• Aucun résultat trouvé

A novel mutation in the TMC1 gene causes non-syndromic hearing loss in a Moroccan family.

N/A
N/A
Protected

Academic year: 2021

Partager "A novel mutation in the TMC1 gene causes non-syndromic hearing loss in a Moroccan family."

Copied!
6
0
0

Texte intégral

(1)

Research paper

A novel mutation in the TMC1 gene causes non-syndromic hearing loss in a Moroccan family.

Amina Bakhchanea, Hicham Charoutea, Halima Nahilia, Rachida Rokyb, Hassan Roubaa, Majida Charifa,c,d, Guy Lenaersc,d,1, Abdelhamid Barakata,1,

aLaboratoire de Génétique Moléculaire Humaine, Département de Recherche Scientifique, Institut Pasteur du Maroc, Casablanca, Morocco

bUniversité Hassan II Ain Chock, Laboratoire de Physiologie et génétique moléculaire, Km 8 Route d'El Jadida, B.P. 5366 Maarif, Casablanca 20100, Morocco

cInstitut des Neurosciences de Montpellier, U1051 de l'INSERM, Université de Montpellier I et II, BP 74103, 34091 Montpellier cedex 05, France

dPREMMi, Université d'Angers, CHU Bât IRIS/IBS, Rue des Capucins, 49933 Angers cedex 9, France

a b s t r a c t a r t i c l e i n f o

Article history:

Received 12 March 2015

Received in revised form 29 June 2015 Accepted 22 July 2015

Available online xxxx

Keywords:

Hearing loss TMC1 Mutation

Whole exome sequencing Morocco

Autosomal recessive non-syndromic hearing loss (ARNSHL) is one of the most common genetic diseases in human and is subject to important genetic heterogeneity, rendering molecular diagnosis difcult. Whole- exome sequencing is thus a powerful strategy for this purpose. After excluding GJB2 mutation and other common mutations associated with hearing loss in Morocco, whole-exome sequencing was performed to study the genet- ic causes of one sibling with ARSHNL in a consanguineous Moroccan family. Afterltering data and Sanger se- quencing validation, one novel pathogenic homozygous mutation c.1810CNG (p.Arg604Gly) was identified in TMC1, a gene reported to cause deafness in various populations. Thus, we identified here thefirst mutation in theTMC1gene in the Moroccan population causing non-syndromic hearing loss.

© 2015 Elsevier B.V. All rights reserved.

1. Introduction

Hearing loss is one of the most common sensory disorder world- wide, occurring in approximately 0.2% of newborns (Hilgert et al., 2009). The majority of congenital cases are due to genetic factors and inherited across generations. Hereditary hearing loss is highly heteroge- neous, with autosomal recessive non-syndromic hearing loss (ARNSHL) being the most frequent accounting for 80% of all cases. To date, a total of 142 loci have been mapped for non syndromic deafness and 90 genes have been identied, including 31 autosomal dominant, 55 auto- somal recessive and 4 X-linked genes (http://hereditaryhearingloss.

org). GJB2 mutations are responsible for almost 50% of all cases with ARNSHL in most populations (Diaz-Horta et al., 2012). Conversely, the

majority of other deafness mutations are private and found in very few families, if not in a single one (Duman and Tekin, 2012). Thus screening of ARNSHL genes by standard molecular procedures is exten- sively long, expensive and time consuming (Diaz-Horta et al., 2012).

Whole-exome sequencing (WES) is lately viewed as a substitute to more conventional procedures for genetic diagnosis, as it authorizes a specic enrichment and sequencing of all exons of protein-coding genes, including those involved in ARNSHL (Diaz-Horta et al., 2012).

Next to the usual genes related to hearing loss published previously in Morocco, mainly GJB2 (Abidi et al., 2007; Abidi et al., 2008), LRTOMT (Charif et al., 2012) and also MT-RNR1 (Nahili et al., 2010), we here de- scribe therst mutation in theTMC1gene in the Moroccan population affected by ARNSHL, a gene which was already identied as causative for DFNA36 and DFNB7/11 deafness presentations (Kurima et al., 2002).

