Article
Reference
Mismatches in Influenza A virus vRNA panhandle prevent RIG-I sensing by impairing RNA/RIG-I complex formation
ANCHISI, Stéphanie, et al.
Abstract
Influenza virus RNA promoter panhandle structures are believed to be sensed by RIG-I. The occurrence of mismatches in this dsRNA structure raises questions about their effect on innate sensing. Our results suggest that mismatches in vRNA promoters decrease binding to RIG-I in vivo, affecting RNA/RIG-I complex formation, and preventing RIG-I activation. These results can be inferred to apply to other viruses and suggest that mismatches may represent a general viral strategy to escape RIG-I sensing.
ANCHISI, Stéphanie, et al . Mismatches in Influenza A virus vRNA panhandle prevent RIG-I sensing by impairing RNA/RIG-I complex formation. Journal of Virology , 2016, vol. 90, no. 1, p. 586-590
DOI : 10.1128/JVI.01671-15 PMID : 26446607
Available at:
http://archive-ouverte.unige.ch/unige:79563
Disclaimer: layout of this document may differ from the published version.
1 / 1
1
Mismatches in Influenza A virus vRNA panhandle prevent
1
RIG-I sensing by impairing RNA/RIG-I complex formation
2
3
Stéphanie Anchisi1, Jessica Guerra1, Geneviève Mottet-Osman1 and Dominique 4
Garcin1* 5
1Department of Microbiology and Molecular Medicine, Faculty of Medicine, University of 6
Geneva, 1211 Geneva, Switzerland 7
*Corresponding author: [email protected] 8
9
Running title: Influenza A virus vRNA panhandle and RIG-I activation 10
11
12
Abstract:
13
Influenza virus RNA promoter panhandle structures are believed to be sensed by 14
RIG-I. The occurrence of mismatches in this dsRNA structure raises questions 15
about their effect on innate sensing. Our results suggest that mismatches in 16
vRNA promoters decrease binding to RIG-I in vivo, affecting RNA/RIG-I complex 17
formation, and preventing RIG-I activation. These results can be inferred to apply 18
to other viruses and suggest that mismatches may represent a general viral 19
strategy to escape RIG-I sensing.
20 21
JVI Accepted Manuscript Posted Online 7 October 2015 J. Virol. doi:10.1128/JVI.01671-15
Copyright © 2015, American Society for Microbiology. All Rights Reserved.
2 Detection of viral infections at the cellular level is crucial for the establishment of 22
an innate immune response. Accordingly, viruses have developed strategies to 23
circumvent this response. They can actively block the pathways involved or prevent 24
formation of viral molecular patterns sensed by specific cellular receptors such as 25
retinoic acid-inducible gene i (RIG-I) and melanoma differentiation-associated protein 5 26
(MDA5) that recognize viral RNA patterns. For RIG-I, this pattern consists of dsRNA 27
structures of various lengths, with 5’ tri- or diphosphate (5’-ppp or 5’-pp) base-paired 28
ribonucleotides (1, 2). For segmented negative strand RNA viruses, dsRNA structures 29
are found in panhandles formed by base-pairing of conserved and complementary 5’
30
and 3’ genome ends, which activate RIG-I (3, 4). To avoid detection, viruses have 31
evolved strategies to prevent their formation. Some Arenaviruses and Bunyaviruses 32
have unusual ways to initiate genome replication leading to the formation of panhandles 33
with a non-base-paired 5’-pppN overhang, or with a 5’ mono-phosphate end, 34
respectively (5-7). These structures did not activate RIG-I (7, 8) and, in the case of 35
Arenaviruses, were seen as a viral decoy strategy to prevent RIG-I activation from bona 36
fide ligands (9).
