DOI 10.1007/s12185-015-1839-4 ORIGINAL ARTICLE
Evaluation of a novel multiplex RT‑qPCR assay for the
quantification of leukemia‑associated BCR‑ABL1 translocation
D. Kottwitz
1· H. EL Hadi
1· M. El Amrani
1· S. Cabezas
2· H. Dehbi
3· S. Nadifi
3· A. Quessar
4· D. Colomer
2· Abdeladim Moumen
1· EL Hassan Sefrioui
1Received: 12 February 2015 / Revised: 30 June 2015 / Accepted: 7 July 2015
© The Japanese Society of Hematology 2015
between MAScIR and the reference assays. The present study illustrates the utility of MAScIR assay as a sensitive, rapid, and cost-effective quantitative device to monitor the BCR-ABL1 ratios by RT-qPCR on whole blood of diag- nosed Philadelphia chromosome-positive (Ph + ) leukemia patients. This test could be used as an aid in the assessment of molecular response to available treatments.
Keywords CML patients · BCR-ABL1 translocation · Molecular diagnostics · Multiplex RT-qPCR · Molecular response
Introduction
Chronic myeloid leukemia (CML) is an hematologic stem cell malignancy associated with the Philadelphia chro- mosome (Ph), a balanced genetic translocation, t(9;22) (q34;q11.2), involving a fusion of the Abelson oncogene (ABL1) from chromosome 9q34 with the breakpoint cluster region (BCR) gene on chromosome 22q11.2 [1, 2]. The molecular consequence of this translocation is the generation of a BCR-ABL1 fusion oncogene, which in turn translates into a BCR-ABL1 protein that showed enhanced tyrosine kinase activity that is essential for their transforming ability [3–5] and are found in 95 % of CML patients, 25 % of acute lymphoblastic leukemia (ALL) adult cases [6], and approximately 2–5 % of children with ALL [7].
Karyotyping and fluorescence in situ hybridization (FISH) are the methods used in routine for the detection of Ph-positive cells at diagnosis [8–10]. However, to moni- tor response to treatment, accurate methods based on the quantification of BCR-ABL1 transcripts have been pro- posed and specific consensus has been reached [11, 12].
Abstract Although monitoring of BCR-ABL1 translo- cation has become an established practice in the manage- ment of chronic myeloid leukemia (CML), the detection limit of the BCR-ABL1 transcripts needs more standardi- zation. The aim of the present study was to evaluate the clinical performances of a novel assay for thequantifica- tion of BCR-ABL1 fusion transcripts (e13a2 and e14a2) and ABL1 in a single reaction. This assay is based on the real-time reverse transcription polymerase chain reaction (RT-qPCR) in multiplex format. In a retrospective com- parative clinical study performed in a reference laboratory, RNA was extracted from 48 CML patient blood samples with various BCR-ABL1/ABL1 ratios and RT-qPCR was performed using either MAScIR assay or the RT-qPCR simplex reference assay used in routine clinical testing. The comparative clinical results showed high qualitative and quantitative concordance (correlation coefficient >0.95)
D. Kottwitz and H. El Hadi authors contributed equally.
* Abdeladim Moumen a.moumen@mascir.com
* EL Hassan Sefrioui h.sefrioui@mascir.com http://www.mascir.com
1 MAScIR: Moroccan Foundation for Advanced Sciences, Innovation and Research, Medical Biotechnology Center, Rabat Design, Rue Mohamed El Jazouli, Madinat Al Irfane, 10100 Rabat, Morocco
2 Hematopathology Unit, Hospital Clinic, Villarroel 170, 08036 Barcelona, Spain
3 Human Genetics Laboratory, Faculty of Medicine, University Hassan II, Casablanca, Morocco
4 Hematology Unit, Ibn Rochd University Hospital, Casablanca, Morocco
From this consensus, RT-qPCR technology has emerged as the best and accurate sensitive method to harmonize BCR- ABL1 transcripts quantification [13–17]. To help improve the comparability of results, an International Scale (IS) for BCR–ABL1 was proposed [18]. The IS expresses results as a percentage relative to the standardized baseline estab- lished in the International Randomized Study of Interferon and STI571 (IRIS) study. Thus, reporting data as the ratio between BCR-ABL1 and ABL1, the establishment of a con- version factor (CF) between existing methods and IS refer- ence laboratories, has facilitated the harmonization of RT- qPCR results for BCR-ABL1 quantification [19]. Despite the remarkable progress in monitoring of BCR-ABL1 tran- scripts, its detection limit, particularly after the treatment, needs more standardization which reflects the relatively few BCR-ABL1 quantification assays available for molecu- lar testing.
