:10,000 (BioRad), respectively. Antibodies were revealed using ECl reagents and hyperfilm ECL (Amersham Biosciences). Image-J Software was used to quantify the level of protein expression.
2.7. Statistics
Results are expressed as mean±SEM of individual cells. Sets of data were compared with a Student’sttest. Differences were considered statistically significant whenP< 0.05. ns: non signifi- cant difference, *P< 0.05, **P< 0.01, ***P< 0.001. All statistical tests were performed using GraphPad Prism version 5.0 for Windows (Graphpad Software).
3. Results
3.1. STIM1 and Orai1 are involved in store-operated Ca2+influx
To measure the store-operated Ca2+entry (SOCE), the cells were stimulated with 1M thapsigargin (TG) in the absence of external Ca2+, and 2 mM Ca2+was re-added to the extracellular medium to elicit Ca2+entry (Fig. 1A). Only a very small response was detected in the absence of TG stimulation (Fig. 1A). To compare Ca2+influx between different conditions, we measured the initial slope of flu- orescence increase (Fig. 1C).
First, we investigated the role of STIM1 and Orai1 proteins on SOCE, by transiently transfecting the EA.hy926 cells with the respective siRNA designed against STIM1 and Orai1. The basal Ca2+
entry, in the absence of TG stimulation, was not different between
F. Antigny et al. / Cell Calcium49 (2011) 115–127 119
Fig. 3.Role of phospholipase C in TG-induced Ca2+entry. (A) EA.hy926 cells were loaded with Fura-2 to monitor cytosolic Ca2+changes. The Ca2+entry phase is depicted and each trace is the mean of a representative coverslip. Cells were transiently transfected either with control siRNA or with siSTIM1. The PLC blocker U73122 (2M) or the inactive analog U73343 (5M) was added 5 min before TG stimulation. (B) The bar graphs show aggregate data of the effect of U73122 and U73343 on the initial slope of ratio increase on STIM1, Orai1 and STIM1/Orai1 silenced cells (nranges from 41 to 335 cells). The bars representing the control experiments (for control, siSTIM1, siOrai1 and siSTIM1/Orai1) are the same as presented inFig. 1.
control cells, and cells invalidated for STIM1 or Orai1 (data not shown). The addition of TG in Ca2+-free medium elicited similar responses in control and STIM1 or Orai1 knockdown cells (data not shown), whereas the response elicited by Ca2+re-addition was inhibited by 60% in STIM1 knockdown cells (Fig. 1B and C). In Orai1 silenced cells, the SOCE was reduced by 43% (Fig. 1B and C). These results confirmed that STIM1 and Orai1 proteins contribute to SOCE in this endothelial cell line.
3.2. Effect of STIM1 and Orai1 knockdown on mRNA level and protein expression
We performed a quantitative RT-PCR to evaluate the extend of gene silencing upon siRNAs transfection. As shown inFig. 2A, STIM1 mRNA level was decreased by 86% in cells transfected with siRNA against STIM1 (n= 4) when compared to cells exposed to scramble siRNA (noted siControl). The amount of STIM1 protein measured by Western blot 48 h after transfection was reduced by 67% in cells treated with siSTIM1 (n= 4; Fig. 2B) confirming the efficiency of STIM1 silencing. Orai1 mRNA levels were decreased by 99% in Orai1 silenced cells (n= 3) (Fig. 2C) when compared
with control cells. The amount of Orai1 protein 48 h after trans- fection was reduced by 81% in cells treated with siOrai1 (n= 5;
Fig. 2D) confirming that Orai1 silencing was highly efficient. In dou- ble (STIM1/Orai1) knockdown cells, the level of STIM1 mRNA was decreased by about 67% and 99% for Orai1 mRNA (n= 2;Fig. S1). The double knockdown (Orai1/STIM1) did not reduce the SOCE more than siRNA against STIM1 alone (Fig. 1C), suggesting that STIM1 is the limiting player in SOCE mechanism. Altogether, these data con- firmed the role played by STIM1/Orai1 machinery in TG-induced Ca2+entry, but suggest also the involvement of other proteins in this process.
3.3. The phospholipase C inhibitor (U73122) blocks the residual Ca2+influx in STIM1 or Orai1 knockdown cells
Several studies have shown that PLC is involved in TG-induced Ca2+entry[42–44]. We thus used the membrane-permeable phos- pholipase C (PLC) inhibitor U73122 to evaluate the implication of PLC in TG-induced Ca2+entry. In control cells, a 5 min preincu- bation (before TG stimulation) with 2M U73122 resulted in a reduction of the Ca2+influx by 20% (Fig. 3B). In STIM1 silenced
Fig. 4.Role of protein kinase C (PKC) in TG-induced Ca2+entry. (A) Cells were transiently transfected with siSTIM1 or control siRNA. The PKC inhibitor staurosporine was added 2 min before TG stimulation. The Ca2+entry phase is depicted and each trace is the mean of a representative coverslip. (B) Statistic evaluation of the effect of staurosporine and chelerythrine on TG-induced Ca2+influx in control and STIM1 silenced cells (nranges from 36 to 335 cells). (C) The addition of 1M PMA or 100M OAG, 5 min before TG, restored the Ca2+entry in cells treated with the PLC inhibitor U73122. Bar graphs are the quantification of the effect of PMA and OAG on the initial slope of ratio increase, after Ca2+re-addition (nranges from 41 to 335 cells). The bars of panel B and C, representing the control experiments (for control, siSTIM1, siOrai1 and siSTIM1/Orai1) are the same as presented inFig. 1.
cells, the U73122 pretreatment completely prevented the residual Ca2+influx (Fig. 3A and B). The remaining Ca2+influx in Orai1 and Orai1/STIM1 knockdown cells was also completely abolished after PLC inhibition (Fig. 3B). On the contrary, the inactive analog U73343 (5M) did not affect the Ca2+influx activated by TG (Fig. 3). Neither
U73122 nor U73343 had an effect on the ability of TG to release cal- cium from the stores (data not shown). Interestingly, the addition of 2M U73122 just prior the Ca2+ re-addition phase or during the Ca2+re-addition phase did not prevent Ca2+influx (Fig. S2).
