• Aucun résultat trouvé

Hepatocyte nuclear factor 4alpha regulates the expression of pancreatic beta -cell genes implicated in glucose metabolism and nutrient-induced insulin secretion

N/A
N/A
Protected

Academic year: 2022

Partager "Hepatocyte nuclear factor 4alpha regulates the expression of pancreatic beta -cell genes implicated in glucose metabolism and nutrient-induced insulin secretion"

Copied!
8
0
0

Texte intégral

(1)

Article

Reference

Hepatocyte nuclear factor 4alpha regulates the expression of pancreatic beta -cell genes implicated in glucose metabolism and

nutrient-induced insulin secretion

WANG, Haiyan, et al .

Abstract

Mutations in the HNF4alpha gene are associated with the subtype 1 of maturity-onset diabetes of the young (MODY1), which is characterized by impaired insulin secretory response to glucose in pancreatic beta-cells. Hepatocyte nuclear factor 4alpha (HNF4alpha) is a transcription factor critical for liver development and hepatocyte-specific gene expression.

However, the role of HNF4alpha in the regulation of pancreatic beta-cell gene expression and its correlation with metabolism secretion coupling have not been previously investigated. The tetracycline-inducible system was employed to achieve tightly controlled expression of both wild type (WT) and dominant-negative mutant (DN) of HNF4alpha in INS-1 cells. The induction of WT-HNF4alpha resulted in a left shift in glucose-stimulated insulin secretion, whereas DN-HNF4alpha selectively impaired nutrient-stimulated insulin release. Induction of DN-HNF4alpha also caused defective mitochondrial function substantiated by reduced [(14)C]pyruvate oxidation, attenuated substrate-evoked mitochondrial membrane hyperpolarization, and blunted nutrient-generated cellular ATP production. [...]

WANG, Haiyan, et al . Hepatocyte nuclear factor 4alpha regulates the expression of pancreatic beta -cell genes implicated in glucose metabolism and nutrient-induced insulin secretion.

Journal of Biological Chemistry , 2000, vol. 275, no. 46, p. 35953-9

DOI : 10.1074/jbc.M006612200 PMID : 10967120

Available at:

http://archive-ouverte.unige.ch/unige:35181

Disclaimer: layout of this document may differ from the published version.

1 / 1

(2)

Hepatocyte Nuclear Factor 4Regulates the Expression of Pancreatic-Cell Genes Implicated in Glucose Metabolism and Nutrient-induced Insulin Secretion*

Received for publication, July 25, 2000 Published, JBC Papers in Press, August 30, 2000, DOI 10.1074/jbc.M006612200

Haiyan Wang, Pierre Maechler, Peter A. Antinozzi, Kerstin A. Hagenfeldt, and Claes B. Wollheim‡

From the Division de Biochimie Clinique, De´partment de Me´decine Interne, Centre Me´dical Universitaire, CH-1211 Geneva 4, Switzerland

Mutations in theHNF4gene are associated with the subtype 1 of maturity-onset diabetes of the young (MODY1), which is characterized by impaired insulin secretory response to glucose in pancreatic-cells. Hep- atocyte nuclear factor 4(HNF4) is a transcription factor critical for liver development and hepatocyte- specific gene expression. However, the role of HNF4in the regulation of pancreatic-cell gene expression and its correlation with metabolism secretion coupling have not been previously investigated. The tetracycline-in- ducible system was employed to achieve tightly con- trolled expression of both wild type (WT) and dominant- negative mutant (DN) of HNF4in INS-1 cells. The induction of WT-HNF4resulted in a left shift in glu- cose-stimulated insulin secretion, whereas DN-HNF4selectively impaired nutrient-stimulated insulin re- lease. Induction of DN-HNF4also caused defective mi- tochondrial function substantiated by reduced [14C]pyruvate oxidation, attenuated substrate-evoked mitochondrial membrane hyperpolarization, and blunted nutrient-generated cellular ATP production.

Quantitative evaluation of HNF4-regulated pancreatic

-cell gene expression revealed altered mRNA levels of insulin, glucose transporter-2, L-pyruvate kinase, aldol- ase B, 2-oxoglutarate dehydrogenase E1 subunit, and mitochondrial uncoupling protein-2. The patterns of HNF4-regulated gene expression are strikingly similar to that of its downstream transcription factor HNF1. Indeed, HNF4changed the HNF1mRNA levels and HNF1promoter luciferase activity through altered HNF4binding. These results demonstrate the impor- tance of HNF4in-cell metabolism-secretion coupling.

The hepatocyte nuclear factor 4␣(HNF4␣),1a transcription factor of the nuclear hormone receptor superfamily, is ex- pressed in liver, kidney, gut, and pancreatic islets (1–3). Mu-

tations in the human HNF4␣ gene lead to maturity onset diabetes of the young subtype 1 (MODY1), which is character- ized by autosomal dominant inheritance and impaired glucose- stimulated insulin secretion from pancreatic ␤-cells (4 – 6).

These MODY1 mutations located in various domains of the HNF4␣protein result in defective function of the transcription factor (6). The clinical phenotype of MODY1 patients is indis- tinguishable from that of MODY3 patients who carry muta- tions in the HNF1␣ gene (5, 6). HNF4␣ acts upstream of HNF1␣in a transcriptional cascade that drives liver-specific gene expression and hepatocyte differentiation (7–9). A natu- rally occurring mutation in the HNF4␣-binding site of the HNF1␣promoter identified in a MODY3 family (10) suggests that the transcriptional hierarchy could also be involved in pancreatic␤-cell gene expression and function.