In the present study, we evaluate the clinical perfor- mance of MAScIR assay (multiplex format) in comparison with BCR-ABL1 reference assay used (simplex format) in routine hematological clinical testing.
Materials and methods Patient samples
Peripheral blood samples (10 ml) from CML patients at different stage of the disease were collected and processed at the Hematopathology Unit at the Hospital Clinic of Bar- celona (Spain) for diagnostic purposes. Peripheral blood mononuclear cells (PBMC) were purified according to the protocols approved by this institution. Patient CML sam- ples were obtained with informed consent and ethics com- mittee approval.
RNA isolation and reverse transcription
At the Hematopathology Unit of the Hospital Clinic (Bar- celona, Spain), RNA has been isolated using Trizol reagent according to the manufacturer instructions and quantified in the Nanodrop system. One µg of RNA was used for cDNA synthesis using murine Moloney leukemia virus (M-MLV) reverse transcriptase (INvitrogen) as recommended in the European Against Cancer (EAC) protocol [20].
MAScIR assay
Standards
Standards were prepared after cloning PCR products employing the cDNA of BCR-ABL1 (e14a2) and normal
The generated recombinant plasmid DNA was isolated and purified using the QIAprep Spin Miniprep kit (Qiagen).
Plasmid concentration was determined using the Nanodrop 2000 (Thermo Scientific) and the copy number calculated employing the molecular weight of the plasmid. Next, serial dilutions of each standard were prepared (range from 10
1to 10
6copies).
Real‑time qPCR
The Primer 3 software (http://simgene.com/Primer3) was used to design appropriate probes and primer pairs for BCR-ABL1 quantification. Probe sequences were purchased from Eurofins (Germany) with a 5′6-carboxy- fluorescein (FAM) for BCR-ABL1 and 5′ Yakima Yellow (YY) for ABL1 as reporter dyes, as well as a 3′ non-fluo- rescent quencher (NFQ), with the Minor Groove Binder (MGB) moiety attached to the quencher molecule as a quencher for both probes. BCR-ABL1 primers amplify both the e13a2 and the e14a2 variants. The ABL1 prim- ers amplified a sequence that was disrupted during for- mation of the BCR-ABL1 gene and was present in both isoforms a and b of the ABL1 transcripts. Primer design excluded amplification of genomic DNA. MAScIR assay was validated using the ABI/Fast 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and TaqMan
®Fast Universal PCR Master Mix (Applied Biosystems). This Master Mix contains an Amplitaq Gold hot-start enzyme. A total of 5 µL cDNA (100 ng) was added to 20 µL PCR Mix. The PCR cycler condi- tions were 95 °C for 20 s, 50 cycles at 95 °C for 1 s, and a combined annealing and extension step at 60 °C for 30 s.