2. Patients and methods

2.1. Ethics statements and DNA preparation

This study was approved by the ethic committee on research of Pas- teur Institute of Morocco. We collected written informed consents from all patients before including them in the study. One unrelated Moroccan family showing prelingual, profound and bilateral sensorineural hearing loss took part to this study because of its parental consanguinity and the existence of two siblings with hearing loss issues (Fig. 1.A). Further Gene xxx (2015) xxx–xxx

Abbreviations:ARNSHL, autosomal recessive non-syndromic hearing loss; DFNA, deaf- ness, autosomal dominant 36; DFNB, deafness, autosomal recessive; ESP, Exome Sequencing Project; EVS, Exome Variant Server; GJB2, gap junction protein, beta 2, 26 kDa; LRTOMT, leucine rich transmembrane and O-methyltransferase domain con- taining; MT-RNR1, Ribosomal RNA, Mitochondrial, 12S; PolyPhen, Polymorphism Phenotyping; SIFT, Sorting Intolerant From Tolerant; TMC1, transmembrane channel-like 1; WES, Whole-exome sequencing.

Corresponding author at: Laboratoire de Génétique Moléculaire et Humaine, Département de Recherche Scientifique, Institut Pasteur. 1, Place Louis Pasteur, C.P.

20360 Casablanca, Morocco.

E-mail address:[email protected](A. Barakat).

1equal level contributors.

http://dx.doi.org/10.1016/j.gene.2015.07.075 0378-1119/© 2015 Elsevier B.V. All rights reserved.

Contents lists available atScienceDirect

Gene

j o u r n a l h o m e p a g e :w w w . e l s e v i e r . c o m / l o c a t e / g e n e

(2)

Clinical examination of the subjects disqualied any symptom or mal- formation that could be suggestive of a syndromic form of hearing loss. Using the phenol chloroform method, Genomic DNA was extracted from the blood from affected and unaffected family members. The pa- tients were previously tested negative for the most common connexin (GJB2, GJB6 and GJB3), mitochondrial (12sRNA) mutations and the 242GNA mutation in LRTOMT gene. We also included in this study 90 healthy Moroccan with normal hearing.

2.2. Exome sequencing

Whole-exome sequencing was performed on patient SF107.3 by Otogenetics Corporation (Norcross, GA, USA). After initial sample qual- ity control, fragmented genomic DNA was amplied using Illumina li- brary preparation kit (Illumina, Inc., San Diego, CA). The resulting libraries were captured by Agilent Human exome V5 (51 Mb) capture kit, followed by paired end sequencing on a Hiseq2000 platform (Illumina, San Diego, USA), according to the manufacturer's protocol.

We obtained a minimal exome coverage of 53X, which provided sufcient depth to analyze variants.

2.3. Read mapping and variant analysis

Short read alignment and variants calling were performed using the DNAnexus software package. Paired-end short reads were aligned against the human genome reference sequence hg19 (GRCh37). The aligned short reads were analyzed to identify single nucleotide varia- tions (SNVs) and indels (insertions and deletions). Weltered variants based on dbSNP (build 135) and 1000 genome project databases. Vari- ants with a frequency less than 1% were considered as rare. Impacts of each variant on protein structure were predicted by SIFT (Sorting Intol- erant From Tolerant), PolyPhen-2 (Polymorphism Phenotyping) and Proven softwares. The remaining variants were viewed using the DNAnexus Genome Browser.

2.4. Verication of variants (Sanger sequencing)

To ascertain the segregation with the disease phenotype in this fam- ily, Sanger sequencing was performed to validate the mutation in the

candidate gene. Specic primers were designed using Primer3 (http://

primer3.ut.ee/) (Table 1).

2.5. Protein structure prediction and analysis of stability

The exact three-dimensional structure ofTMC1is not available;

therefore, homology modeling approach was used to predict a 3D model of the protein. CPHmodels-3.2 Server built a protein 3D model based on the homologous protein structures available in protein data bases (PDB) (Nielsen et al., 2010). The effect of the amino acid substitu- tion onTMC1protein structure was analyzedin silicousing the I-Mutant 2.0 (Capriotti et al., 2005) and SDM (Site Directed Mutator) (Worth et al., 2011) methods. The native and mutant protein structures were vi- sualized using YASARA (Krieger and Vriend, 2014).

3. Results

3.1. Exome sequencing and SNPltering

By whole exome sequencing, we obtained 42 279 068 reads with an average sequence depth of 53×. About 97% of the total short reads were mapped to human reference sequence. A total of 121,839 single nu- cleotide polymorphisms, 6205 deletions and 5404 insertions were identied.