This suggests that this compound does not act as a direct channel
F. Antigny et al. / Cell Calcium49 (2011) 115–127 121
Fig. 5.Inhibition or invalidation of PKCreduced TG-induced Ca2+entry. (A) The myristoylated peptide MPI-PKCwas preincubated 30 min before TG stimulation. The bar graphs represent the slope of ratio increase following Ca2+re-addition (nranges from 65 to 130 cells). (B) Statistical evaluation of the effect of siRNA against PKCon TG-induced Ca2+entry. The bars represent the slope of the ratio increase after Ca2+re-addition (nranges from 72 to 130 cells). (C, left panel) Western blot showing the decrease expression level of STIM1 and PKC, 48 h after transfection, either alone or in combination.␣-Tubulin was used as a loading control. Right panel: quantification of the Western blot, showing also the combination of siOrai1 with siPKCfrom 2 to 4 different experiments.
blocker, and that PLC is essential for the activation but not for the maintenance of SOCE activity.
3.4. The protein kinase C (PKC) pathway is involved in TG-induced Ca2+
The activation of PLC induces the cleavage of phosphatidyli- nositol 4,5-bisphosphate into 1,2-diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3)[5]. In turn, DAG is an activator of the
“classical” and “novel” PKC isoforms[45]. To investigate the poten- tial involvement of PKC in endothelial SOCE, we first used two types of PKC inhibitors: chelerythrine (a widely generic inhibitor of PKC)[46,47]and staurosporine[48,49]. Each inhibitor was added 2 min before TG stimulation, in control and STIM1 knockdown cells.
In control cells chelerythrine and staurosporine reduced the Ca2+
influx by about 45% (Fig. 4B), while in STIM1 knockdown cells, the Ca2+influx was inhibited by 70% for staurosporine (Fig. 4A and B) and by 90% for chelerythrine (Fig. 4B). The same inhibitory effect of PKC blockers was observed in Orai1 and Orai1/STIM1 silenced cells (data not shown). Like for the PLC inhibitor U73122, the PKC blockers had no effect on Ca2+influx when they were added before or during the Ca2+re-addition phase (Fig. S3), suggesting that these compounds did not act as direct channel blockers. In order to fur- ther support our hypothesis that the PLC/PKC pathways is involved in TG-induced Ca2+entry, we performed rescue experiments on
cells treated with the PLC inhibitor U73122. In this condition, the addition of either the PKC activator PMA (phorbol myristate acetate 1M), or the membrane-permeable DAG analog OAG (1-oleoyl-2- acetyl-sn-glycerol 100M) restored the Ca2+entry in control cells and STIM1 or Orai1 knockdown cells (Fig. 4C). These data suggest that the PLC metabolite DAG activates the PKC, limiting the possi- ble PKC isoforms engaged in the Ca2+entry as those that belong to the “classical” (activated by Ca2+and DAG) or “novel” family (acti- vated by DAG but nor by Ca2+). On EA.hy926 cells, the PKC␣and PKC, from the “classical” family, as well as the PKC␦, PKCand PKCfrom the “novel” family are present[50]. Thus we applied inhibitors directed against different isoforms of PKC. GF103209X that preferentially blocks the PKC␣/did not reduced Ca2+entry (Fig. S4A). On the contrary, rottlerin (Fig. S4B) and the myristoy- lated peptide MPI-PKC(Fig. 5A), which inhibit PKC␦and PKC, respectively, reduced by more than 50% TG-induced Ca2+entry, both in control cells, and in cells invalidated for STIM1 or Orai1. To confirm these data, we transiently transfected the cells with siRNA directed against these two PKCs isoforms. The invalidation of the PKC␦reduced by about 15% the Ca2+entry in control cells, but did not affect Ca2+entry in STIM1 or Orai1 invalidated cells (Fig. S5A).
On the contrary, the knockdown of PKCreduced TG-induced Ca2+
entry by 20% in control cells, and by about 40% in STIM1 and Orai1 invalidated cells (Fig. 5B). To measure the efficiency of gene silenc- ing, we performed Western blots 48 h after transfection. The siRNA
Fig. 6.Effect of TRPCs knockdown on TG-induced Ca2+entry. (A) EA.hy926 cells were loaded with 2M Fura-2 to monitor cytosolic Ca2+changes. Traces are the mean of a representative coverslip showing the Ca2+entry phase. Cells were transiently transfected with control siRNA or siRNA against TRPC3. (B) Quantification of the effects of siTRPC1, siTRPC3, siTRPC4, siTRPC5 and siTRPC6 expressed as percent of the initial slope of ratio increase compared to control cells. Bars are mean±SEM (nranges from 50 to 335 cells). (C) mRNA levels were assessed by quantitative RT-PCR 48 h after transfection (mean±SEM, 2–4 independent experiments). For each TRPC invalidation, the control was set to 1, and the mRNA level of each TRPC was expressed as compared to its own control. (D, left panel) Western blot showing the disappearance of the TRPC3 bands 48 h after the transfection with siTRPC3.␣-Tubulin was used as a loading control. Right panel: quantification of Western blots from 4 different experiments.