Primers and probes sequences For BCR-ABL1
Primer F: actccagactgtccacagca Primer R: accctgaggctcaaagtcag Probe: accttcagcggccagtagca
For ABL1
Primer F: gtggccagtggagataacac Primer R: tgttgactggcgtgatgtag Probe: aaatggccaaggctgggtcc Reference RT‑qPCR simplex assay
RT-qPCR was performed using the certified plasmid ERM-
AD623 [22] and according to Europe Against Cancer
Data analysis
Data were first converted to logarithmic scales to fit linear- ity. The conversion to International scale (IS) has been per- formed using a conversion factor calculated as the antilog of the Bland–Altman bias plots [13, 23]. To compare MAS- cIR and the reference assays, regression analysis and corre- lation coefficients were calculated. The difference between results was assessed by estimating the mean bias with the Bland–Altman method and calculating the 95 % limits of agreement (LOA) [23].
Results
The clinical performance of MAScIR assay has been per- formed at the accredited CML reference laboratory of the Hospital Clinic, Barcelona, Spain, according to the EUTOS recommendation. This laboratory used its own analyti- cal method to collect, process, and evaluate the samples referred to us as reference assay. MAScIR assay was com- pared to the reference assay using the same clinical sam- ples which had an ABL1 copy number above the limit (10
4) recommended by the EUTOS program. Standard curve results were analyzed separately; BCR-ABL1 quantifica- tion has been compared between the assays using 48 CML patient samples and different statistical methods.
Comparison of the standard curves performance of both MASCIR and reference assays
Standard curve allows the determination of both RT-qPCR efficacy and the R
2factor that are used to measure the per- formance of the reaction. The standard curve will also be used to extrapolate the transcript copy numbers of the tar- get genes (herein BCR-ABL and ABL1) for a given patient sample. For a particular standard curve, an efficacy greater than 95 % and an R
2higher than 0.98 are required [24].
The standard curve of MAScIR assay contains a serial dilution of the BCR-ABL1 and ABL1 DNA with a known plasmid copy number (10–10
6copies). This is a single vec- tor containing fragments from both the BCR-ABL1 and ABL1 genes and encompassed the region recognized and amplified by designed set of primers and probes. The MAS- cIR assay contains primer pairs and probes that will simul- taneously and specifically detect both BCR-ABL1 tran- scripts and ABL1 within the same reaction. Two standard curves will be generated by MAScIR assay, one for BCR- ABL1 amplification and the other for ABL1 amplification.
As shown in Fig. 1, MAScIR assay is performed with an efficacy of 99 % and 98 % for BCR-ABL1 and ABL1, respectively (R
2value of 0.98 for BCR-ABL and 0.99 for ABL1) (Fig. 1). These results confirm the high accuracy and sensitivity of the qPCR under the experimental con- ditions of MAScIR assay. The reference assay contains a vector also containing both BCR-ABL1 and ABL1 DNA,
Fig. 1 Plasmid BCR-ABL1 and ABL1 copy number-based standard curves. Ct-versus- BCR-ABL1 copy number (solid line) and Ct-versus-ABL1 copy number (dashed line) obtained by MAScIR and Ct-versus- BCR-ABL1 copy number and Ct-versus-ABL1 copy number obtained by the reference assay are shown. Each data point well represents the mean of results in duplicate. The efficacy and R2 values are included in the chart
but BCR-ABL1 quantification test is done in a simplex format that allows the detection of BCR-ABL1 and ABL1 transcripts in separate reactions. The efficacies of the two reactions performed with the reference assay were 98 and 96 % for BCR-ABL and ABL1 amplification, respectively (Fig. 1).
Comparison of BCR‑ABL1 quantification between reference and MASCIR assays
Peripheral blood samples of 48 diagnosed CML patients with known BCR-ABL1/ABL1 NCN (NCN = copy number BCR-ABL1/copy number ABL1 × 100) have been used in the present comparative study. NCN from reference assay was corrected to IS-NCN (international scale) (NCN × Cf (conversion factor). Briefly, 5 patients had undetectable BCR-ABL1 ratio (und), 10 had a ratio below 0.01 %, 10 had a ratio between 0.01 and 0.1 %, 10 had a ratio above 1 %, and 3 had a ratio higher than 10 % (Table 1). In all 5 samples with undetectable BCR-ABL1 levels, the tran- scripts were not detected by both MAScIR and reference assays. The remaining CML patient samples were BCR- ABL1 positive for both tests. The regression analysis of BCR-ABL1-positive samples demonstrated a good linear fit with high correlation (r = 0.95) (Fig. 2). These results suggest the similar performance of MAScIR and the refer- ence assays which was also confirmed with the Bland and Altman test (Only 1 sample was out of the range) (Fig. 3).