These variants wereltered to identify pathogenic variants, with the following strategy: we focused on missense, nonsense and frameshift mutations and excluded intronic, 5UTR, 3UTR, and synonymous variants. We discarded common variants reported in NHLBI Exome Sequencing Project (ESP), Exome Variant Server (EVS) (Tennessen et al., 2012), and the 1000 Genomes Project, with a frequency greater than 1%. Deleterious SNPs predicted by SIFT, PolyPhen-2 and Proven softwares were retained. According to the pedigree, we hypothesized an autosomal recessive mode of inheritance. Thus, we selected Fig. 1.(A) Pedigree of the SF107 family, presenting the segregation of the p.Arg604Gly mutation. (B) Electrophoregram showing the heterozygous (top) and homozygous (bottom) c.1810CNG mutation.

Table 1

Sequences of the primers used to validate the mutation by Sanger sequencing.

TMC1-Ex20-F TTTAAGAAGTATCTTGGGGAACTG

TMC1-Ex20-R GGATCTCATTTCCACCAACC

(3)

homozygous and compound heterozygous mutations. Based on this strat- egy, we identied a single novel deleterious mutation c.1810CNG (p.Arg604Gly) at homozygous state in the exon 20 of theTMC1gene.

This mutation (chr9: 75435804) is localized in a 4 megabases homozy- gous region located on chromosome 9q21.13. This variant has not yet been reported and is absent from all actual databases. Using Sanger se- quencing, we found that both parents were heterozygous, the two affect- ed offspring were homozygous for the mutation, while the healthy siblings were heterozygous or homozygous wild-type (Fig. 1.B). This novel mutation was analyzed on 63 Moroccan probands from recessive multiplex families without genetic diagnosis in order to identify the same mutation in another family, and on 90 Moroccan controls. None of the patients and the controls subjects showed this novel mutation.

3.2. Modeling and stability analysis of mutant structure

Homology model building methods was used to generate three- dimensional structure ofTMC1protein, using CPHmodels-3.2 Server.

Structural analyses were performed for evaluating the impact of the

p.Arg604Gly missense mutation on the protein stability. This mutation is predicted by the I-Mutant 2.0 and SDM (Site Directed Mutator) methods to be highly destabilizing and causing conformational changes on the protein 3D structure, thus possibly leading to protein dysfunction.

Indeed, theTMC1mutation involves the change of Arginine a polar hy- drophilic residue in general found on protein surface, to Glycine a neutral hydrophobic residue, in general found inside the protein structure. In this respect, our prediction study revealed that in the native protein structure, the Arginine-604 is found on polypeptide chain surface (Fig. 3A), whereas in the mutant protein, the Glycine is found in the inte- rior of the folded polypeptide (Fig. 3B). Thus, this mutation may lead to changes inTMC1protein folding, and consequently to its inactivation or degradation.

4. Discussion

Not only whole exome sequencing is an effective way for screening mutations in a huge number of genes, but it is also less expensive if we compare this method to other classical genetic methods, especially

Fig. 2.TMC1gene mutation identified in family SF107 with autosomal hearing loss. A: Cytogenetic location of TMC1 gene locus on chromosome 9 and mutation position. B: Schematic structure of TMC1 protein. C: Amino acid conservation map across species demonstrating that Arginine at position 604 is well conserved throughout vertebrates.

(4)

for extremely heterogeneous diseases such as ARNSHL. In this work, WES disclosed in a Moroccan family a novel missense mutation c.1810CNG (p.Arg604Gly) in exon 20 inTMC1gene (Fig. 2.A) which is responsible for the DFNA36 and DFNB7/11 form of deafness (Kurima et al., 2002). This mutation is predicted to be deleterious as stated by Polyphen-2 (Adzhubei et al., 2010), MutationTaster (Schwarz et al., 2010) and SIFT (http://sift.jcvi.org/).TMC1gene encodes a transmembrane channel-like protein 1, which includes six transmem- brane domains (Fig. 2.B). This protein does not show similarity to any other known protein and is expressed specically in hair cells of the co- chlea and in the neurosensory epithelium of the vestibular organ, and mandatory for their normal functions (Kurima et al., 2002). The identi- ed missense mutation c.1810CNG (p.Arg604Gly) can cause structural changes inTMC1structure affecting its function, and eventually leading to the phenotype observed in the affected offspring. The pathogenic ef- fect of the p.Arg604Gly mutation on the three-dimensional structure is suggested by the prediction programs as reported in the graphical model (Fig. 3) In addition, this amino-acid position is well-conserved among species (Fig. 2.C). To date, a total of 52 different mutations have been detected inTMC1gene (Table 2). In North Africa,TMC1mutations were identied in Algeria, Morocco (the current study) and Tunisia. In Tunisia, a novel mutation (c.2260 + 2 T) was recently described by whole exome sequencing in intron 23 ofTMC1(Riahi et al., 2014), while another mutation inTMC1exon 7 c.100CNT (p.R34X) was very frequently found (5.55%) in Tunisian patients with ARSHNL, suggesting a founder effect (Ben Said et al., 2010). This mutation c.100CNT was also present in a family from Algeria (Ammar-Khodja et al., 2015).