F. Antigny et al. / Cell Calcium49 (2011) 115–127 123
Fig. 7.Effect of STIM1 and TRPC3 knockdown on TG-induced Ca2+entry. (A) EA.hy926 cells were loaded with 2M Fura-2 to monitor cytosolic Ca2+changes. Traces are the mean of a representative coverslip showing the Ca2+entry phase. Cells were transiently transfected with control siRNA, siRNA against STIM1, or siRNA against STIM1 together with siRNA against TRPC3; siSTIM1 was transfected 24 h before siTRPC3 (72 h and 48 h after transfection for STIM1 and TRPC3, respectively). (B) The bars represent the slope of the ratio increase after Ca2+re-addition in siControl, siSTIM1 and siSTIM1/siTRPC3 silenced cells. Bars are mean±SEM (nranges from 46 to 190 cells). (C) Western blots showing the disappearance of the STIM1 protein and the TRPC3 protein expression after the transfection with siSTIM1/siTRPC3.␣-Tubulin was used as a loading control. (D) Quantification of Western blots from 2 different experiments.
against PKCwas efficient in reducing protein levels, both on single transfection, and in combination with STIM1 and Orai1 silencing.
The same efficiency on protein levels was obtained with the siRNA against PKC␦(Fig. S5B), suggesting that PKC␦is not essential for TG-induced Ca2+entry.
3.5. Involvement of canonical transient receptor potential in TG-induced Ca2+entry
We next tested the involvement of TRPC in TG-induced Ca2+
entry. To this aim, we designed siRNA against each of the five iso- forms expressed in this endothelial cells line (TRPC1, TRPC3, TRPC4, TRPC5 and TRPC6). Interestingly, only TRPC3 appear to be involved in TG-induced Ca2+entry, as shown by the reduction of the initial slope of Ca2+influx by 45% (Fig. 6A and B). The efficiency of each siRNA in silencing its messenger RNA was verified by quantitative RT-PCR, and the mRNA levels were reduced between 50% and 90%
(Fig. 6C). At the protein level, TRPC3 was decreased by around 70%
(Fig. 6D). We confirmed this result by using two other siRNA against TRPC3, which gave similar reduction of the Ca2+entry (Fig. S6A).
The combination of siRNA against STIM1 and TRPC3 reduced Ca2+
entry by 85% (Fig. 7A and B). In these conditions, the efficiency of TRPC3 and STIM1 invalidation was between 70 and 85% at the pro- tein level (Fig. 7C and D). These data confirmed the involvement of STIM1 and TRPC3 protein in TG-induced Ca2+influx in endothelial cells.
3.6. Effect of PLC, PKC or Src inhibitors on TRPC3 knockdown cells
To explore the putative target of the PKC pathway, we tested the PLC and PKC inhibitors on TRPC3 knockdown cells. U73122 reduced by about 12%, and chelerytrine by 25% TG-induced entry (Fig. S6B). Staurosporine on the other hand did not inhibit Ca2+
entry in TRPC3 knockdown cells (Fig. S6B), and neither OAG nor PMA rescued the Ca2+ entry after U73122 treatment in siTRPC3 treated cells (Fig. S6C). The MPI-PKCreduced by about 25% the slope of Ca2+influx, while the siRNA against PKCdid not reduce, and even paradoxically increased the entry (Fig. 8A). The absence (staurosporine, siPKC) or small inhibitory effect (U73122, chel- erythrine, MPI-PKC) of the PLC/PKC pathway inhibitors on TRPC3 knockdown cells, suggested that TRPC3 is likely the target of the pathway engaged upon TG stimulation. The non-receptor tyrosine
Fig. 8.Effect of PKCand Src inhibition on TG-induced Ca2+entry. (A) Statistical evaluation of the effect on TG-induced Ca2+entry, of MPI-PKCand siPKC. The bar graphs represent the initial slope of the ratio increase following Ca2+re-addition (nranges from 37 to 130 cells). (B) Effect of two Src inhibitors, PP1 and Src inhibitor-1 (Src1) on TG-induced Ca2+entry. The Src inhibitors were incubated 30 min before TG stimulation. Experiments were performed in STIM1, Orai1 or TRPC3 invalidated cells. Bars are mean±SEM of the initial slope following Ca2+re-addition (nranges from 24 to 141 cells). The bars representing the control experiments (for control, siSTIM1, siOrai1) are the same as presented inFig. 5.
kinase Src was shown to be essential for TRPC3 activation[51]. We thus tried two different Src inhibitors, PP1 and Src inhibitor-1 on TG-induced Ca2+entry. As shown inFig. 8B, Src inhibition reduced Ca2+entry in STIM1 and Orai1 silenced cells, but not in TRPC3 inval- idated cells, confirming again TRPC3 as a probable target of the PLC/PKC signaling pathway.
4. Discussion
In the present work, we studied the molecular identity and the mechanism of TG-induced Ca2+ entry in human umbilical vein endothelial cell line, the EA.hy926. By siRNA approach, we assessed the involvement of STIM1, Orai1 and TRPCs proteins in this process. We showed that TG-induced Ca2+entry is partially medi- ated by STIM1 and Orai1, and partially by TRPC3, and the double STIM1/TRPC3 invalidation reduced the entry by 85%. Interestingly, the residual STIM1/Orai1-independent Ca2+entry is fully abolished following inhibition of PLC and/or PKC, while the residual TRPC3- independent entry is almost not affected by PLC or PKC inhibition.