The analysis with correction factor using the well-known fold-change estimation, a test required by EUTOS program and reserved to samples with a ratio between 0.01 and 10 % BCR-ABL1 expression, also showed a perfect correla- tion between MAScIR and the reference assays with cor- responding values of 80 % for 2-fold changes, 96.66 % for 3-fold changes, and 100 % for the 5-fold changes (Table 2).
These values are all above the limit required (>50 % sam- ples with less that 2-fold changes, >75 % samples with less than 3-fold changes, and >90 % samples with less than 5-fold changes) (Table 2).
Discussion
Monitoring BCR-ABL1 expression after treatment response in CML requires precise and accurate methods like the RT- qPCR which is a well-established and worldwide-accepted molecular analytical method [25–30]. The use of RT-qPCR for BCR-ABL1 expression quantification has been standard- ized for the different steps of the procedure including RNA extraction and storage, cDNA synthesis, the selection of set of primers and probes, and the platforms used for the anal- ysis [27]. Based on this international standardization, con- version factors that normalize the results between differ- ent laboratories have been provided and few qPCR assays using different housekeeping genes have been developed for BCR-ABL1 quantification [28, 29]. However, the major- ity of these qPCR tests have been performed in simplex for- mat. In the present study, we evaluated the characteristics and the clinical performance of MAScIR assay, a newly developed RT-qPCR-based assay for monitoring BCR- ABL1 expression in CML patients at diagnosis and after treatment. This test uses ABL1, one of the widely used ref- erence gene in the literature for BCR-ABL1 quantification [19]. In addition, quantification is performed in a multiplex reaction, making the test rapid and especially cost effective.
The multiplex testing has also the potential to increase the number of sample per run and to reduce significantly the burden validation for independent assays. Another impor- tant factor of MAScIR assay includes the use in the stand- ard curve of one single vector, instead of two, containing both BCR-ABL1 and ABL1 fragments which further reduce the cost and increase the accuracy of MAScIR assay.
Precise and robust qPCR testing are usually correlated with high PCR precision and efficiency [31]. Other critical characteristics of the qPCR includes the repeatability, the reproducibility, and the sensitivity especially in multiplex reaction where possible amplification competition between the target genes can occur when one of them is found at low copy number. Indeed, amplification competition between the BCR-ABL target sequence and ABL reference gene is excluded, since at very low concentration of the BCR-ABL target sequence (10 copies of BCR-ABL/40000 copies of ABL) still the amplification of BCR-ABL is performed with a high efficiency as demonstrated by the linearity of the standard curve (Fig. 1). Furthermore, the high con- cordance between MAScIR assay and the reference sim- plex assay for BCR-ABL1 quantification results (Figs. 2, 3;
Table 2) confirm the non-competition between BCR-ABL1 and ABL1 for MAScIR assay.
Using the internationally accepted statistical methods, the clinical comparative study between MAScIR and the reference assays for BCR-ABL1 quantification revealed a perfect correlation between the two assays. Indeed,
Table 1 Number of CML clinical samples used in the present study and their corresponding BCR-ABL1/ABL1 ratio measured by refer- ence and MAScIR assays
(BCR‑ABL/ ABL1) × 100 Number of samples N = 48 Reference assay MAScIR assay
und 5 5
<0.01 10 10
0.01–0.1 10 7
0.1–1 10 9
1–10 10 8
>10 3 3
Fold-change tests confirmed the high concordance between the clinical results (correlation coefficient of 0.95) and the standard curves (efficacy >95 %), illustrating the efficiency and the accuracy of MAScIR assay for the quantification of BCR-ABL1 and ABL1 transcripts. Other characteristics of MAScIR assay including its efficacy, repeatability, and
its reproducibility were performed with different samples both in MAScIR and in three other different laboratories.