37
Influenza virus genome promoters are contained within their mostly 38
complementary genome ends, which can form 5’-ppp-blunt-ended dsRNAs with 39
conserved mismatches (Fig.1A and 3A). When these promoter sequences are bound to 40
their polymerase, the complementary genome ends cannot form dsRNA, except for a 41
region relatively distant from the 5’-ppp and 3’OH ends (10, 11). However, a fraction of 42
the flu genome promoters is likely not bound to the polymerase during infection. As 43
residues close to the 5’-ppp-blunt-end of RNA duplexes are critical for RIG-I ATPase 44
3 activity (12), the presence of mismatches in Influenza virus panhandles raises the 45
possibility that, additionally to their primary role in RNA synthesis, mismatches represent 46
a viral strategy to minimize detection by RIG-I.
47
To study the effect of these mismatches on RIG-I activation, we designed 48
synthetic dsRNAs based on the H1N1 Taïwan NS segment that mimic the influenza 49
panhandles, with or without mismatches (Fig.1A and 3A). To obtain a 5’ppp-RNA, the 50
top strand was made in vitro using a T7 polymerase. For this purpose, the initial 51
nucleotides “AG” have been changed into “GG”. The length of these panhandle-like 52
structures was extended to 30 base-pairs (bp) in Figures 1, 2 and 4 to circumvent 53
stability problems and to only monitor the effect of the mismatches. The 5’ppp-RNA 54
made in vitro was used as ssRNA control, and a dsRNA of 20 bp (“20r”) known to 55
activate RIG-I was used as a positive control (Fig.1A). We first studied the binding of 56
these dsRNAs to RIG-I. Pull-down experiments showed that RIG-I binds equally to 57
dsRNAs mimicking influenza cRNA panhandle structures with (Cmis.) or without (Cperf.) 58
mismatches (Fig.1B). Using a different approach, Liu et al have shown recently that the 59
panhandle structure without mismatches exhibited higher affinities for RIG-I (13). In 60
addition, the presence of mismatches did not influence the ability of RIG-I to form dimers 61
(2 RIG-I) on these dsRNAs, as shown by electrophoretic mobility shift assays (EMSA) 62
(Fig.1C, Cperf. and Cmis. vs ssRNA). In EMSA, addition of ATP and MgCl2 which allows 63
RIG-I ATPase activity had no effect on RIG-I dimerization, as previously observed (12).
64
Interestingly, despite the fact that these mismatches are positioned in key residues for 65
RIG-I ATPase activity (12), their presence had no effect on RIG-I ATPase activity in 66
vitro, which was higher than 20r due to their longer dsRNA length (30 vs 20 bp) (Fig.1D).
67
4 Nevertheless, when these dsRNAs were tested for their ability to activate the IFNβ 68
promoter in a luciferase-based reporter gene assay, the presence of mismatches 69
completely abrogated activation (Fig.1E). Here again Cperf. was more active than 20r 70
very likely due to its longer dsRNA length. To rule out the hypothesis of selective RNA 71
degradation, A549 cells engineered to express a GFP gene under the control of the 72
IFNβ promoter (14) were transfected with dsRNAs labeled with Cy5-fluorescent CTP.
73
A549 cells were then analyzed by flow cytometry for GFP expression (IFNβ activation) 74
and for Cy5 fluorescence (RNA stability) at 9 and 24 hours post-transfection. The results 75
confirmed that, contrary to Cperf., Cmis. did not induce IFNβ in conditions where no 76
difference in Cy5 fluorescence could be detected (Fig.2A and 2B), ruling out RNA 77
degradation as an explanation for lack of IFN induction.