These data strongly suggested that PLC is getting activated upon TG stimulation, and that the downstream signaling pathway, involving
PKC and TRPC3, account for a large part in TG-induced Ca2+entry in endothelial cells.
Since 2005 and the discovery of the major role played by STIM1 and Orai1 proteins in SOCE, the function of TRPCs isoforms in this mechanism remained to be firmly established. In this study, we confirm that STIM1 and Orai1 are important players of SOCE, as invalidation of these proteins reduced the Ca2+entry by 45% (Orai1) to 65% (STIM1). Interestingly, even though the silencing efficiency was of between 65 and 80% at the protein level, an important resid- ual Ca2+entry persisted upon store depletion. Such a “partial” SOCE reduction was already observed, for instance in smooth muscle cells [52–54]or HEK cells[20], but in most cell types, the inhibition of SOCE upon STIM1 invalidation is very pronounced[3,39,55,56]. This finding prompted us to investigate the mechanism of the residual TG-induced Ca2+entry.
Several studies have reported a reduction of SOCE following inhibition of the PLC by U73122[42], or after PLC␥knockdown [43,44]. In our hands, U73122 reduced by only 20% the SOCE in con- trol cells, while in STIM1 and/or Orai1 knockdown cells, the Ca2+
entry was completely abolished. To investigate whether the down- stream products of PLC activation might affect Ca2+entry after TG
F. Antigny et al. / Cell Calcium49 (2011) 115–127 125
stimulation, we used two PKC inhibitors, staurosporine and chel- erythrine. Both compounds reduced by about 45% TG-induced Ca2+
entry in control cells, and completely inhibited Ca2+entry in STIM1 and/or Orai1 knockdown cells. The involvement of PKC was further confirmed by using PMA to directly activate PKC on cells treated with the PLC blocker. This treatment restored the Ca2+influx to levels achieved without blocking the PLC, both in control cells, and in cells invalidated for STIM1 or Orai1. Additionally, the DAG analog OAG also restored Ca2+entry upon PLC inhibition. It thus appears that the lipase activity of PLC is required for TG-induced Ca2+entry, in particular through the production of DAG that activates the PKC.
In previous studies reporting the importance of PLC for SOCE, it was shown that either the lipase activity of the enzyme was not required [44], or the production of DAG was not important[42,43]. On the contrary, in our cellular system, the generation of DAG seems to be essential for TG-induced Ca2+entry. Next, we wanted to deter- mine which isoform of the PKC was involved in the Ca2+entry. The PKC family consists of ten isozymes[57]. Based on their mecha- nism of activation, the PKC are divided into three subfamilies, the
“conventional” (or “classical”), the “novel”, and the “atypical” PKC.
“Conventional” PKCs contain the isoforms␣,I,II, and␥. They require Ca2+, DAG, and phospholipids such as phosphatidylserine for their activation. “Novel” PKCs include the␦,,, andisoforms require DAG, but not Ca2+to be activated. Thus, “conventional” and
“novel” PKCs are activated downstream of the PLC signal trans- duction pathway. The “atypical” PKCs (including protein kinase M and/isoforms) neither require Ca2+nor diacylglycerol for their activation.
GF103209X, an inhibitor of the classical PKC had no inhibitory effect on Ca2+ entry. On the contrary, rottlerin and MPI-PKC that inhibit PKC␦and PKC, respectively, markedly prevented TG- induced Ca2+entry. Caution had to be taken by using PKC inhibitors, in particular rottlerin that was shown to have serious side effects [58]. We thus used siRNA against PKC␦and PKCto confirm our data. While the knockdown of PKC␦did not inhibit Ca2+ entry, the invalidation of PKCnegatively impacted on TG-induced Ca2+
entry, both in control and STIM1 and Orai1 silenced cells. Alto- gether, these results strongly point to a role played by the “novel”
PKC family (likely PKC), in TG-induced Ca2+entry.
The inhibitory effect of PLC and PKC blockers was observed in control cells, but also in cells invalidated for STIM1 or Orai1.
Hence, it is unlikely that STIM1/Orai1 proteins are the target(s) of PKC, even though we could not completely rule this out, as the silencing of these two proteins was not complete. We thus inves- tigated what other proteins could be implicated in TG-induced Ca2+ entry, focusing on the TRPC channel family and found out that only TRPC3 invalidation reduced the Ca2+entry. The double STIM1/TRPC3 invalidation almost completely prevented Ca2+entry, strongly suggesting that TG-induced Ca2+entry in endothelial cells was constituted by the STIM1/Orai1 machinery for one part, and for the other part by TRPC3. Interestingly however, when TRPC3 was knocked-down, the efficiency of PLC of PKC inhibition was much less pronounced, with an absence of significant inhibition using staurosporine or siPKC, and a modest reduction of the Ca2+
entry of about 15–20%, upon U73122, chelerythrine and MPI-PKC application. In addition, when TRPC3 was down-regulated, neither OAG nor PMA potentiate the Ca2+ entry. We thus propose that TRPC3 channel is likely a target of the PLC/PKC pathway activa- tion. PKC was shown to phosphorylate TRPC3 on Ser 712, resulting in channel inhibition[59,60], whereas in our study PKC inhibition decreased Ca2+entry. Hence, in our cellular system, it is unlikely that PKC directly phosphorylates TRPC3. PKC might phosphorylate an intermediate protein that in turn positively regulates the activ- ity of TRPC3. It was shown that the non-receptor tyrosine kinase Src is essential for TRPC3 activation[51], by phosphorylating the channel on a tyrosine at position 444[61]. Using two different Src
inhibitors, we showed that both reduced Ca2+entry in STIM1 and Orai1 knockdown cells, while not in TRPC3 invalidated cells. This result suggests that TRPC3 is the target of phosphorylation by Src.