The obtained results revealed high concordance with those of the international standards (efficacy >95 % and variation coefficient CV <5 %) (data not shown). Furthermore, using our patented primers and probes [32] and blood samples isolated from CML patients treated with imatinib, we have shown that our BCR-ABL1 quantification assay is more sensitive than conventional PCR and FISH tests [21].
In summary, MAScIR assay has the performance char- acteristics required for an accurate and sensitive multiplex quantification of BCR-ABL1 and ABL1 transcripts. This is a robust, sensitive, accurate, rapid, and cost-effective quan- titative device to monitor BCR-ABL1 to ABL1 ratio by RT- qPCR on whole blood of diagnosed Ph + leukemia patients expressing e13a2 or e14a2 transcripts.
Fig. 2 Linear regression analy- sis plot to compare MAScIR and reference assays. Solid lines represent the equality between the BCR-ABL1 quantification obtained by the 2 assays. The number of clinical samples and the coefficient of correlation are added in the chart
Fig. 3 Bland and Altman analysis plot to compare MAScIR and reference assays.
Y line represents the log of the differences between BCR-ABL1 values obtained by MAScIR and reference assays. X line shows the log of the mean between BCR-ABL1 values obtained by MAScIR and reference assays
Table 2 Fold changes analysis table: The fold changes in BCR- ABL1/ABL1 ratio between MAScIR and reference assays are within the international values
Number of samples MAScIR score (%) Acceptable score (%)
2-fold 24 80 >50
3-fold 29 96.6 >75
5-fold 30 100 >90
Recently, another multiplex RT-qPCR assay has been developed [33]. The standard curve of this assay is based on Armored RNA with four dilution points and a detection limit of 50 copy numbers for BCR-ABL. The standard curve of MAScIR assay is based on a plasmidic DNA sequence, containing both BCR-ABL and ABL1 fragments, with 6 dilution points and a detection limit of 10 copy numbers for BCR-ABL. In addition, the two assays used different cali- brators and fluorescent probes.
Overall, MAScIR assay could provide benefits over the few available commercial BCR-ABL1 detection assays and can be used as an aid in the follow-up of the treatment, the assessment of the major molecular response, and the mini- mal residual disease.
Acknowledgments We are grateful for all the patients who gave their informed consent prior the inclusion of their samples in the study. We also thank all the members of MAScIR medical biotechnol- ogy and Pasteur Institute of Morocco for their assistance and help in performing the present work. The study was supported by the Moroc- can Foundation for Advanced Sciences and research Innovation and Research.
Compliance with ethical standards
Conflict of interest All authors declare that they have no conflict of interest.
References
1. Rowley JD. A new consistent chromosomal abnormality in chronic myelogenous leukemia identified by quinacrine fluores- cence and Giemsa staining. Nature. 1973;243:290–3.
2. Heisterkamp N, Stam K, Groffen J, de Klein A, Grosveld G.
Structural organization of the bcr gene and its role in the Phila- delphia translocation. Nature. 1985;315:758–61.
3. Lugo TG, Pendergast AM, Muller AJ, Witte ON. Tyrosine kinase activity and transformation potency of bcr-abl oncogene prod- ucts. Science. 1990;247:1079–82.
4. Sillaber C, Mayerhofer M, Agis H, Sagaster V, Mannhalter C, Sperr WR, et al. Chronic myeloid leukemia: pathophysiology, diagnostic parameters, and current treatment concepts. Wien Klin Wochenschr. 2003;115:485–504.
