• Aucun résultat trouvé

Quercus ilex L.: How season, Plant Organ and Extraction Procedure Can Influence Chemistry and Bioactivities

N/A
N/A
Protected

Academic year: 2021

Partager "Quercus ilex L.: How season, Plant Organ and Extraction Procedure Can Influence Chemistry and Bioactivities"

Copied!
1
0
0

Texte intégral

(1)

Quercus ilex L.: How season, Plant Organ and Extraction

Procedure Can Influence Chemistry and Bioactivities

Auteurs :

Lila Hadidi, Louiza Babou, Farid Zaidi, Patrícia Valentão, Paula B Andrade, Clara Grosso

Date de publication :2017/1 Revue :Chemistry & biodiversity Volume :14

Numéro :1

Pages : e 1600187 Description :

Quercus species have a plethora of applications, either in wine and wood industries, in human and animal nutrition or in human health. In order to improve the knowledge on this genus, the aim of the present study was to correlate, for the first time, the phenolic composition of different Quercus ilex L. plant tissues (leaves in two maturation stages, acorns, teguments and cotyledons) and different extraction procedures with scavenging and

anticholinesterase activities. The hydromethanolic and aqueous extracts obtained showed strong radical scavenging activity against DPPH,

superoxide anion radical and nitric oxide radical, leaves exhibiting higher total phenolic content and revealing the best antioxidant properties, followed by tegument and acorns. Concerning the phenolic profile, fifteen compounds were identified and quantified by HPLC‐ DAD, ranging from 1568.43 to

45,803.16 mg/kg dried extract. The results …

Nombre total de citations :Cité 6 fois :2017 2018 2019 2020 Articles Google Scholar :

Quercus ilex L.: how season, plant organ and extraction procedure can influence chemistry and bioactivities

L Hadidi, L Babou, F Zaidi, P Valentão, PB Andrade… - Chemistry & biodiversity, 2017

Références

Documents relatifs

A study on milling of Douglas fir bark in view of histological dissociation has highlighted that a visco-elastic plant tissue, such as the suber, deforms under impact

L'Arduino, le module RTC, le module Bluetooth et les LEDS WS2812B sont utilisés dans la partie matérielle, quant à la simulation elle a été faite sous Proteus et la

ATATTTCCTCTACCACCTACATCAC TA ATTAGCGGGGTTTTGCTCAGTACC AGGCTGACAACAAGCTG 68 ATATTTCCTCTACCACCTACATCAC TA AGAAAACGAGAATGACCATAAAT CTACGCCCCTCAAATGCTTTA 71 ATATTTCCTCTACCACCTACATCAC

L’air était encore chaud mais il savait que ce n’était pas pour cette raison qu’il transpirait et qu’il avait les mains moites.. Il les frotta nerveusement contre les

Both the over- shooting from the hydrogen burning core during main-sequence (MS) evolution (β H ) and overshooting from the convective enve- lope (β env ) affect the extent and

& Material and methods In this work, we assessed mor- phology, growth and survival of two Quercus species (Quercus ilex ssp. ballota and Quercus suber) using two different

As for any traits, expression levels of different genes may be genetically correlated, to an extent that depends on their regulation mechanism: cis-regulatory sequences that

This confirmed the production of an ADP-ribosyltransferase activity targeting RhoA by WT ST80-MRSA-IV strain (ST80) and the ΔedinB/edinB-WT strains opposite to ΔedinB