Redox-responsive repressor Rex modulates alcohol production and oxidative stress tolerance in Clostridium acetobutylicum

BASIC AMINO ACID CARRIER 2 gene expression modulates arginine and urea content and stress recovery in Arabidopsis leaves... BASIC AMINO ACID CARRIER 2

These authors present data on the role of mitochondrial dys- function and oxidative stress in the initiation and progression of Alzheimer’s disease, respectively.. Ariga

Several original and review articles discuss the role of oxidative stress in neurodegenerative disorders and upon brain injury.. Singh

In each of 11 studied taxonomic groups, an iterative motif detection procedure implemented in the Reg- Predict tool was used to identify common regulatory DNA motifs in a set

AUAP GGCCACGCGTCGACTAGTAC Abridged universal amplification primer 3P1 AAGGAGACCGACGACAAGA 3 ′-RACE forward primer, outer 3P2 AAGAACGAGGCCGCGATGAA 3 ′-RACE forward primer, inner

We proved with Proposition 1.2 that a cartesian product of a finite numbers of copies of an Archimedean Dedekind-complete totally ordered ring is a Simple Complete

Orléans, Lille, Nantes, Rennes, Paris, Rouen, Ajaccio, Lyon, Dijon, Bordeaux, Marseille, Toulouse, Strasbourg.. La tour

Regarding the friction measurements on the different hydrophilic samples, the reference surface shows higher values for the contact angles (is less hydrophilic) than the