HNF4␣defines the expression of liver-specific genes encod- ing apolipoproteins, serum factors, cytochrome P-450 isoforms, and proteins involved in the metabolism of glucose, fatty acids, and amino acids (reviewed in Ref. 11). However, clinical char- acterization of MODY1 subjects reveals that the primary defect is impaired glucose-stimulated insulin secretion from pancre- atic␤-cells rather than liver dysfunction (5, 12–14). Unfortu- nately, little is known as to how HNF4␣regulates ␤-cell-re- stricted gene expression and glucose metabolism and associated insulin secretion. Targeted disruption of thehnf4␣ gene results in defective gastrulation of mouse embryos due to dysfunction of the visceral endoderm (15). This early embryonic lethality prevents further analysis of the HNF4␣function in pancreatic ␤-cells. The precise role of HNF4␣ in pancreatic

␤-cells would best be examined by conditional ␤-cell-specific deletion of the mousehnf4␣gene. Another alternative is to up- and down-regulate HNF4␣function in pancreatic␤-cell lines through gene manipulation.

In the present study, the wild type HNF4␣(WT-HNF4␣) and its dominant-negative mutant (DN-HNF4␣) could be induced in INS-1 cells under tight control of the reverse tetracycline- dependent transactivator (16). DN-HNF4␣ represents the epitope Myc-tagged truncated HNF4␣mutant protein lacking the first 111 amino acids (myc⌬111HNF4␣) (17). The HNF4␣ protein consists of an N-terminal ligand-independent transac- tivation domain (amino acids 1–24), a DNA binding domain containing two zinc fingers (amino acids 51–117), and a large hydrophobic portion (amino acids 163–368) composed of the dimerization, ligand binding, cofactor binding, and ligand-de- pendent transactivation domain (18, 19). DN-HNF4␣therefore suppresses the endogenous WT-HNF4␣transcriptional activity by the formation of heterodimers lacking DNA binding capacity (17). We have investigated in a quantitative manner the con- sequences of altered HNF4␣function on␤-cell-specific expres-

* This work was supported by Swiss National Science Foundation Grant 32-49755.96, by a European Union Network grant (through the Swiss Federal Office for Education and Science), and by a research grant from Eli Lilly. The costs of publication of this article were de- frayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

‡ To whom correspondence should be addressed. Tel.: 41 22 702 5548;

Fax: 41 22 702 5543; E-mail: [email protected].

1The abbreviations used are: HNF4␣, hepatocyte nuclear factor 4␣;

MODY, maturity-onset diabetes of the young; WT, wild type; DN, dominant- negative; PCR, polymerase chain reaction; USF, upstream stimulatory fac- tors; OGDH, 2-oxoglutarate dehydrogenase; L-PK, L-pyruvate kinase;

EMSA, electrophoretic mobility shift assay; FCCP, carbonyl cyanidep-trif- luoromethoxyphenylhydrazone; Dox, doxycycline.

This paper is available on line at http://www.jbc.org

35953

at Bibliotheque Faculte Medecine Geneve, on October 1, 2012www.jbc.orgDownloaded from

(3)

sion of genes implicated in glucose metabolism and insulin secretion. This allowed us to elucidate the molecular basis and HNF4␣target genes responsible for impaired metabolism se- cretion coupling in␤-cells deficient in HNF4␣function.

EXPERIMENTAL PROCEDURES

Generation of Stable Cell Lines—The rat insulinoma INS-1 cell line- derived stable clones were cultured in RPMI 1640 in 11 mMglucose, unless indicated otherwise (20). The establishment of the first step stable clone INS-r3, which expresses the reverse tetracycline-depend- ent transactivator, was reported previously (21). Plasmids used in the secondary stable transfection were constructed by subcloning the cDNAs encoding the rat WT-HNF4␣(a generous gift from Dr. Darnell Jr., New York) and DN-HNF4␣into the expression vector PUHD10-3 (a kind gift from Dr. H. Bujard, University Heidelberg, Germany). DN- HNF4␣was PCR-amplified from WT-HNF4␣using the following prim- ers, ctaggatccttccgggctggcatgaagaaagaagcc and ccagaattcctgcagatggtt- gtcctttag. The PCR fragment was subcloned into pcDNA3.1myc (Invitrogen, Netherlands) and sequenced. Transfection, clone selection, and screening procedures were described previously (21).

Immunoblot—Immunoblotting procedures were performed as de- scribed previously using enhanced chemiluminescence (Pierce) for de- tection (22). Dilutions for antibody against HNF4␣(kindly supplied by Dr. F. M. Sladek, University of California, Riverside, CA) and anti-Myc tag (9E10) in myeloma SP2/0 culture medium were 1:6,000 and 1:10.

Insulin Secretion and Cellular Insulin Content—Cells in 24-well dishes were cultured in 2.5 mMglucose medium with or without indi- cated doses of doxycycline for 14 or 48 h. Insulin secretion was meas- ured over a period of 30 min, in Krebs-Ringer/bicarbonate-HEPES buffer (KRBH, 140 mMNaCl, 3.6 mMKCl, 0.5 mMNaH2PO4, 0.5 mM

MgSO4, 1.5 mMCaCl2, 2 mMNaHCO3, 10 mMHEPES, 0.1% bovine serum albumin) containing indicated stimulators. Insulin content was determined after extraction with acid ethanol following the procedures of Asfariet al. (20). Insulin was detected by radioimmunoassay using rat insulin as standard (22).

Intracellular ATP—Cells in 6-well dishes were cultured in 2.5 mM

glucose medium with or without 500 ng/ml doxycycline for 48 h. The production of ATP was measured during 8 min of stimulation in KRBH.

ATP assay was performed as reported previously (22).

[14C]Pyruvate Oxidation—The production of14CO2from [1-14C]pyru- vate or [2-14C]pyruvate was measured over 1 h in KRBH containing either 0.05 or 1.0 mMpyruvate as described previously (23, 24).