In conclusion, using whole exome sequencing, we identied therst TMC1 mutation, c.1810CNG (p.Arg604Gly) in the Moroccan population.

The identication of supplementary disease-causing mutations in this gene should conrm further the essential role of theTMC1protein in au- ditory function.

Disclosure statements

The authors declare not having any conict of interest.

Fig. 3.Three-dimensional structural modeling. (A) Segments of TMC1 protein highlighting position and orientation of the native amino acid Arginine-604. (B) Same structural pre- diction as in (A) but with the Glycine-604 substitution showing a reverse orientation of the amino-acid residue.

Table 2

Overview of all TMC1 mutations so far identified.

Origin Mutation DNA Protein Exon(E)/Intron(I) Type of variant Domain Reference

China c.589GNA p.G197R E11 Missense IC1 Gao et al. (2013)

China c.1171CNT p.Q391X E15 Nonsense EC2 Gao et al. (2013)

China c.1247 TNG p.L416R Missense EC2 Chen et al. (2015)

China c.1312GNA p.A438T Missense EC2 Chen et al. (2015)

China c.236 + 1GNC Splicing site Yang et al. (2013)

China c.1107CNA p.N369K Missense TM3 Yang et al. (2013)

China c.1209GNC p.W403C Missense EC2 Yang et al. (2013)

China c.1253 TNA p.M418K E16 Missense EC2 Zhao et al. (2014)

India c.1960ANG p.M654V E20 Missense TM5 Kurima et al. (2002)

India c.237-6 TNG Intron 7 Splice site regulation Ganapathy et al. (2014)

India c.453 + 2 TNC Intron 9 Splice site regulation Ganapathy et al. (2014)

India c.628_630del p.I210del Exon 11 Deletion TM1 Ganapathy et al. (2014)

India c.800GNA p.G267E Exon 13 Missense EC1 Ganapathy et al. (2014)

India c.1566 + 1GNA Intron 17 Splice site regulation Ganapathy et al. (2014)

Iran c.776 + 1GNA E7 Splice site mutation Hilgert et al. (2008)

Greece c.2350CNT p.R604X E20 Nonsense EC3 Hilgert et al. (2008)

Morocco c.1810CNG p.Arg604Gly E20 Missense IC3 The present study

Pakistan c. IVS10-8 TNA I10 Splice site mutation Kurima et al. (2002)

Pakistan c. IVS13 + 1GNA I13 Splice site mutation Kurima et al. (2002)

Santos et al. (2005)

Pakistan c.884 + 1GNA E13 Splice site mutation Kurima et al. (2002)

Pakistan c.830ANG p.Y277C E13 Missense TM2 Santos et al. (2005)

Pakistan c.IVS5 + 1GNT Splice site I5 Splice site mutation Kitajiri et al. (2007b)

Pakistan c.1534CNT p.R512X E17 Nonsense IC3 Kurima et al. (2002)

Pakistan c.536-8 TNA E11 Splice site mutation Santos et al. (2005)

Pakistan c.2004 TNG p.S668R E21 Missense EC3 Santos et al. (2005)

Pakistan c.2035GNA p.E679K E21 Missense EC3 Santos et al. (2005)

Pakistan c.1541CNT p.P514L E17 Missense IC3 Kitajiri et al. (2007b)

(5)

Acknowledgments

Authors are indebted to the families that contributed to this study, and to an INSERM-CNRST collaboration program favoring exchanges between our laboratories.

References

Abidi, O., Boulouiz, R., Nahili, H., Ridal, M., Alami, M.N., Tlili, A., Rouba, H., Masmoudi, S., Chafik, A., Hassar, M., Barakat, A., 2007.GJB2 (connexin 26) gene mutations in Moroc- can patients with autosomal recessive non-syndromic hearing loss and carrier frequency of the common GJB2-35delG mutation. Int. J. Pediatr. Otorhinolaryngol.

71, 1239–1245.