5. Sattler M, Griffin JD. Molecular mechanisms of transformation by the BCR-ABL oncogene. Semin Hematol. 2003;40:4–10.
6. Maurer J, Janssen JWG, Thiel E, van Denderen J, Ludwig WD, Aydemir U, et al. Detection of chimeric BCR/ABL genes in acute lymphoblastic leukemia by the polymerase chain reaction.
Lancet. 1991;1337:1055–8.
7. Schlieben S, Borkhardt A, Reinisch I, Ritterbach J, Janssen JW, Ratei R, et al. Incidence and clinical outcome of children with BCR/ABL-positive acute lymphoblastic leukemia (ALL). A prospective RT-PCR study based on 673 patients enrolled in the German pediatric multicenter therapy trials ALL-BFM-90 and CoALL-05-92. Leukemia. 1996;10:957–63.
8. Buño I, Wyatt WA, Zinsmeister AR, Dietz-Band J, Silver RT, Dewald GW, et al. A special fluorescent in situ hybridization technique to study peripheral blood and assess the effective- ness of interferon therapy in chronic myeloid leukemia. Blood.
1998;92:2315–21.
9. Schoch C, Schnittger S, Bursh S, Gerstner D, Hochhaus A, Berger U, et al. Comparison of chromosome binding analysis, interphase-and hypermetaphase-FISH, qualitative and quantita- tive PCR for diagnosis and follow-up in CML: a study on 350 cases. Leukemia. 2002;16:53–9.
10. Wang YL, Bagg A, Pear W, Nowell PC, Hess JL. Chronic mye- loid leukemia: laboratory diagnosis and monitoring. Genes Chro- mosomes Cancer. 2001;32:97–111.
11. Baccarani M, Cortes J, Pane F, Niederwiseser D, Saglio G, Apperley J, et al. Chronic myloide leukemia: an update of con- cepts and management recommendations of European leukemia Net. J Clin Oncol. 2009;27:6041–51.
12. Hughes TP, Kaeda J, Branford S, Rudzki Z, Hochhaus A, Hensley ML, et al. Frequency of major molecular responses to imatinib or interferon alpha plus cytarabine in newly diag- nosed chronic chronic myeloid leukemia. N Engl J Med.
2003;349:1423–32.
13. Hughes T, Deininger M, Hochhaus A, Branford S, Radich J, Kaeda J, et al. Monitoring CML patients responding to treatment with tyrosine kinase inhibitors: review and recommendations for harmonizing current methodology for detecting BCR-ABL tran- scripts and kinase domain mutations and for expressing results.
Blood. 2006;108:28–37.
14. Gaber J, Beillard E, Van Der Velden V, Bi W, Grimwade D, Pal- lisgaard N, et al. Standardization and quality control studies of of ‘real-time’ quantitative reverse transciptase polymerase chain reaction of fusion gene transcripts for residual disease detec- tion in leukemia. A Europe Against Cancer Program. Leukemia.
2003;17:2318–57.
15. Muler MC, Saglio G, Lin F, Pfeifer H, Press RD, Tubbs RR, et al. An international study to standardize the detection and quantification of BCR-ABL transcripts from stabilized periph- eral blood preparations by quantitative RT-PCR. Haematologica.
2007;92:970–3.
16. Bradford S, Hughes T. Diagnosis and monitoring of chronic myeloid leukemia by qualitative and quantitative RT-PCR. Meth- ods Mol Med. 2006;125:69–92.
17. National Comprehensive Cancer network. Clinical practice guideline in oncology: chronic myelogenous leukaemia, ver- sion 1. http//nccn.org/professionals/physician_gls/PDF/cml.pdf.
Accessed July 2007, following the International Scale proposed previously.
18. Hughes T, Kaeda J, Branford S, Rudzki Z, Hochhau A, Hensley ML, et al. Frequency of major molecular responses to imatinib or interferon alpha plus cytarabine in newly diagnosed chronic myeloid leukemia. N Engl J Med. 2003;349:1423–32.