We can reasonably postulate that Src is getting activated indirectly by PKC, as it was reported in smooth muscle cells[62]. The precise mechanism between PKC activation and TRPC3 opening remains however to be firmly established, but our data suggested that Src is, at least partially, involved in this process. Considering that the inhibition of the Ca2+entry varied between about 40 and 60% upon src inhibition or siRNA treatment against PKC, it is possible that for a part, TRPC3 is also getting directly activated by DAG, like it was already reported[15,63,64]. This point, however, remains to be further investigated.
Moreover, recent papers showed that STIM1 directly or indi- rectly binds to all TRPC (except TRPC7) and activated them[28,29].
Orai1 was also shown to be associated with the complex formed by STIM1 and TRPC. Hence, the idea emerged that the function of TRPC channels might well depend on their association or not with the STIM/Orai molecules[30–35]. Our experimental evidence sug- gested that TRPC3 function independently from STIM/Orai and that its activity is not linked to the Ca2+content of the store.
In summary, we showed that in EA.hy926 cells, the influx elicited upon TG application has two components, one being the
“classical” STIM1 and Orai1 machinery, and the other one that com- prises TRPC3 being activated by a rather unusual mechanism: TG stimulation leads to PLC activation and the production of DAG that in turns activates a “novel” PKC (likely PKC). This presumably results in an activation of Src that phosphorylates TRPC3 leading to Ca2+entry. This chain of event is unexpected following TG stimula- tion, even though PLC was already reported to be involved in SOCE.
While we can certainly call the STIM1/Orai1-dependent Ca2+entry SOCE, the machinery involving PLC/PKC/Src/TRPC3 is not necessar- ily store-operated. Indeed, we do not know whether the depletion of the ER per se leads to PLC activation, or whether the conse- quence of the depletion, for instance the cytosolic Ca2+elevation, is responsible for this activation. In any instance, in EA.hy926 cells, TG stimulation engaged more molecules than STIM1 and Orai1, and surprisingly activated a Ca2+signaling pathway usually triggered by agonist stimulation.
Conflict of interest
There is no conflict of interest
Acknowledgements
We thank Cyril Castelbou for his excellent technical assis- tance, and Dr. C.J.S. Edgell for the EA.hy926 cells. We thank Dr.
Michelangelo Foti for the PKC antibodies, and Drs. R. Malli, W.
F. Graier, C. Vandebrouck and N. Demaurex for critically reading the manuscript. This work was supported by the Swiss National Science Foundation, Grant 310000-120186/1, and the foundation Carlos and Elsie de Reuter.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in the online version, atdoi:10.1016/j.ceca.2010.12.001.
References
[1] J.W. Putney Jr., A model for receptor-regulated calcium entry, Cell Calcium 7 (1986) 1–12.
[2] R. Malli, M. Frieden, M. Hunkova, M. Trenker, W.F. Graier, Ca2+ refilling of the endoplasmic reticulum is largely preserved albeit reduced Ca2+ entry in endothelial cells, Cell Calcium 41 (2007) 63–76.
[3] H. Jousset, M. Frieden, N. Demaurex, STIM1 knockdown reveals that store- operated Ca2+ channels located close to sarco/endoplasmic Ca2+ ATPases (SERCA) pumps silently refill the endoplasmic reticulum, J. Biol. Chem. 282 (2007) 11456–11464.
[4] A.B. Parekh, J.W. Putney Jr., Store-operated calcium channels, Physiol. Rev. 85 (2005) 757–810.
[5] M.J. Berridge, Cell signalling. A tale of two messengers, Nature 365 (1993) 388–389.
[6] H. Jousset, R. Malli, N. Girardin, W.F. Graier, N. Demaurex, M. Frieden, Evi- dence for a receptor-activated Ca2+ entry pathway independent from Ca2+
store depletion in endothelial cells, Cell Calcium 43 (2008) 83–94.
[7] N.C. Girardin, F. Antigny, M. Frieden, Electrophysiological characterization of store-operated and agonist-induced Ca2+ entry pathways in endothelial cells, Pflugers Arch. 460 (2010) 109–120.
[8] X. Liu, K.T. Cheng, B.C. Bandyopadhyay, B. Pani, A. Dietrich, B.C. Paria, W.D.
Swaim, D. Beech, E. Yildrim, B.B. Singh, L. Birnbaumer, I.S. Ambudkar, Attenu- ation of store-operated Ca2+ current impairs salivary gland fluid secretion in TRPC1(−/−) mice, Proc. Natl. Acad. Sci. U.S.A. 104 (2007) 17542–17547.
[9] T.K. Zagranichnaya, X. Wu, M.L. Villereal, Endogenous TRPC1, TRPC3, and TRPC7 proteins combine to form native store-operated channels in HEK-293 cells, J.
Biol. Chem. 280 (2005) 29559–29569.