Mitochondrial Membrane Potential (⌬␺m)—After a 48-h culture pe- riod in 2.5 mMglucose medium with or without 500 ng/ml doxycycline, cells were trypsinized (0.025% trypsin, 0.27 mMEDTA), and the cell suspension was maintained for 2 h in a spinner culture with 2.5 mM

glucose RPMI 1640 plus 1% newborn calf serum at 37 °C. Mitochondrial membrane potential (⌬␺m) was measured as described (25). Briefly, after the spinner culture period, cells were loaded with 10␮g/ml rho- damine-123 (Rh-123) for 10 min at 37 °C. After centrifugation, the cells were resuspended and transferred to the fluorimeter cuvette at 37 °C with gentle stirring in an LS-50B fluorimeter (PerkinElmer Life Sci- ences), and fluorescence, excited at 490 nm, was measured at 530 nm.

Total RNA Isolation and Northern Blotting—Cells in 10-cm dishes

were cultured in 2.5 mMglucose medium with or without 500 ng/ml doxycycline for 14 or 48 h, followed by an additional 8 h in culture medium with 2.5, 6, 12, and 24 mMglucose. Total RNA was extracted and blotted to nylon membranes as described previously (22). The membrane was prehybridized and then hybridized to32P-labeled ran- dom primer cDNA probes by the technique of Sambrooket al.(26). To ensure equal RNA loading and even transfer, all membranes were stripped and re-hybridized with the “housekeeping gene” probes such as

␤-actin or cyclophilin. cDNA fragments used as probes for L-pyruvate kinase (L-PK), glucose transporter-2 (GLUT-2), glucokinase, insulin, PDX1, HNF4␣, upstream stimulatory factors (USF), c-Jun, and C/EBP␤mRNA detection were digested from corresponding expression vectors kindly provided by Drs. A. Kahn, B. Thorens, P. B. Iynedjian, J.

Philippe, T. Edlund, J. E. Darnell, Jr., M. Sawadogo, W. Schlegel, and U. Schibler, respectively. cDNA probes for rat aldolase B, glyceralde- hyde-3-phosphate dehydrogenase, dimerization cofactor for HNF1␣ (DcoH), mitochondrial adenine nucleotide translocator 1 and 2 (ANT1 and ANT2), mitochondrial uncoupling protein-2 (UCP-2), mitochondrial 2-oxoglutarate dehydrogenase (OGDH) E1 subunit, glutamate dehydro- genase (GDH), Pax4, Pax6, Nkx2.2, Nkx6.1, Isl1, insulin receptor sub- strate-2 (IRS2), cyclin-dependent kinase-4 (Cdk4), and cyclophilin were prepared by reverse transcriptase-PCR and confirmed by sequencing.

Nuclear Extract Preparation and Electrophoretic Mobility Shift As- say (EMSA)—Cells in 10-cm dishes were grown in culture medium with or without 500 ng/ml doxycycline for 48 h. The following double- stranded oligonucleotides were used as probes, 5⬘-GGCTGAAGTC- CAAAGTTCAGTCCCTTCGC-3⬘(8). EMSA procedures including condi-

FIG. 1.Dose response and time course of doxycycline effect on WT-HNF4(A) and DN-HNF4(B) expression.For studying dose response, cells were cultured with the indicated doses of Dox for 48 h.

For studying time course, cells were cultured in medium containing 500 ng/ml doxycycline and harvested for nuclear extracts at the indicated times. Nuclear extracts from WT-HNF4␣-28 (50␮g/lane) (A) and DN- HNF4␣-26 (10␮g/lane) (B) were resolved in 9% SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose, and immunoblotted with antibodies against HNF4␣(A) and the Myc-tag (B), respectively.

FIG. 2.HNF4␣regulates nutrient-evoked insulin secretion in INS-1 cells.Insulin secretion was quantified as described under “Experi- mental Procedures” and normalized by cellular DNA content.A,glucose-stimulated insulin secretion in WT-HNF4␣-28 cells induced with indicated doses of doxycycline for 14 h. Data represent the mean⫾S.E. of six independent experiments. Statistical significance between doxycycline-induced and non-induced cells was obtained at 2.5 and 6 mMglucose (p⬍0.001, unpaired Student’sttest).B,glucose-, leucine-, and K-elicited insulin secretion in DN-HNF4␣-26 cells induced with 500 ng/ml doxycycline for 48 h. Insulin secretion was measured during 30 min of incubation with 2.5 mM(Basal) and 24 mMglucose in KRBH, or with 20 mMleucine and 20 mMKCl added in KRBH containing 2.5 mMglucose. Data are the mean⫾ S.E. of six separate experiments. Statistical significance between doxycycline-induced and non-induced cells was observed at 24 mMglucose- and 20 mMleucine-stimulated conditions (p⬍0.001). Insulin content was reduced by 30⫾8.2% after induction of DN-HNF4␣.

HNF4-regulated-Cell Gene Expression and Insulin Secretion 35954

at Bibliotheque Faculte Medecine Geneve, on October 1, 2012www.jbc.orgDownloaded from

(4)

tions for nuclear extract preparation, probe labeling, binding reactions, unlabeled-probe competition, and antibody supershift were performed as reported previously (22).

Transient Transfection and Luciferase Assay—TheHNF1␣gene pro- moter luciferase reporter plasmids, WT-HNF1␣Luc (wild type) and

AHNF1Luc(HNF4␣-binding site deleted), were kindly provided by Dr. N. Miura (Akita University, Japan) (27).

Transient transfection experiments and luciferase reporter enzyme assays were carried out as previously reported (22).