19. Beillard E, Pallisgaard N, Vander Velden V, Bi W, Dee R, van der Schoot E, et al. Evaluation of candidate controlgenes for diagno- sis and residual disease detection in leukemia patients using ‘real time’ quantitative reverse-transcriptase polymerase chain reac- tion (RQ-PCR)- a European Against Cancer program. Leukemia.
2003;17:2474–86.
20. Gabert J, Beillard E, van der Velden VH, Bi W, Grimwade D, Pallisgaard N, et al. Standardization and quality control studies of ‘real-time’ quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia—a Europe Against Cancer program. Leukemia.
2003;17(12):2318–57.
21. Moumen A, Dehbi H, Kottwitz H, El Amrani M, H. El Hadi, H.
Sefrioui. Comparison of real-time qPCR, conventional PCR and FISH in detecting Mbcr and mbcr translocation in Moroccan chronic myeloid leukaemia patients treated with Imatinib. GMR.
2014. (in press).
22. White H, Deprez L, Corbisier P, Hall V, Lin F, Mazoua S, et al.
A certified plasmid reference material for the standardisation
of BCR-ABL1 mRNA quantification by real-time quantitative PCR. Leukemia. 2015;29(2):369–76. doi:10.1038/leu.2014.217.
23. Branford S, Fletcher L, Cross NC, Müller MC, Hochhaus A, Kim DW, et al. Desirable performance characteristics for BCR- ABL measurement on an international reporting scale to allow consistent interpretation of individual patient response and comparison of response rates between clinical trials. Blood.
2008;112(8):3330–8.
24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.
25. Mughal TI, Yong A, Szydio RM, Dazzi F, Olavarria E, van Rhee F, et al. Molecular studies in patients with chronic mye- loid leukemia in remission 5 years after allogeneic stem cell transplant define the risk of subsequent relapse. Br J Haematol.
2001;115:569–74.
26. Press RD, Love Z, Tronnes AA, Trant T, Tran T, Mongoue- Tchokote S, et al. BCR-ABL mRNA levels at and after the time of a complete cytogenetic response (CCR) predict the duration of CCR in imatinib mesylate-treated patients with CML. Blood.
2006;107:4250–6.
27. White HE, Matejtschuck P, Rigsby P, Gabert J, Lin F, Lynn Wang Y, et al. Establishment of the first World Health Organiza- tion International Genetic Reference Panel for quantification of BCR-ABL mRNA. Blood. 2010;116:11–117.
28. Luthra R, Sanchez-Vega B, Medeiros LJ. TaqMan RT-PCR assay coupled with capillary electrophoresis for quantifica- tion and identification of bcr-abl transcript type. Mol Pathol.
2004;17:96–103.
29. Cortes J, Talpaz M, O’Brien S, Jones D, Luthra R, Shan J, et al.
Molecular responses in patients with CML phase treated with imatinib mesylate. Clin Cancer. 2005;11:3425–32.
30. Cervantes F, López-Garrido P, Montero MI, Jonte F, Martínez J, Hernández-Boluda JC, et al. Early intervention during imatinib therapy in patients with newly diagnosed chronic phase chronic myeloid leukemia: a study of the Spanish PETHEMA group.
Haematologica. 2010;95(8):1317–24.
31. CLSI. Evaluation of precision performance of quantitative meas- urement methods: approved guidelines, 2nd. NCCLS document EP5-A2;2000.
32. Sefrioui H, El Amrani M and Kottwitz K. Patent WO2014042497A1: www.google.com/patents/WO2014042497 A1?cl=en&hl=fr.
33. Brown JT, Laosinchai-Wolf W, Hedges JB, Watt CD, Van Deer- lin VM, Fletcher L, et al. Establishment of a standardized multi- plex assay with the analytical performance required for quantita- tive measurement of BCR–ABL1 on the international reporting scale. Blood Cancer J. 2011;1:e13. doi:10.1038/bcj.2011.10.