78
We further tested the effect of individual mismatches (Fig.3A, Cmis.3 and 79
Cmis.5). As shown in Figure 1D for the double mismatch construct (Cmis.), the two 80
single mismatched dsRNAs induced RIG-I ATPase as efficiently as the perfect dsRNA 81
(Fig.3B). When tested for their ability to induce the IFNβ promoter in reporter gene 82
assay, the duplex with the mismatch at position 3 (Cmis.3) exhibited no stimulatory 83
activity, while Cmis.5 retained some stimulatory activity (Fig.3C, black bars). We have 84
previously shown that IFNβ promoter activation can be enhanced by pretreating cells 85
(“priming”) with IFNβ (12). Under these conditions, the inactive dsRNAs with single or 86
double mismatches now activated the IFNβ promoter, confirming that these RNAs are 87
not degraded (Fig.3C, grey bars). The observed increased RIG-I levels upon priming 88
(Fig.3C) could promote formation of an active tetrameric RIG-I complex (15), especially 89
5 for unstable RNA/RIG-I complexes, as seen for dsRNAs shorter than 13 bp (12). When 90
short dsRNAs mimicking the precise length of Influenza vRNA panhandles (13 bp) with 91
or without mismatches, G-U bonds, and an AU-tail mimicking the loop were used 92
(Fig.3A, Vperf. and Vmis.), similar results in ATPase activity, RIG-I activation in cells and 93
primed cells were obtained, with exception of Vmis. that remained inactive even in IFN 94
primed cells (Fig.3D and 3E). Taken together, these results suggested that these 95
mismatches might act by lowering the formation of the RNA/RIG-I complex.
96
To monitor the formation of the RNA/RIG-I complex, we performed “in vivo” RNA 97
pull-down experiments, after transfection of biotinylated-dsRNAs in cells over-expressing 98
RIG-I. Results presented in Figure 4A showed that significantly less RIG-I was found 99
associated with dsRNAs with mismatches as compared to perfect dsRNAs (65% vs 100
100%, Fig.4A). In order to further test this complex formation in vitro, competitions were 101
performed in RNA pull-down experiments using an excess of non-biotinylated dsRNAs 102
with (Cmis.) or without mismatches (Cperf.), in conditions where RIG-I ATPase activity 103
and related RNA recycling are allowed (12). Figure 4B shows that more RIG-I is 104
associated to the biotinylated RNA when the competitor has mismatches. This indicate 105
that the rate of RIG-I exchange is lower with a competitor carrying mismatches (50% vs 106
22% after 6 min. incubation), consistent with a lower stability of the RNA/RIG-I complex 107
in this case. As shown in Figure 4C, the rate of RIG-I exchange and related RNA/RIG-I 108
complex stability is dependent on RIG-I ATPase activity since no exchange is observed 109
in absence of ATP and MgCl2. In conclusion, mismatches as found in the panhandle 110
structures of segmented negative strand RNA viruses may prevent RIG-I activation by 111
impairing the formation of stable RNA/RIG-I complexes. As mismatches can be 112
6 observed in the panhandle structure of other segmented negative strand viruses (16), 113
the results presented here can be inferred to apply to other viruses and suggest that 114
mismatches could represent a general viral strategy to escape RIG-I sensing.
115
116
Acknowledgments 117
This work was supported by the Swiss National Science Foundation grant 118
31003A_135467.
119
Thanks to Steve Goodbourn and Richard Randall for providing the GFP-IFNβ-reporter 120
A549 cells. We also thank Daniel Kolakofsky, Laurent Roux and Mirco Schmolke for 121
their precious help discussing the project and critically reading the manuscript.
122 123
7 References
124
1. Schlee M. 2013. Master sensors of pathogenic RNA - RIG-I like receptors.
125 Immunobiology 218:1322-1335.
126
2. Goubau D, Schlee M, Deddouche S, Pruijssers AJ, Zillinger T, Goldeck M, 127
Schuberth C, Van der Veen AG, Fujimura T, Rehwinkel J, Iskarpatyoti JA, 128 Barchet W, Ludwig J, Dermody TS, Hartmann G, Reis e Sousa C. 2014. Antiviral 129
immunity via RIG-I-mediated recognition of RNA bearing 5'-diphosphates. Nature 130
514:372-375.
131 3. Liu G, Park HS, Pyo HM, Liu Q, Zhou Y. 2015. Influenza A Virus Panhandle 132
Structure Is Directly Involved in RIG-I Activation and Interferon Induction. J Virol 133
89:6067-6079.
134 4. Weber M, Gawanbacht A, Habjan M, Rang A, Borner C, Schmidt AM, Veitinger S, 135
Jacob R, Devignot S, Kochs G, Garcia-Sastre A, Weber F. 2013. Incoming RNA 136 virus nucleocapsids containing a 5'-triphosphorylated genome activate RIG-I and 137
antiviral signaling. Cell Host Microbe 13:336-346.