Abidi, O., Boulouiz, R., Nahili, H., Bakhouch, K., Wakrim, L., Rouba, H., Chafik, A., Hassar, M., Barakat, A., 2008.Carrier frequencies of mutations/polymorphisms in the connexin 26 gene (GJB2) in the Moroccan population. Genet. Test. 12, 569–574.

Adzhubei, I.A., Schmidt, S., Peshkin, L., Ramensky, V.E., Gerasimova, A., Bork, P., Kondrashov, A.S., Sunyaev, S.R., 2010.A method and server for predicting damaging missense mutations. Nat. Methods 7, 248–249.

Ammar-Khodja, F., Bonnet, C., Dahmani, M., Ouhab, S., Lefevre, G.M., Ibrahim, H., Hardelin, J.P., Weil, D., Louha, M., Petit, C., 2015.Diversity of the causal genes in hearing impaired Algerian individuals identified by whole exome sequencing. Mol. Genet.

Genomic Med. 3, 189–196.

Ben Said, M., Hmani-Aifa, M., Amar, I., Baig, S., Mustapha, M., et al., 2010.High frequency of the p.R34X mutation in the TMC1 gene associated with nonsyndromic hearing loss is due to founder effects. Genet. Test. Mol. Biomark. 14, 307–311.

Capriotti, E., Fariselli, P., Casadio, R., 2005.I-Mutant2.0: predicting stability changes upon mutation from the protein sequence or structure. Nucleic Acids Res. 33, W306–W310.

Charif, M., Bounaceur, S., Abidi, O., Nahili, H., Rouba, H., Kandil, M., Boulouiz, R., Barakat, A., 2012.The c.242GNA mutation in LRTOMT gene is responsible for a high prevalence of deafness in the Moroccan population. Mol. Biol. Rep. 39, 11011–11016.

Chen, Y., Wang, Z., Wang, Z., Chen, D., Chai, Y., Pang, X., Sun, L., Wang, X., Yang, T., Wu, H., 2015.Targeted next-generation sequencing in uyghur families with non-syndromic sensorineural hearing loss. PLoS ONE 10, e0127879.

Davoudi-Dehaghani, E., Fallah, M.S., Tavakkoly-Bazzaz, J., Bagherian, H., Zeinali, S., 2014.

Allelic heterogeneity among Iranian DFNB7/11 families: report of a new Iranian deaf family with TMC1 mutation identified by next-generation sequencing. Acta Otolaryngol. 1–5.

de Heer, A.M., Collin, R.W., Huygen, P.L., Schraders, M., Oostrik, J., Rouwette, M., Kunst, H.P., Kremer, H., Cremers, C.W., 2011.Progressive sensorineural hearing loss and nor- mal vestibular function in a Dutch DFNB7/11 family with a novel mutation in TMC1.

Audiol. Neuro Otol. 16, 93–105.

Diaz-Horta, O., Duman, D., Foster II, J., Sirmaci, A., Gonzalez, M., Mahdieh, N., Fotouhi, N., Bonyadi, M., Cengiz, F.B., Menendez, I., Ulloa, R.H., Edwards, Y.J., Zuchner, S., Blanton, S., Tekin, M., 2012.Whole-exome sequencing efficiently detects rare mutations in au- tosomal recessive nonsyndromic hearing loss. PLoS ONE 7, e50628.

Duman, D., Tekin, M., 2012.Autosomal recessive nonsyndromic deafness genes: a review.

Front. Biosci. (Landmark Ed.) 17, 2213–2236.

Ganapathy, A., Pandey, N., Srisailapathy, C.R., Jalvi, R., Malhotra, V., Venkatappa, M., Chatterjee, A., Sharma, M., Santhanam, R., Chadha, S., Ramesh, A., Agarwal, A.K., Rangasayee, R.R., Anand, A., 2014.Non-syndromic hearing impairment in India:

high allelic heterogeneity among mutations in TMPRSS3, TMC1, USHIC, CDH23 and TMIE. PLoS ONE 9, e84773.

Gao, X., Su, Y., Guan, L.P., Yuan, Y.Y., Huang, S.S., Lu, Y., Wang, G.J., Han, M.Y., Yu, F., Song, Y.S., Zhu, Q.Y., Wu, J., Dai, P., 2013.Novel compound heterozygous TMC1 mutations associated with autosomal recessive hearing loss in a Chinese family.

PLoS ONE 8, e63026.

Hassan, M.A., Shah, A.A., Szmida, E., Smigiel, R., Sasiadek, M.M., Pfister, M., Blin, N., Bress, A., 2015.A TMC1 (transmembrane channel-like 1) mutation (p.S320R) in a Polish family with hearing impairment. J. Appl. Genet.