RESULTS

WT-HNF4or DN-HNF4Protein Was Induced in INS-1 Cells in a Dose- and Time-dependent Manner—We have ob- tained 10 and 8 clones positively expressing WT-HNF4␣and DN-HNF4␣, respectively. The clones designated as WT- HNF4␣-28 and DN-HNF4␣-26 that displayed highest induc- tion levels of transgene proteins were chosen for the present study. The time course and dose response of doxycycline effect on WT-HNF4␣and DN-HNF4␣expression are illustrated in Fig. 1, A and B, respectively. WT-HNF4␣ protein could be induced within a range from 2- to 50-fold above the endogenous protein level (Fig. 1A). Thus, graded overexpression of WT- HNF4␣could be achieved by culturing the WT-HNF4␣-28 cells with varying doses of doxycycline in a defined period. Similar induction of DN-HNF4␣protein was detected in the nuclear extracts from DN-HNF4␣-26 cells (Fig. 1B). No leakage of this doxycycline-dependent promoter was observed, since the ex- pression of DN-HNF4␣ protein was not detectable in non- induced DN-HNF4␣-26 cells (Fig. 1B). Therefore, the domi- nant-negative suppression of HNF4␣ function in INS-1 cells could be rapidly achieved by culturing the DN-HNF4␣-26 cells with a maximum dose of doxycycline (500 ng/ml).

Effects of WT-HNF4and DN-HNF4on Insulin Secretion—

Impaired glucose-stimulated insulin secretion from pancreatic

␤-cells is the primary defect causing hyperglycemia in MODY1 patients carrying HNF4␣mutations. We therefore examined the consequences of induction of WT-HNF4␣and DN-HNF4␣ on insulin secretion in INS-1 cells. The graded overexpression

of WT-HNF4␣led to a left shift of glucose-stimulated insulin secretion (Fig. 2A). However, the maximal (above 12 mM) glu- cose-elicited insulin secretion remained unchanged (Fig. 2A).

Glucose generates ATP and other metabolic coupling factors important for insulin secretion through glycolysis and mito- chondrial oxidation (28). The physiological insulin secreta- gogue, leucine, is transported directly into mitochondria to provide substrates for the tricarboxylic acid cycle (28). K causes insulin secretion by depolarization of the ␤-cell mem- brane, resulting in an increase in cytosolic Ca2(28). We there- fore examined the insulin secretory responses to these three secretagogues that act at different levels of the signal trans- duction cascade following induction of DN-HNF4␣. As demon- strated in Fig. 2B, DN-HNF4␣ selectively inhibited glucose- and leucine-stimulated insulin secretion. This could be ex- plained by defective glucose and leucine metabolism.

Effects of DN-HNF4on Cellular ATP Production and Mito- chondrial Oxidation—To investigate whether impaired nutri- ent-evoked insulin secretion is correlated to defective cellular ATP production, we analyzed the impact of DN-HNF4␣expres- sion on the level of ATP generated by glucose and leucine. As shown in Fig. 3A, induction of DN-HNF4␣indeed abolished the ATP generation by glucose and leucine. Since the mitochon- drial substrate leucine failed to generate ATP after induction of DN-HNF4␣, it would seem that HNF4␣is required for main- taining normal mitochondrial function.

To test this hypothesis, we examined the consequences of DN-HNF4␣induction on mitochondrial oxidation of pyruvate.

Pyruvate-derived carbons enter the tricarboxylic acid cycle as either acetyl-CoA, catalyzed by pyruvate dehydrogenase, or oxaloacetate via pyruvate carboxylase. By using pyruvate ra- diolabeled at either the first or second carbon, the putative defects at various steps in pyruvate metabolism can be as- sessed. The radiolabeled carbon of [1-14C]pyruvate is lost to CO2 at the pyruvate dehydrogenase step as pyruvate is con- verted into acetyl-CoA. Alternatively, if pyruvate enters the FIG. 3.Induction of DN-HNF4␣impairs cellular ATP production and mitochondrial oxidation.A,cellular ATP levels in DN-HNF4␣-26 cells were measured after 8 min of incubation with 2.5 (Basal) and 24 mMglucose in KRBH or 20 mMleucine and 20 mMKCl added in KRBH containing 2.5 mMglucose. Data represent mean⫾S.E. of three independent experiments. Glucose- and leucine-stimulated ATP production was significantly inhibited after treatment with 500 ng/ml doxycycline for 48 h (p⬍0.005 andp⬍0.001, respectively).B,[2-14C]pyruvate oxidation was measured during 1 h of incubation in KRBH containing 0.05 or 1 mMpyruvate. Data represent the mean⫾S.E. performed in triplicate from one of four similar experiments. *p⬍0.02.C,[1-14C]pyruvate oxidation was measured with identical conditions in the same preparation of cells as inB. Data represent the mean⫾S.E. performed in triplicate from one of three similar experiments.

at Bibliotheque Faculte Medecine Geneve, on October 1, 2012www.jbc.orgDownloaded from

(5)

tricarboxylic acid cycle via oxaloacetate, the label is lost to CO2 at isocitrate dehydrogenase within one turn of the cycle. Ra- diolabeled CO2 is generated from 2-14C at either OGDH or isocitrate dehydrogenase when pyruvate enters the tricarbox- ylic acid cycle as acetyl-CoA. Overexpression of DN-HNF4␣ reduced CO2formation from [2-14C]pyruvate by 41% (Fig. 3B), whereas CO2formation from [1-14C]pyruvate was not different between non- and induced conditions (Fig. 3C). These results suggest that the defect in mitochondrial metabolism is not at the point of entry of pyruvate into the tricarboxylic acid cycle, rather that the defect appears in reactions within the tricar- boxylic acid cycle. This is in full agreement with the impair- ment of leucine stimulation of insulin secretion since leucine metabolism bypasses pyruvate and enters the tricarboxylic acid cycle solely as acetyl-CoA. Decreased isocitrate dehydro- genase activity would also be unlikely since impairment at this step would be observed by both [1-14C]pyruvate and [2-14C]pyruvate oxidation. These oxidation experiments sug- gest that steps following this reaction beginning with OGDH may be responsible for impaired [2-14C]pyruvate oxidation.