138
5. Garcin D, Kolakofsky D. 1992. Tacaribe arenavirus RNA synthesis in vitro is primer 139 dependent and suggests an unusual model for the initiation of genome replication. J 140
Virol 66:1370-1376.
141
6. Garcin D, Lezzi M, Dobbs M, Elliott RM, Schmaljohn C, Kang CY, Kolakofsky D.
142 1995. The 5' ends of Hantaan virus (Bunyaviridae) RNAs suggest a prime-and- 143
realign mechanism for the initiation of RNA synthesis. J Virol 69:5754-5762.
144
7. Habjan M, Andersson I, Klingstrom J, Schumann M, Martin A, Zimmermann P, 145 Wagner V, Pichlmair A, Schneider U, Muhlberger E, Mirazimi A, Weber F. 2008.
146
Processing of genome 5' termini as a strategy of negative-strand RNA viruses to 147
avoid RIG-I-dependent interferon induction. PLoS One 3:e2032.
148 8. Marq JB, Kolakofsky D, Garcin D. 2010. Unpaired 5' ppp-nucleotides, as found in 149
arenavirus double-stranded RNA panhandles, are not recognized by RIG-I. J Biol 150
Chem 285:18208-18216.
151 9. Marq JB, Hausmann S, Veillard N, Kolakofsky D, Garcin D. 2011. Short double- 152
stranded RNAs with an overhanging 5' ppp-nucleotide, as found in arenavirus 153
genomes, act as RIG-I decoys. J Biol Chem 286:6108-6116.
154 10. Chang S, Sun D, Liang H, Wang J, Li J, Guo L, Wang X, Guan C, Boruah BM, Yuan L, 155
Feng F, Yang M, Wang L, Wang Y, Wojdyla J, Li L, Wang J, Wang M, Cheng G, 156
Wang HW, Liu Y. 2015. Cryo-EM structure of influenza virus RNA polymerase 157 complex at 4.3 A resolution. Mol Cell 57:925-935.
158
11. Pflug A, Guilligay D, Reich S, Cusack S. 2014. Structure of influenza A polymerase 159
bound to the viral RNA promoter. Nature 516:355-360.
160 12. Anchisi S, Guerra J, Garcin D. 2015. RIG-I ATPase Activity and Discrimination of 161
Self-RNA versus Non-Self-RNA. MBio 6.
162
13. Liu G, Park HS, Pyo HM, Liu Q, Zhou Y. 2015. Influenza A Virus Panhandle 163 Structure Is Directly Involved in RIG-I Activation and Interferon Induction. J Virol 164
89:6067-6079.
165
8 14. Chen S, Short JA, Young DF, Killip MJ, Schneider M, Goodbourn S, Randall RE.
166
2010. Heterocellular induction of interferon by negative-sense RNA viruses. Virology 167 407:247-255.
168
15. Wu B, Peisley A, Tetrault D, Li Z, Egelman EH, Magor KE, Walz T, Penczek PA, 169
Hur S. 2014. Molecular imprinting as a signal-activation mechanism of the viral RNA 170 sensor RIG-I. Mol Cell 55:511-523.
171
16. Weber M, Weber F. 2014. Segmented negative-strand RNA viruses and RIG-I: divide 172
(your genome) and rule. Current opinion in microbiology 20:96-102.
173 17. Hausmann S, Marq JB, Tapparel C, Kolakofsky D, Garcin D. 2008. RIG-I and 174
dsRNA-induced IFNbeta activation. PLoS One 3:e3965.
175
18. King P, Goodbourn S. 1994. The beta-interferon promoter responds to priming 176 through multiple independent regulatory elements. J Biol Chem 269:30609-30615.