Hilgert, N., Alasti, F., Dieltjens, N., Pawlik, B., Wollnik, B., Uyguner, O., Delmaghani, S., Weil, D., Petit, C., Danis, E., Yang, T., Pandelia, E., Petersen, M.B., Goossens, D., Favero, J.D., Sanati, M.H., Smith, R.J., Van Camp, G., 2008.Mutation analysis of TMC1 identifies four new mutations and suggests an additional deafness gene at loci DFNA36 and DFNB7/11. Clin. Genet. 74, 223–232.

Table 2(continued)

Origin Mutation DNA Protein Exon(E)/Intron(I) Type of variant Domain Reference

Pakistan c.1543 TNC p.C515R E17 Missense IC3 Kitajiri et al. (2007b)

Pakistan c.IVS3_IVS5 E5 Deletion Kurima et al. (2002)

Pakistan c.362 + 18ANG p.Glu122Tyrfs*10 I8 Splice site mutation Shafique et al. (2014)

Poland p.S320R E8 Missense IC2 Hassan et al. (2015)

Sudan c.IVS19 + 5GNA I19 Splice site mutation Meyer et al. (2005)

The Netherlands c.1763 + 3ANG p.W588WfsX81 I19 Splice site mutation de Heer et al. (2011)

Tunisia c.2260 + 2 TNA I23 Splice site mutation Riahi et al. (2014)

Tunisia c.1764GNA p.W588X E19 Nonsense IC3 Tlili et al. (2008)

Turkey c.776 ANG p.Y259C E13 Missense EC1 Kalay et al. (2005)

Turkey c.821CNT p.P274L E13 Missense TM2 Kalay et al. (2005)

Turkey c.1083_1087delCAGAT p.R362PfsX6 E15 Deletion IC2 Kalay et al. (2005)

Turkey c.767delT p.F255FfsX14 E13 Deletion EC1 Hilgert et al. (2008)

Turkey c.1166GNA p.R389Q E15 Missense EC2 Hilgert et al. (2008)

Turkey c.1330GNA p.G444R E16 Missense TM4 Sirmaci et al. (2009)

Turkey c.IVS6 + 2 TNA Splice site I6 Splice site mutation Sirmaci et al. (2009)

Turkey c.1685_2280 del E19–24 Deletion Sirmaci et al. (2009)

Turkey, India c.1333CNT p.G445R E16 Missense TM4 Sirmaci et al. (2009)

Ganapathy et al. (2014)

North America, China c.1714 GNA p.D572N E19 Missense IC3 Makishima et al. (2004)

Kitajiri et al. (2007a) Wei et al. (2014)

Iran, China c.150delT p.N50KfsX25 Frame-shift indel IC1 Yang et al. (2010)

Yang et al. (2013)

Pakistan, India c.1114GNA p.V372M E15 Missense TM3 Ganapathy et al. (2014).

Santos et al. (2005)

Pakistan, India c.295_296 delA E8 Deletion IC1 Kurima et al. (2002)

Pakistan, Tunisia, Algeria, Lebanon, Jordan,Turkey, India

c.100 CNT p.R34X E7 Nonsense IC1 Kurima et al. (2002)

Hilgert et al. (2008) Sirmaci et al. (2009) Kitajiri et al. (2007a) Tlili et al. (2008) Ammar-Khodja et al. (2015) Ganapathy et al. (2014)

Sudan, Tunisia, Lebanon, Jordan c.1165CNT p.R389X E15 Nonsense EC2 Meyer et al. (2005)

Hilgert et al. (2008) Tlili et al. (2008)

Turkey, Pakistan, China c.1334 GNA p.R455H E16 Missense TM4 Kalay et al. (2005)

Santos et al. (2005) Yang et al. (2013)

Turkey, Iran c.2030 TNC p.I667T E21 Missense EC3 Sirmaci et al. (2009)

Davoudi-Dehaghani et al. (2014)

(6)

Hilgert, N., Smith, R.J., Van Camp, G., 2009.Function and expression pattern of nonsyn- dromic deafness genes. Curr. Mol. Med. 9, 546–564.

Kalay, E., Karaguzel, A., Caylan, R., Heister, A., Cremers, F.P., Cremers, C.W., Brunner, H.G., de Brouwer, A.P., Kremer, H., 2005.Four novel TMC1 (DFNB7/DFNB11) mutations in Turkish patients with congenital autosomal recessive nonsyndromic hearing loss.