[10] M Louis, N. Zanou, M. Van Schoor, P. Gailly, TRPC1 regulates skeletal myoblast migration and differentiation, J. Cell Sci. 121 (2008) 3951–3959.
[11] M.S. Kim, J.H. Hong, Q. Li, D.M. Shin, J. Abramowitz, L. Birnbaumer, S. Muallem, Deletion of TRPC3 in mice reduces store-operated Ca2+ influx and the severity of acute pancreatitis, Gastroenterology 137 (2009) 1509–1517.
[12] X. Liu, W. Wang, B.B. Singh, T. Lockwich, J. Jadlowiec, B. O’Connell, R. Well- ner, M.X. Zhu, I.S. Ambudkar, Trp1, a candidate protein for the store-operated Ca(2+) influx mechanism in salivary gland cells, J. Biol. Chem. 275 (2000) 3403–
3411.
[13] G Vazquez, J.P. Lievremont, J.B.G. St, J.W. Putney Jr., Human Trp3 forms both inositol trisphosphate receptor-dependent and receptor-independent store- operated cation channels in DT40 avian B lymphocytes, Proc. Natl. Acad. Sci.
U.S.A. 98 (2001) 11777–11782.
[14] J.P. Lievremont, G.S. Bird, J.W. Putney Jr., Canonical transient receptor potential TRPC7 can function as both a receptor- and store-operated channel in HEK-293 cells, Am. J. Physiol. Cell Physiol. 287 (2004) C1709–1716.
[15] T. Hofmann, A.G. Obukhov, M. Schaefer, C. Harteneck, T. Gudermann, G. Schultz, Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol, Nature 397 (1999) 259–263.
[16] C. Zitt, A.G. Obukhov, C. Strubing, A. Zobel, F. Kalkbrenner, A. Luckhoff, G.
Schultz, Expression of TRPC3 in Chinese hamster ovary cells results in calcium- activated cation currents not related to store depletion, J. Cell Biol. 138 (1997) 1333–1341.
[17] M. Trebak, J.B.G. St, R.R. McKay, L. Birnbaumer, J.W. Putney Jr., Signaling mech- anism for receptor-activated canonical transient receptor potential 3 (TRPC3) channels, J. Biol. Chem. 278 (2003) 16244–16252.
[18] G. Vazquez, B.J. Wedel, M. Trebak, G. St John Bird, J.W. Putney Jr., Expres- sion level of the canonical transient receptor potential 3 (TRPC3) channel determines its mechanism of activation, J. Biol. Chem. 278 (2003) 21649–
21654.
[19] G. Vazquez, G.S. Bird, Y. Mori, J.W. Putney Jr., Native TRPC7 channel activation by an inositol trisphosphate receptor-dependent mechanism, J. Biol. Chem. 281 (2006) 25250–25258.
[20] J. Roos, P.J. DiGregorio, A.V. Yeromin, K. Ohlsen, M. Lioudyno, S. Zhang, O.
Safrina, J.A. Kozak, S.L. Wagner, M.D. Cahalan, G. Velicelebi, K.A. Stauderman, STIM1, an essential and conserved component of store-operated Ca2+ channel function, J. Cell Biol. 169 (2005) 435–445.
[21] J Liou, M.L. Kim, W.D. Heo, J.T. Jones, J.W. Myers, J.E. Ferrell Jr., T. Meyer, STIM is a Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx, Curr.
Biol. 15 (2005) 1235–1241.
[22] S.L. Zhang, Y. Yu, J. Roos, J.A. Kozak, T.J. Deerinck, M.H. Ellisman, K.A. Stauder- man, M.D. Cahalan, STIM1 is a Ca2+ sensor that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane, Nature 437 (2005) 902–905.
[23] S. Feske, M. Prakriya, A. Rao, R.S. Lewis, A severe defect in CRAC Ca2+ chan- nel activation and altered K+ channel gating in T cells from immunodeficient patients, J. Exp. Med. 202 (2005) 651–662.
[24] M. Vig, C. Peinelt, A. Beck, D.L. Koomoa, D. Rabah, M. Koblan-Huberson, S. Kraft, H. Turner, A. Fleig, R. Penner, J.P. Kinet, CRACM1 is a plasma membrane protein essential for store-operated Ca2+ entry, Science 312 (2006) 1220–1223.
[25] A.V. Yeromin, S.L. Zhang, W. Jiang, Y. Yu, O. Safrina, M.D. Cahalan, Molecular identification of the CRAC channel by altered ion selectivity in a mutant of Orai, Nature 443 (2006) 226–229.
[26] M.M. Wu, J. Buchanan, R.M. Luik, R.S. Lewis, Ca2+ store depletion causes STIM1 to accumulate in ER regions closely associated with the plasma membrane, J.
Cell Biol. 174 (2006) 803–813.
[27] R.M. Luik, M.M. Wu, J. Buchanan, R.S. Lewis, The elementary unit of store- operated Ca2+ entry: local activation of CRAC channels by STIM1 at ER-plasma membrane junctions, J. Cell Biol. 174 (2006) 815–825.
[28] G.N. Huang, W. Zeng, J.Y. Kim, J.P. Yuan, L. Han, S. Muallem, P.F. Worley, STIM1 carboxyl-terminus activates native SOC, I(crac) and TRPC1 channels, Nat. Cell Biol. 8 (2006) 1003–1010.
[29] J.P. Yuan, W. Zeng, G.N. Huang, P.F. Worley, S. Muallem, STIM1 heteromultimer- izes TRPC channels to determine their function as store-operated channels, Nat.