177 178
179
9 Figure legends
180
Fig.1. Mismatches do not affect RIG-I binding and ATPase activity but prevent 181
IFNβ activation 182
(A) Sequence of the RNAs used to mimic the Influenza cRNA panhandle structures with 183
(mis.) or without (perf.) mismatches. (B) RIG-I binding. RNA pull-down assays were 184
performed using 13 pMoles of biotinylated RNA ligands (as previously described, (12)) 185
and 13 pMoles of HIS-RIG-I (17). Reactions were analyzed by Western-blot using anti- 186
Histidine antibody (1:2000, H1029 SIGMA). (C) RIG-I oligomerization was monitored 187
using Electrophoretic Mobility Shift Assay (EMSA). Radiolabeled RNAs (25 pm) were 188
incubated with purified HIS-RIG-I (50 pm RIG-I). Reactions were analyzed on native 189
gradient acrylamide gel and revealed by phosphorimaging (Typhoon, GE Healthcare Life 190
Sciences) (12). (D) RIG-I ATPase activity. Purified RIG-I was incubated at 37°C with [γ- 191
32P]ATP in the presence of various RNA ligands as indicated. Data are represented as 192
the mean ± SEM (N=4). Significance: NS = p>0.05, (*) 0.01≤p<0.05, (**) p<0.001 (12).
193
(E) IFNβ-promoter activation. A549 cells were transfected with luciferase-based reporter 194
gene plasmids (pβ-IFN-fl-lucter, which encodes the firefly luciferase gene driven by the 195
human IFNβ promoter (18), pTK-rl-lucter, which encodes the Renilla luciferase gene 196
(PROMEGA) driven by the herpes simplex virus thymidine kinase promoter) and 197
increasing amount (200, 400, 800 ng) of the indicated RNAs. Relative luciferase 198
activation (IFNβ fold induction) was calculated by normalization to the mock and is 199
represented as the mean ± SD (n=2) (12).
200 201
Fig.2: Mismatches do not affect RNA stability 202
10 (A-B) IFNβ-promoter activation. A549/pr(IFN-β).GFP reporter cells (14) were transfected 203
with 400 ng of the indicated RNAs for 24 hours before FACS analysis. (A) Top panel 204
shows white light (WL) and fluorescence (GFP) microscope pictures. Bottom panel 205
shows flow cytometry data. Results are plotted as a percentage GFP (x axis) positive 206
cells. Data are represented as mean ± SD (n=2). (B) RNA stability. A549/pr(IFN-β).GFP 207
reporter cells were transfected with Cy5-labeled RNAs and Cy5 fluorescence monitored 208
over time by FACS analysis. Results are plotted as percentage of Cy5 or GFP positive 209
cells. Data are represented as mean ± SD (n=2). Bottom panel shows representative 210
plots of the FACS data. Results are plotted as a percentage of Cy5 (x axis) and GFP(y 211
axis) positive cells.
212 213
Fig.3: A single mismatch on dsRNA is enough to limit IFNβ induction 214
(A) Sequence of the RNAs used. (B) RIG-I ATPase activity. Purified RIG-I was 215
incubated at 37°C with [γ-32P]ATP in the presence of various RNA ligands as indicated.
216
Data are represented as the mean ± SEM (N=4). Significance: NS = p>0.05, (*) 217
0.01≤p<0.05, (**) p<0.001 (12). (C) IFNβ-promoter activation. A549/pr(IFN-β).GFP 218
reporter cells were transfected with 500 ng of the indicated RNAs for 24 hours, with or 219
without IFNβ treatment 6 hours prior to transfection. Top panel show the percentage of 220
GFP positive cells measured by FACS analysis. Data are represented as the mean ± SD 221
(n=2). Bottom panels show the intracellular level of RIG-I analyzed by Western blot. As a 222
loading control, the membrane was stained with Coomassie blue after immunoblotting.
223
(D) RNA-induced ATPase activity of RIG-I. Purified RIG-I was incubated at RT with [γ- 224
32P]ATP in presence of various RNA ligands as indicated. Data are represented as the 225
11 mean ± SEM (N=5). Significance: NS = p>0.05, (**) p<0.001. (E) IFNβ-promoter 226
activation. A549/pr(IFN-β).GFP reporter cells were transfected with 500 ng of the 227
indicated RNAs for 24 hours, with or without IFNβ treatment 6 hours prior to transfection.
