Formulation and
characterisation of lipoplexes
Development of a sustained release
system containing lipid nanoparticles for
intravaginal delivery
Development of a topical formulation containing lipoplexes
able to inhibit E6 and E7 genes for the treatment of cervix
cancer caused by HPV16 and HPV18
•selection of simple lipids: DOTAP/cholesterol and DOTAP/cholesterol/DOPE at different molar ratios
•preparation of cationic liposomes: dehydration-rehydration
method(2)
•measurement of particle size, morphylogy and zeta potential
The simplest method to prepare siRNA/liposome complexes is to mix cationic liposomes with siRNA (but different complexation strategies will also be tested):
•characterisation of lipoplexes: size, zeta potential, degree of siRNA encapsulation (ratio N/P) and toxicity
•formulation of more specific lipoplex with PEG (necessary to penetrate into the mucus), pH-sensitive lipids (to enhance the endosome escape), …and characterisation
•in-vitro and in-vivo tests: protection of siRNA against RNases and pH, penetration on organotypic culture, evaluation of toxicity on cells, escape from the endosome, rate of release,…
Incorporation of lipoplexes in a gel in order to improve their contact with the mucosa as well as the transfection rate and diffusion through the cervical mucus.
•characterisation of lipoplex gel based formulation: size, integrity, leakage of encapsulated material, …
•development of lipoplex-gel-based freeze-dried rods characterisation of obtained sponges (morphology, moisture, homogeneity, mucoadhesion,…) and evaluation of the stablity of lyophilized siRNA nanosomes formulations;
•tests of rehydration and evaluation of the release kinetics. •selected sequences (based on the litterature):
siRNA E6 (against HPV16) : CUAGGCAAACAACUAUACAUGAUA
siRNA E7 (against HPV16) : AGGAGGAUGAAAUAGAUGG
•efficiency (% transfection; % apoptosis) tested on: Cells (SiHa, CaSki, C33A)
Organotypic culture Mice
•toxicity tested on healthy cells
Goal: Induce APOPTOSIS without killing healthy cells
fusion of a lipoplexe with a cell membrane(3) (1)
(1) Scholy C. et al., Journal of Controlled Release 161, 2012, 554-564 (2) Anup K. Kundu et al., International Journal of Pharmaceutics 423, 2012, 525-534 (3) Schroeder A. et al., Journal of Internal Medicine 267-268, 2010, 9-21
HPV (16 and 18) are responsible for cervical cancer, in over 70% of cases. These viruses integrate into
keratinocytes cells and induce the expression of oncogenes E6 and E7. These prevent the expression of tumor
suppressor genes (p53 and pRb) and lead keratinocytes transformation into tumor cells.
The purpose of this study is to target locally mRNA encoding for E6-E7 oncoproteins with siRNA. In order to
protect and to optimize their penetration through the vaginal mucus and into the cytoplam, siRNA will be
incorporated into liposomes. These resulting lipoplexes will be then introduced into a sustained-release system.
Anna Lechanteur1, Tania Furst1, Brigitte Evrard1, Philippe Delvenne2, Pascale Hubert2, Marie Piette1, Geraldine Piel1
1Laboratory of Pharmaceutical Technology-CIRM, 2University of Liege, GIGA-CANCER, Laboratory of Experimental Pathology,
Liège, Belgium