Cell Biol. 9 (2007) 636–645.
[30] Y. Liao, C. Erxleben, E. Yildirim, J. Abramowitz, D.L. Armstrong, L. Birnbaumer, Orai proteins interact with TRPC channels and confer responsiveness to store depletion, Proc. Natl. Acad. Sci. U.S.A. 104 (2007) 4682–4687.
[31] Y. Liao, C. Erxleben, J. Abramowitz, V. Flockerzi, M.X. Zhu, D.L. Armstrong, L.
Birnbaumer, Functional interactions among Orai1, TRPCs, and STIM1 suggest a STIM-regulated heteromeric Orai/TRPC model for SOCE/Icrac channels, Proc.
Natl. Acad. Sci. U.S.A. 105 (2008) 2895–2900.
[32] Y Liao, N.W. Plummer, M.D. George, J. Abramowitz, M.X. Zhu, L. Birnbaumer, A role for Orai in TRPC-mediated Ca2+ entry suggests that a TRPC:Orai complex may mediate store and receptor operated Ca2+ entry, Proc. Natl. Acad. Sci. U.S.A.
106 (2009) 3202–3206.
[33] H.L. Ong, K.T. Cheng, X. Liu, B.C. Bandyopadhyay, B.C. Paria, J. Soboloff, B. Pani, Y. Gwack, S. Srikanth, B.B. Singh, D.L. Gill, I.S. Ambudkar, Dynamic assembly of TRPC1–STIM1–Orai1 ternary complex is involved in store-operated calcium influx. Evidence for similarities in store-operated and calcium release-activated calcium channel components, J. Biol. Chem. 282 (2007) 9105–9116.
[34] I. Jardin, J.J. Lopez, G.M. Salido, J.A. Rosado, Orai1 mediates the interaction between STIM1 and hTRPC1 and regulates the mode of activation of hTRPC1- forming Ca2+ channels, J. Biol. Chem. 283 (2008) 25296–25304.
[35] M.S. Kim, W. Zeng, J.P. Yuan, D.M. Shin, P.F. Worley, S. Muallem, Native store- operated Ca2+ influx requires the channel function of Orai1 and TRPC1, J. Biol.
Chem. 284 (2009) 9733–9741.
[36] G.U. Ahmmed, D. Mehta, S. Vogel, M. Holinstat, B.C. Paria, C. Tiruppathi, A.B.
Malik, Protein kinase Calpha phosphorylates the TRPC1 channel and regu- lates store-operated Ca2+ entry in endothelial cells, J. Biol. Chem. 279 (2004) 20941–20949.
[37] M. Freichel, S.H. Suh, A. Pfeifer, U. Schweig, C. Trost, P. Weissgerber, M. Biel, S. Philipp, D. Freise, G. Droogmans, F. Hofmann, V. Flockerzi, B. Nilius, Lack of an endothelial store-operated Ca2+ current impairs agonist-dependent vasore- laxation in TRP4−/−mice, Nat. Cell Biol. 3 (2001) 121–127.
[38] C. Tiruppathi, M. Freichel, S.M. Vogel, B.C. Paria, D. Mehta, V. Flockerzi, A.B.
Malik, Impairment of store-operated Ca2+ entry in TRPC4(−/−) mice inter- feres with increase in lung microvascular permeability, Circ. Res. 91 (2002) 70–76.
[39] I.F. Abdullaev, J.M. Bisaillon, M. Potier, J.C. Gonzalez, R.K. Motiani, M. Tre- bak, Stim1 and Orai1 mediate CRAC currents and store-operated calcium entry important for endothelial cell proliferation, Circ. Res. 103 (2008) 1289–
1299.
[40] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F. Speleman, Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes, Genome Biol. 3 (2002), RESEARCH0034.
[41] S. Konig, V. Hinard, S. Arnaudeau, N. Holzer, G. Potter, C.R. Bader, L. Bernheim, Membrane hyperpolarization triggers myogenin and myocyte enhancer factor- 2 expression during human myoblast differentiation, J. Biol. Chem. 279 (2004) 28187–28196.
[42] L.M. Broad, F.J. Braun, J.P. Lievremont, G.S. Bird, T. Kurosaki, J.W. Putney Jr., Role of the phospholipase C-inositol 1,4,5-trisphosphate pathway in calcium release-activated calcium current and capacitative calcium entry, J. Biol. Chem.
276 (2001) 15945–15952.
[43] C.L. Tu, W. Chang, D.D. Bikle, Phospholipase cgamma1 is required for activation of store-operated channels in human keratinocytes, J. Invest. Dermatol. 124 (2005) 187–197.
[44] T. Litjens, T. Nguyen, J. Castro, E.C. Aromataris, L. Jones, G.J. Barritt, G.Y. Rychkov, Phospholipase C-gamma1 is required for the activation of store-operated Ca2+
channels in liver cells, Biochem. J. 405 (2007) 269–276.
[45] M.G. Kazanietz, L.B. Areces, A. Bahador, H. Mischak, J. Goodnight, J.F. Mushin- ski, P.M. Blumberg, Characterization of ligand and substrate specificity for the calcium-dependent and calcium-independent protein kinase C isozymes, Mol.
Pharmacol. 44 (1993) 298–307.
[46] J.M. Herbert, J.M. Augereau, J. Gleye, J.P. Maffrand, Chelerythrine is a potent and specific inhibitor of protein kinase C, Biochem. Biophys. Res. Commun. 172 (1990) 993–999.