Effect of DN-HNF4a on Mitochondrial Membrane Potential (⌬␺m) in INS-1 Cells—The⌬␺mwas measured in a suspension of INS-1 cells by monitoring rhodamine-123 fluorescence. In control cells (⫺Dox) addition of 10 mMglucose (12.5 mMfinal) potently hyperpolarized ⌬␺m, whereas 1 ␮M of the protono- phore FCCP depolarized ⌬␺m (Fig. 4A). In cells expressing DN-HNF4␣(⫹Dox), the glucose response was inhibited by 65%

(p ⬍ 0.02). Impaired hyperpolarization of ⌬␺m was also ob- served when the glycolysis was bypassed by stimulating cells

with the end product of glycolysis pyruvate (Fig. 4B), indicating mitochondrial dysfunction. Direct activation with methyl suc- cinate of the electron transport chain at complex II resulted in a diminished response in DN-HNF4␣-induced cells (Fig. 4C).

The amplitude of complete ⌬␺mdepolarization by FCCP was also reduced in cells treated with doxycycline (⫺43%;p⬍0.01), suggesting that the mitochondria were partially uncoupled by suppression of HNF4␣function (Fig. 4D).

Effects of WT-HNF4and DN-HNF4on Pancreatic-Cell Gene Expression—The expression of genes involved in glucose metabolism (Fig. 5,Aand B) or in pancreatic␤-cell develop- ment and differentiation (Fig. 5,CandD) was quantitatively evaluated in WT-HNF4␣-28 (Fig. 5, A and C) and DN- HNF4␣-26 cells (Fig. 5,Band D). As shown in Fig. 5A, WT- HNF4␣mRNA could be induced by 2-, 8-, and 50-fold above the endogenous level. This graded overexpression of WT-HNF4␣ resulted in a stepwise increase in the expression of three glu- cose-responsive genes encoding, respectively, GLUT-2, L-PK, and aldolase B (Fig. 5A). However, the mRNA level of glycer- aldehyde-3-phosphate dehydrogenase, which is also responsive to glucose, remained unaltered (Fig. 5A). Induction of WT- HNF4␣also caused incremental expression of OGDH E1 sub- unit transcript (Fig. 5A). Consistently, The mRNA levels of GLUT-2, aldolase B, L-PK, and OGDH E1 subunit were signif- icantly reduced after induction of DN-HNF4␣(Fig. 5B). On the other hand, induction of DN-HNF4␣led to increased UCP-2 mRNA expression (Fig. 5B). Therefore, HNF4␣regulates the expression of genes involved in both glycolysis and mitochon- drial metabolism. The profile of HNF4␣-targeted genes is strik- FIG. 4.Effect of DN-HNF4on mitochondrial membrane potential (⌬␺m) in INS-1 cells.The⌬␺mwas measured in a suspension of 2⫻ 106INS-1 cells per 2 ml of KRBH using rhodamine-123 (Rh-123) fluorescence after a spinner culture period.A, glucose-induced (12.5 mMfinal) hyperpolarization of⌬␺mwas tested followed by the complete depolarization of⌬␺musing 1␮Mof the uncoupler FCCP.B, the end product of glycolysis pyruvate (10 mM) was added 10 min before FCCP.C, the mitochondrial substrate methyl succinate (10 mM) was tested. The effects of these various substrates (5 min after addition) as well as that of FCCP are summarized with statistics inD. *,p⬍0.05; **,p⬍0.01. Each trace (A–C) is representative of 4 – 8 independent experiments.

HNF4-regulated-Cell Gene Expression and Insulin Secretion 35956

at Bibliotheque Faculte Medecine Geneve, on October 1, 2012www.jbc.orgDownloaded from

(6)

ingly similar to that of HNF1␣(29). HNF4␣may regulate the expression of genes implicated in glucose metabolism through HNF1␣function as in hepatocytes (7–9).

Since HNF4␣is required for liver development and hepato- cyte differentiation (9), we investigated whether HNF4␣regu- lates the expression of genes important for the pancreatic␤-cell phenotype. Induction of WT-HNF4␣(Fig. 5C) or DN-HNF4␣ (Fig. 5D) did not alter the expression patterns of PDX1, Pax4, Pax6, NKx2.2, NKx6.1, and Isl-1, which are necessary for nor- mal pancreatic cell development or differentiation (30). More- over, HNF4␣did not regulate the mRNA levels of USF, c-Jun, and C/EBP␤(Fig. 5,CandD). The expression of these tran- scription factors appeared to be responsive to glucose (Fig. 5,C and D). The expression of another glucose-responsive tran- scription factor, DcoH, was slightly affected by induction of WT-HNF4␣but not by expression of DN-HNF4␣(Fig. 5,Cand D), suggesting the involvement of an indirect mechanism. Both Cdk4 and IRS2 are involved in pancreatic␤-cell development (31, 32), but their expression was not regulated by HNF4␣(Fig.

5, C and D). Induction of DN-HNF4␣ for 48 h caused 50%

reduction in insulin mRNA levels (Fig. 5D). This may be sec- ondary to decreased HNF1␣function, since HNF1␣is required for insulin gene transcription (29).