Hum. Mutat. 26, 591.

Kitajiri, S., Makishima, T., Friedman, T.B., Griffith, A.J., 2007a.A novel mutation at the DFNA36 hearing loss locus reveals a critical function and potential genotype–

phenotype correlation for amino acid-572 of TMC1. Clin. Genet. 71, 148–152.

Kitajiri, S.I., McNamara, R., Makishima, T., Husnain, T., Zafar, A.U., Kittles, R.A., Ahmed, Z.M., Friedman, T.B., Riazuddin, S., Griffith, A.J., 2007b.Identities, frequencies and or- igins of TMC1 mutations causing DFNB7/B11 deafness in Pakistan. Clin. Genet. 72, 546–550.

Krieger, E., Vriend, G., 2014.YASARA Viewmolecular graphics for all devicesfrom smartphones to workstations. Bioinformatics 30, 2981–2982.

Kurima, K., Peters, L.M., Yang, Y., Riazuddin, S., Ahmed, Z.M., Naz, S., Arnaud, D., Drury, S., Mo, J., Makishima, T., Ghosh, M., Menon, P.S., Deshmukh, D., Oddoux, C., Ostrer, H., Khan, S., Riazuddin, S., Deininger, P.L., Hampton, L.L., Sullivan, S.L., Battey Jr., J.F., Keats, B.J., Wilcox, E.R., Friedman, T.B., Griffith, A.J., 2002.Dominant and recessive deafness caused by mutations of a novel gene, TMC1, required for cochlear hair-cell function. Nat. Genet. 30, 277–284.

Makishima, T., Kurima, K., Brewer, C.C., Griffith, A.J., 2004.Early onset and rapid progres- sion of dominant nonsyndromic DFNA36 hearing loss. Otol. Neurotol. 25, 714–719.

Meyer, C.G., Gasmelseed, N.M., Mergani, A., Magzoub, M.M., Muntau, B., Thye, T., Horstmann, R.D., 2005.Novel TMC1 structural and splice variants associated with congenital nonsyndromic deafness in a Sudanese pedigree. Hum. Mutat. 25, 100.

Nahili, H., Charif, M., Boulouiz, R., Bounaceur, S., Benrahma, H., Abidi, O., Chafik, A., Rouba, H., Kandil, M., Barakat, A., 2010.Prevalence of the mitochondrial A 1555G mutation in Moroccan patients with non-syndromic hearing loss. Int. J. Pediatr. Otorhinolaryngol.

74, 1071–1074.

Nielsen, M., Lundegaard, C., Lund, O., Petersen, T.N., 2010.CPHmodels-3.0—remote ho- mology modeling using structure—guided sequence profiles. Nucleic Acids Res. 38, W576–W581.

Riahi, Z., Bonnet, C., Zainine, R., Louha, M., Bouyacoub, Y., Laroussi, N., Chargui, M., Kefi, R., Jonard, L., Dorboz, I., Hardelin, J.P., Salah, S.B., Levilliers, J., Weil, D., McElreavey, K., Boespflug, O.T., Besbes, G., Abdelhak, S., Petit, C., 2014.Whole exome sequencing identifies new causative mutations in Tunisian families with non-syndromic deaf- ness. PLoS ONE 9, e99797.

Santos, R.L., Wajid, M., Khan, M.N., McArthur, N., Pham, T.L., Bhatti, A., Lee, K., Irshad, S., Mir, A., Yan, K., Chahrour, M.H., Ansar, M., Ahmad, W., Leal, S.M., 2005.Novel

sequence variants in the TMC1 gene in Pakistani families with autosomal recessive hearing impairment. Hum. Mutat. 26, 396.

Schwarz, J.M., Rodelsperger, C., Schuelke, M., Seelow, D., 2010.MutationTaster evaluates disease-causing potential of sequence alterations. Nat. Methods 7, 575–576.

Shafique, S., Siddiqi, S., Schraders, M., Oostrik, J., Ayub, H., Bilal, A., Ajmal, M., Seco, C.Z., Strom, T.M., Mansoor, A., Mazhar, K., Shah, S.T., Hussain, A., Azam, M., Kremer, H., Qamar, R., 2014.Genetic spectrum of autosomal recessive non-syndromic hearing loss in Pakistani families. PLoS ONE 9, e100146.