[47] A.E. Eckly-Michel, A. Le Bec, C. Lugnier, Chelerythrine, a protein kinase C inhibitor, interacts with cyclic nucleotide phosphodiesterases, Eur. J. Pharma- col. 324 (1997) 85–88.
[48] C Schachtele, R. Seifert, H. Osswald, Stimulus-dependent inhibition of platelet aggregation by the protein kinase C inhibitors polymyxin B, H-7 and stau- rosporine, Biochem. Biophys. Res. Commun. 151 (1988) 542–547.
[49] S.P. Watson, J. McNally, L.J. Shipman, P.P. Godfrey, The action of the protein kinase C inhibitor, staurosporine, on human platelets. Evidence against a reg- ulatory role for protein kinase C in the formation of inositol trisphosphate by thrombin, Biochem. J. 249 (1988) 345–350.
[50] H. Li, S.A. Oehrlein, T. Wallerath, I. Ihrig-Biedert, P. Wohlfart, T. Ulshofer, T.
Jessen, T. Herget, U. Forstermann, H. Kleinert, Activation of protein kinase C alpha and/or epsilon enhances transcription of the human endothelial nitric oxide synthase gene, Mol. Pharmacol. 53 (1998) 630–637.
[51] G. Vazquez, B.J. Wedel, B.T. Kawasaki, G.S. Bird, J.W. Putney Jr., Obligatory role of Src kinase in the signaling mechanism for TRPC3 cation channels, J. Biol. Chem.
279 (2004) 40521–40528.
[52] M. Potier, J.C. Gonzalez, R.K. Motiani, I.F. Abdullaev, J.M. Bisaillon, H.A. Singer, M. Trebak, Evidence for STIM1- and Orai1-dependent store-operated calcium influx through ICRAC in vascular smooth muscle cells: role in proliferation and migration, FASEB J. 23 (2009) 2425–2437.
[53] W. Lu, J. Wang, G. Peng, L.A. Shimoda, J.T. Sylvester, Knockdown of stromal inter- action molecule 1 attenuates store-operated Ca2+ entry and Ca2+ responses to
F. Antigny et al. / Cell Calcium49 (2011) 115–127 127
acute hypoxia in pulmonary arterial smooth muscle, Am. J. Physiol. Lung Cell Mol. Physiol. 297 (2009) L17–25.
[54] L.C. Ng, D. Ramduny, J.A. Airey, C.A. Singer, P.S. Keller, X.M. Shen, H. Tian, M.L.
Valencik, J.R. Hume, Orai1 interacts with STIM1 and mediates capacitative Ca2+
entry in mouse pulmonary arterial smooth muscle cells, Am. J. Physiol. Cell Physiol. (2010).
[55] B. Darbellay, S. Arnaudeau, S. Konig, H. Jousset, C. Bader, N. Demaurex, L. Bern- heim, STIM1- and Orai1-dependent store-operated calcium entry regulates human myoblast differentiation, J. Biol. Chem. 284 (2009) 5370–5380.
[56] Y. Baba, K. Nishida, Y. Fujii, T. Hirano, M. Hikida, T. Kurosaki, Essential function for the calcium sensor STIM1 in mast cell activation and anaphylactic responses, Nat. Immunol. 9 (2008) 81–88.
[57] H. Mellor, P.J. Parker, The extended protein kinase C superfamily, Biochem. J.
332 (Pt (2)) (1998) 281–292.
[58] S.P. Soltoff, Rottlerin: an inappropriate and ineffective inhibitor of PKCdelta, Trends Pharmacol. Sci. 28 (2007) 453–458.
[59] M. Trebak, N. Hempel, B.J. Wedel, J.T. Smyth, G.S. Bird, J.W. Putney Jr., Negative regulation of TRPC3 channels by protein kinase C-mediated phosphorylation of serine 712, Mol. Pharmacol. 67 (2005) 558–563.
[60] H.Y. Kwan, Y. Huang, X. Yao, Protein kinase C can inhibit TRPC3 channels indirectly via stimulating protein kinase G, J. Cell Physiol. 207 (2006) 315–
321.
[61] B.T. Kawasaki, Y. Liao, L. Birnbaumer, Role of Src in C3 transient receptor poten- tial channel function and evidence for a heterogeneous makeup of receptor- and store-operated Ca2+ entry channels, Proc. Natl. Acad. Sci. U.S.A. 103 (2006) 335–340.
[62] D.T. Brandt, A. Goerke, M. Heuer, M. Gimona, M. Leitges, E. Kremmer, R. Lam- mers, H. Haller, H. Mischak, Protein kinase C delta induces Src kinase activity via activation of the protein tyrosine phosphatase PTP alpha, J. Biol. Chem. 278 (2003) 34073–34078.
[63] B. Lintschinger, M. Balzer-Geldsetzer, T. Baskaran, W.F. Graier, C. Romanin, M.X. Zhu, K. Groschner, Coassembly of Trp1 and Trp3 proteins generates diacylglycerol- and Ca2+-sensitive cation channels, J. Biol. Chem. 275 (2000) 27799–27805.
[64] R.R. McKay, C.L. Szymeczek-Seay, J.P. Lievremont, G.S. Bird, C. Zitt, E. Jungling, A.
Luckhoff, J.W. Putney Jr., Cloning and expression of the human transient recep- tor potential 4 (TRP4) gene: localization and functional expression of human TRP4 and TRP3, Biochem. J. 351 (Pt (3)) (2000) 735–746.