HNF4Regulates Pancreatic-Cell Gene Expression

through HNF1Function—We performed EMSA for studying HNF4␣ binding activity to HNF1␣ promoter, luciferase re- porter enzyme assay for HNF1␣promoter activity, and North- ern blotting for the HNF1␣mRNA expression. Nuclear extracts were prepared from WT-HNF4␣-28 and DN-HNF4␣-26 cells cultured for 48 h in the presence or absence of 500 ng/ml doxycycline. The murine HNF1␣promoter segment, which con- tains the HNF4␣-binding site, was used as probe (8). Induction of WT-HNF4␣resulted in a dramatic increase in the signal density of HNF4␣binding (Fig. 6A). On the other hand, induc- tion of DN-HNF4␣ almost completely abolished the binding activity of endogenous HNF4␣to the HNF1␣promoter (Fig.

6A). DN-HNF4␣exerts its dominant-negative function by form- ing DN-HNF4␣/WT-HNF4␣heterodimers that lack DNA bind- ing capacity (11). The retarded DNA binding complexes corre- sponding to endogenous WT-HNF4␣and/or induced transgene WT-HNF4␣homodimers were supershifted by a specific anti- body against HNF4␣(Fig. 6A).

Consistently, induction of WT-HNF4␣ resulted in a 2-fold increase in endogenous HNF1␣ mRNA level, whereas DN- HNF4␣completely eliminated the HNF1␣expression (Fig. 6B).

To confirm that HNF4␣directly regulates HNF1␣transcrip- tion, we transiently transfected WT-HNF4␣-28 and DN- HNF4␣-26 cells with a luciferase reporter construct containing either the wild typeHNF1␣gene promoter (HNF1␣Luc) or a promoter that lacks a functional HNF4␣-binding site (⌬AHNF1Luc). As demonstrated in Fig. 6C, overexpression of WT-HNF4␣caused a 2.5-fold increase in the luciferase reporter enzyme activity in WT-HNF4␣-28 cells transfected with HNF1Luc. Deletion of the HNF4␣-binding site in the HNF1␣ promoter (⌬AHNF1␣) abolished the activation induced by WT- HNF4␣(Fig. 6C). In contrast, induction of DN-HNF4␣caused a 71% reduction in wild type HNF1␣promoter activity (Fig.

6C). The inhibitory effect of DN-HNF4␣was no longer present in DN-HNF4␣-26 cells transfected with ⌬AHNF1Luc (Fig.

6C). Therefore, HNF4␣directly controlsHNF1␣gene expres- sion in pancreatic␤-cells as it does in hepatocytes.

DISCUSSION

It has been demonstrated that HNF4␣controls the expres- sion of a large array of liver-specific genes encoding several apolipoproteins, metabolic proteins, and serum factors that are essential for hepatocyte differentiation and liver development (9). HNF4␣is also required for HNF1␣expression in hepato- cytes (7–9). Another study in embryonic stem cell-differenti- ated embryoid bodies (33) shows that the absence of HNF4␣ affects the expression of genes encoding GLUT-2, aldolase B, and L-PK, which are involved in glucose transport and glycol- ysis. However, little is known as to how HNF4␣ regulates pancreatic ␤-cell gene expression. The primary cause of the MODY1 phenotype is impaired glucose-stimulated insulin se- cretion from pancreatic ␤-cells (5). The present study was therefore designed to investigate the role of HNF4␣ in the regulation of the expression of␤-cell genes implicated in glu- cose metabolism and associated insulin secretion.

We found that overexpression of WT-HNF4␣ caused a left shift of glucose-stimulated insulin secretion, whereas domi- nant-negative suppression of HNF4␣ selectively blunted the insulin release induced by glucose and leucine but not by K depolarization. The diminished nutrient-evoked insulin secre- tion is associated with reduced ATP production in DN-HNF4␣- expressing cells. The physiological insulin secretagogue leucine raises the cytosolic and mitochondrial Ca2⫹ concentrations through mitochondrial metabolism downstream of glycolysis (28, 34). Therefore, we suggest that loss of HNF4␣ function leads to defective mitochondrial metabolism and, as a conse- quence, impaired insulin secretion. The reduced mitochondrial FIG. 5. Effects of WT-HNF1and DN-HNF1on pancreatic

-cell gene expression.Northern blotting was used to quantify the gene expression in WT-HNF4␣-28 (AandC) and DN-HNF4␣-26 (Band D) cells induced with indicated doses of doxycycline and cultured at given concentrations of glucose (detailed under “Experimental Proce- dures”). RNA samples were analyzed by hybridization with the indi- cated cDNA probes.

at Bibliotheque Faculte Medecine Geneve, on October 1, 2012www.jbc.orgDownloaded from

(7)

oxidation of [2-14C]pyruvate and the abrogation of mitochon- drial membrane hyperpolarization elicited by glucose, pyru- vate, and methyl succinate indicate impaired mitochondrial tricarboxylic acid cycle enzyme activity and partial uncoupling of the mitochondrial respiratory chain.

Quantitative Northern blot analysis allows us to identify HNF4␣target genes responsible for defective metabolism-se- cretion coupling. HNF4␣ indeed regulates the expression of genes encoding GLUT-2, aldolase B, and L-PK in pancreatic

␤-cells (Fig. 5), as inferred from previous studies in hepatocytes and embryonic stem cell-differentiated embryoid bodies (8, 9).

Most importantly, we demonstrate that HNF4␣ alters the mRNA expression of mitochondrial OGDH E1 subunit and UCP-2 (Fig. 5), which may indeed contribute more significantly to the impaired metabolism-secretion coupling. The phenotype and gene expression patterns in DN-HNF4␣-expressing cells are strikingly similar to those of DN-HNF1␣-expressing cells (22, 29). This prompted us to investigate whether HNF4␣reg- ulates␤-cell expression through HNF1␣function, as in hepa- tocytes (9). We provide unprecedented evidence that HNF4␣is required for HNF1␣expression in pancreatic␤-cells.