Sirmaci, A., Duman, D., Ozturkmen-Akay, H., Erbek, S., Incesulu, A., Ozturk-Hismi, B., Arici, Z.S., Yuksel-Konuk, E.B., Tasir-Yilmaz, S., Tokgoz-Yilmaz, S., Cengiz, F.B., Aslan, I., Yildirim, M., Hasanefendioglu-Bayrak, A., Aycicek, A., Yilmaz, I., Fitoz, S., Altin, F., Ozdag, H., Tekin, M., 2009.Mutations in TMC1 contribute significantly to nonsyn- dromic autosomal recessive sensorineural hearing loss: a report offive novel muta- tions. Int. J. Pediatr. Otorhinolaryngol. 73, 699–705.

Tennessen, J.A., Bigham, A.W., O'Connor, T.D., Fu, W., Kenny, E.E., Gravel, S., McGee, S., Do, R., Liu, X., Jun, G., Kang, H.M., Jordan, D., Leal, S.M., Gabriel, S., Rieder, M.J., Abecasis, G., Altshuler, D., Nickerson, D.A., Boerwinkle, E., Sunyaev, S., Bustamante, C.D., Bamshad, M.J., Akey, J.M., Broad, G.O., Seattle, G.O., Project, N.E.S., 2012.Evolution and function- al impact of rare coding variation from deep sequencing of human exomes. Science 337, 64–69.

Tlili, A., Rebeh, I.B., Aifa-Hmani, M., Dhouib, H., Moalla, J., Tlili-Chouchene, J., Said, M.B., Lahmar, I., Benzina, Z., Charfedine, I., Driss, N., Ghorbel, A., Ayadi, H., Masmoudi, S., 2008.TMC1 but not TMC2 is responsible for autosomal recessive nonsyndromic hear- ing impairment in Tunisian families. Audiol. Neuro Otol. 13, 213–218.

Wei, Q., Zhu, H., Qian, X., Chen, Z., Yao, J., Lu, Y., Cao, X., Xing, G., 2014.Targeted genomic capture and massively parallel sequencing to identify novel variants causing Chinese hereditary hearing loss. J. Transl. Med. 12, 311.

Worth, C.L., Preissner, R., Blundell, T.L., 2011.SDM—a server for predicting effects of mu- tations on protein stability and malfunction. Nucleic Acids Res. 39, W215–W222.

Yang, T., Kahrizi, K., Bazazzadeghan, N., Meyer, N., Najmabadi, H., Smith, R.J., 2010.A novel mutation adjacent to the Bth mouse mutation in the TMC1 gene makes this mouse an excellent model of human deafness at the DFNA36 locus. Clin. Genet. 77, 395–398.

Yang, T., Wei, X., Chai, Y., Li, L., Wu, H., 2013.Genetic etiology study of the non-syndromic deafness in Chinese Hans by targeted next-generation sequencing. Orphanet J. Rare Dis. 8, 85.

Zhao, Y., Wang, D., Zong, L., Zhao, F., Guan, L., Zhang, P., Shi, W., Lan, L., Wang, H., Li, Q., Han, B., Yang, L., Jin, X., Wang, J., Wang, J., Wang, Q., 2014.A novel DFNA36 mutation in TMC1 orthologous to the Beethoven (Bth) mouse associated with autosomal dom- inant hearing loss in a Chinese family. PLoS ONE 9, e97064.

Références

Documents relatifs

Compared to Otog tm1Prs and twister, the two other existing otogelin alleles, the detailed analysis of Otog vbd/vbd revealed that these mice share some common

puis, le code r´esiduel est g´en´er´e en confrontant cette repr´esentation interm´ediaire – au sein de laquelle chaque processus est rep´er´e par un pid unique – avec le

Production d’écrits : Ecris le dialogue de bienvenue quand Adi arrive chez tata Igénie..

Zum anderen wird Geschichte im Sinne der (fr¨uhen) Gadamerschen Wirkungsgeschichte verstanden, die als diejenige Frage gegenw¨artig ist, auf die ein Text antwortet und die als

Mutations in GJB2, the gene most frequently involved in autosomal recessive deafness in Tunisia [10–12], and mutations in other DFNB genes that had previously been reported in

In this study, we investigated the genetic cause of sensorineural hearing loss in Moroccan patients and presented the importance of whole exome sequencing (WES)

Mag den Angehörigen der im »Walliser Fried- hof« aufgeführten Verstorbenen ihr Verlust auch noch so schmerzlich sein, sie können durch ihre Fürbitte bei Gott erwirken, dass

The frameshift mutation found in PCHD21, one of three sequenced genes of 11 candidate genes in the linkage interval, the segregation of the mutation with the disease in the family,