This conclusion is based on the use of an artificial dominant- negativehnf4␣mutation. The naturally occurring human mu- tations of HNF4␣do not function in a dominant-negative man- ner (6, 35). It is to be expected that a mutation with such repressive action on the endogenous HNF4␣ function would cause embryonic lethality, as is the case in thehnf4␣knock-out mouse (15). Haploinsufficiency or reduced gene dosage of HNF4␣ may thus explain the mechanism leading to the

MODY1 phenotype (33). The INS-1 cell line expressing DN- HNF4␣provides a convenient model to explore the impact of impaired HNF4␣function on ␤-cell gene expression and me- tabolism-secretion coupling. This goal cannot be achieved by the introduction of one of the human HNF4␣mutations into

␤-cell lines. In fact, the induction of a nonsense mutation HNF4␣Q268X to a level similar to DN-HNF4␣had no detect- able consequences on␤-cell gene expression and metabolism- secretion coupling.2

MODY1 patients display secretory defects not only in␤-cells but also in the glucagon-secreting ␣-cells and the pancreatic polypeptide-secreting cells (36, 37). However, this general ef- fect on islet hormone release does not seem due to an effect on the development and differentiation of the endocrine pancreas, since altered HNF4␣function did not affect the expression of PDX1 and other transcription factors determining pancreatic phenotype. On the other hand, loss of HNF4␣ function may cause reduced ␤-cell insulin content secondary to defective HNF1␣function (22, 29).

Acknowledgments—We are grateful to D. Harry, G. Chaffard, C.

Bartley, and E.-J. Sarret for expert technical assistance. We are in- debted to Drs. F. M. Sladek (HNF4␣ antibody), J. E. Darnell, Jr.

(HNF4␣cDNA), W. Schlegel (c-Jun cDNA), P. B. Iynedjian (glucokinase cDNA), U. Schibler (C/EBP␤cDNA), T. Edlund (PDX1 cDNA), M. Sawa- dogo (USF cDNA), A. Kahn (L-PK cDNA), B. Thorens (GLUT-2 cDNA), J. Philippe (insulin I cDNA), H. Bujard (PUHD 10 –3 plasmid), and N.

Quintrell (pTKhygro plasmid).

2H. Wang and C. B. Wollheim, unpublished results.

FIG. 6.Induction of WT-HNF1␣and DN-HNF1␣regulates the HNF1␣mRNA expression and HNF1␣promoter luciferase activity through altered HNF4binding.EMSA (A), Northern blotting (B), and luciferase enzyme reporter activity (C) assays were performed in WT-HNF4␣-28 and DN-HNF4␣-26 cells cultured in the presence or absence of 500 ng/ml doxycycline for 48 h.A,for EMSA, the oligonucleotide duplex corresponding to the murine HNF1␣promoter fragment containing HNF4␣-binding site was used as probe.B,for Northern blot analysis, cells were cultured in 2.5 mMglucose medium for 48 h and continued for 8 h with indicated glucose concentrations. RNA samples from WT-HNF4␣-28 (upper panel) and DN-HNF4␣-26 (lower panel) cells were hybridized with HNF1␣cDNA probe.C,cells were transiently transfected withHNF1Lucor⌬AHNF1Lucby calcium phosphate-DNA co-precipitation. Luciferase activity measured in non-induced cells was defined as 100%. Data are the mean⫾S.E. of six separate experiments.

HNF4-regulated-Cell Gene Expression and Insulin Secretion 35958

at Bibliotheque Faculte Medecine Geneve, on October 1, 2012www.jbc.orgDownloaded from

(8)

REFERENCES

1. Sladek, F. M., Zhong, W., Lai, E., and Darnell, J. E., Jr. (1990)Genes Dev.4, 2353–2365

2. Taraviras, S., Monaghan, P. A., Schu¨ tz, G., and Kelsey, G. (1994)Mech. Dev.

48,67–79

3. Miquerol, L., Lopez, S., Cartier, N., Tulliez, M., Raymondjean, M., and Kahn, A. (1994)J. Biol. Chem.269,8944 – 8951

4. Yamagata, K., Furuta, H., Oda, N., Kaisaki, P., Menzel, S., Cox, N. J., Fajans, S. S., Signorini, S., Stoffel, M., and Bell, G. I. (1996)Nature384,458 – 460 5. Hattersley, A. T. (1998)Diabetic Med.15,15–24

6. Lausen, J., Thomas, H., Lemm, I., Bulman, M., Borgschulze, M., Lingott, A., Hattersley, A. T., and Ryffel, G. U. (2000)Nucleic Acids Res.28,430 – 437 7. Tian, J.-M., and Schibler, U. (1991)Genes Dev.5,2225–2234

8. Kuo, C. J., Conley, P. B., Chen, L., Sladek, F. M., Darnell, J. E., Jr., and Crabtree, G. R. (1992)Nature355,457– 461

9. Li, J., Ning, G., and Duncan, S. A. (2000)Genes Dev.14,464 – 474 10. Gragnoli, C., Lindner, T., Cockburn, B. N., Kaisaki, P. J., Gragnoli, F.,

Marozzi, G., and Bell, G. I. (1997)Diabetes46,1648 –1651

11. Sladek, F. M. (1994) inLiver-specific Gene Expression(F. Tronche and M.

Yaniv, eds) pp. 207–230, R. G. Landes Co., Austin, TX

12. Byne, M. M., Sturis, J., Fanjans, S. S., Ortiz, F. J., Stoltz, A., Stoffel, M., Smith, M. J., Bell, G. I., Halter, J. B., and Polonski, K. S. (1995)Diabetes44, 699 –704

13. Linder, T., Gragnoli, C., Furuta, H., Cockburn, B. N., Petzold, C., Rietzsch, H., Wei, U., Schulze, J., and Bell, G. I. (1997)J. Clin. Invest.100,1400 –1405 14. Lehto, M., Bitze´n, P.-O., Isomaa, B., Wipemo, C., Wessman, Y., Forsblom, C.,

Toumi, T., Taskinen, M.-R., and Groop, L. (1999)Diabetes48,423– 425 15. Chen, W. S., Manova, K., Weinstein, D. C., Duncan, S. A., Plump, A. S.,

Prezioso, V. R., Bachvarova, R. F., and Darnell, J. E., Jr. (1994)Genes Dev.

8,2466 –2477

16. Gossen, M., Freundlieb, S., Bender, G., Mu¨ ller, G., Hillen, W., and Bujard, H.

(1995)Science268,1766 –1769

17. Fraser, J. D., Keller, D., Martinez, V., Santiso-Mere, D., Straney, R., and Briggs, M. R. (1997)J. Biol. Chem.272,13892–13898

18. Hadzopoulou-Cladaras, M., Kistanova, E., Evagelopoulou, C., Zeng, S., Cla- daras, C., and Ladias, J. A. A. (1997)J. Biol. Chem.272,539 –550

19. Sladek, F. M., Ruse, M. D., Jr., Nepomuceno, L., Huang, S.-M., and Stallcup, M. R. (1999)Mol. Cell. Biol.19,6509 – 6522

20. Asfari, M., Janjic, D., Meda, P., Li, G., Halban, P. A., and Wollheim, C. B.

(1992)Endocrinology130,167–178

21. Wang, H., and Iynedjian, P. B. (1997)Proc. Natl. Acad. Sci. U. S. A.99, 4372– 4377

22. Wang, H., Maechler, P., Hagenfeldt, K. A., and Wollheim, C. B. (1998)EMBO J.17,6701– 6713

23. Noel, R. J., Antinozzi, P. A., McGarry, J. D., and Newgard, C. B. (1997)J. Biol.

Chem.272,18621–18627

24. Antinozzi, P. A., Segall, L., Prentki, M., McGarry, J. D., and Newgard, C. B.

(1998)J. Biol. Chem.273,16146 –16154

25. Maechler, P., Kennedy, E. D., Pozzan, T., and Wollheim, C. B. (1997)EMBO J.

16,3833–3841

26. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989)Molecular Cloning: A Laboratory Manual,pp. 7.3–7.84, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

27. Muira, N., and Tanaka, K. (1993)Nucleic Acids Res.21,3731–3736 28. Wollheim, C. B. (2000)Diabetologia43,265–277

29. Wang, H., Antinozzi, P. A., Hagenfeldt, K. A., Maechler, P., and Wollheim, C. B. (2000)EMBO J.19,1– 8

30. Edlund, H. (1998)Diabetes47,1817–1823

31. Rane, G. R., Dubus, P., Mettus, R. V., Galbreath, E. J., Boden, G., Reddy, E. P., and Barbacid, M. (1999)Nat. Genet.22,44 –52

32. Withers, D. J., Burks, D. J., Towery, H. H., Altamuro, S. L., Flint, C. L., and White, M. F. (1999)Nat. Genet.23,32– 40

33. Stoffel, M., and Duncan, S. A. (1997)Proc. Natl. Acad. Sci. U. S. A.94, 13209 –31214

34. Kennedy, E. D., and Wollheim, C. B. (1998)Diabetes Metab.24,15–24 35. Hani, E.-H., Suaud, L., Boutin, P., Che`vre, J.-C., Durand, E., Philippi, A.,

Demenais, F., Vionnet, N., Furuta, H., Velho, G., Bell, G. I., and Laine, B.

(1998)J. Clin. Invest.101,521–526

36. Herman, W. H., Fajans, S. S., Smith, M. J., Polonsky, K. S., Bell, G. I., and Halter, J. B. (1997)Diabetes46,1749 –1754

37. Ilag, L. L., Tabaei, B. P., Herman, W. H., Zawacki, C. M., D’Souza, E., Bell, G. I., and Fajans, S. S. (2000)Diabetes49,961–968

at Bibliotheque Faculte Medecine Geneve, on October 1, 2012www.jbc.orgDownloaded from

Références

Documents relatifs

In the pancreatic /3-celi, mitochondrial metaboiism plays a pivotai role in the generation of signais coupling glucose recognition to insulin secretion [11,27,30,35].. Metabolism

Irrespective of the glutamate levels measured in glucose- stimulated cells, the principal observation is that glutamate directly stimulates insulin exocytosis in permeabilised cells

Conclusion—Foxa2 exerts the following functions in pancre- atic endocrine cells: 1) maintaining the high affinity hexoki- nase expression at a minimal level to limit insulin

Dans ces différents tis- sus, les isoformes de HNF1 forment des homo- et des hétérodimères avec prédominance des homodimères HNF1 α dans le foie et des hétérodi- mères HNF1 α

Furthermore, chromatin immunoprecipitation (ChIP)-chip shows that TEAD4 is a direct target of the MYOD1 and MYOG transcription factors in C2C12 cell differentiation 20..

Forced miR-375 expression in human islet cells reduces insulin secretion in response to glucose 297. but not to KCl or to KIC

Quatre énoncés comportent une différence d’au moins 10 % entre le degré d’accord de 2016 à celui de 2012 : interdire le financement de l’industrie pour la formation (+ 10,4

Dissipative boundary conditions for nonlinear 1-D hyper- bolic systems: sharp conditions through an approach via time-delay systems... Dissipative boundary conditions for nonlinear