228
Results are plotted as the percentage of GFP positive cells measured by flow cytometry.
229
Data are represented as the mean ± SD (n=2).
230
231
Fig.4: Mismatches destabilize the RNA/RIG-I complex formation 232
(A) “in vivo” RIG-I binding. 293T cells were first transfected with pEF-Bos-RIG-I (2 µg) 233
for 24 hours and then transfected with 2 µg of biotinylated perfect cRNA (Cperf.), or 234
mismatch RNA (Cmis.). As a control cells were transfected with 2 µg of biotinylated 235
ssRNA. 2 hours post-RNA transfection, cells were lysed and lysates incubated with 236
Streptavidin beads for 2 hours at 4°C to pull-down RNA-bound RIG-I. Reactions were 237
analyzed by Western-blot using anti-RIG-I antibody (Enzo Life Sciences, ALX-804-849- 238
C100). Data are represented as the mean ± SD (n=2). (B) Competition in RNA pull- 239
down. 13 pMoles of biotinylated perfect cRNA have been bound to Streptavidin beads 240
for 2 hours at 4°C. 13 pMoles of HIS-RIG-I protein have been added to the reactions for 241
15 min at 37°C. A competition assay was performed with a 3 fold excess of either non- 242
biotinylated perfect cRNA (Cperf.) or mismatch cRNA (Cmis.) for 1, 3 or 6 min. at 37°C, 243
in presence of ATP and MgCl2. RIG-I binding was monitored by western blot and 244
quantified using anti-RIG-I antibody. After quantification, results were plotted as the 245
percentage of RIG-I remained bound to the beads in function of the time. Data are 246
represented as the mean ± SD (N=5). (C) Competition in RNA pull-down. 13 pMoles of 247
biotinylated perfect cRNA have been bound to Streptavidin beads for 2 hours at 4°C. 13 248
12 pMoles of HIS-RIG-I protein have been added to the reactions for 15 min at 37°C. A 249
competition assay was performed with a 3 fold excess of either non-biotinylated perfect 250
cRNA (Cperf.) for 1, 3 or 6 min. at 37°C in absence or presence of ATP and MgCl2 as 251
indicated. RIG-I binding was monitored by western blot and quantified using anti-RIG-I 252
antibody. A representative experiment is shown. Western Blot quantifications were 253
performed using ImageJ version 1.44p (Rasband, W.S., ImageJ, U.S. National Institutes 254
of Health, Bethesda, Maryland, USA, http://imagej.nih.gov/ij/, 1997-2015).
255
FIG 1
Input - RNA ssRNA C perf. C mis.
RNA Pull Down
ATP+Mg
RIG-I +-
++ +- +- ++ +- +- ++ +-
ssRNA C perf. C mis.
1 RIG-I 2 RIG-I
unbound
RNA Rel. ATPase activity
- RNA 20r
ssRNA C perf. C mis.
** *
0 2 4 6 8
A B
C D
E
20r 5’ GCGCACCGGGGAACCAAGGCGAACACGGACA...
3’ CGCGUGGCCCCUUGGUUCCGU
5’ GGCAAAAGCAGGGAGACAAAGACAAAAAGGC
ssRNA
5’ GGCAAAAGCAGGGAGACAAAGACAAAAAGGC 3’ CCGUUUUCGUCCCUCUGUUUCUGUUUUUCCG
C perf.
5’ GG A AAGCAGGGAGACAAAGACAAAAAGGC 3’ CC U UUUGUCCCUCUGUUUCUGUUUUUCCGU C
C mis. C A
0 10 20 30 40
IFNß fold induction
Mock 20r C perf. C mis.
FIG 2 A
B
Mock 20r C perf. C mis.
WL
GFP
20 40 60
10
+ % GFPcells 0 + %GFPcells
0 20 40 60
Mock ssRNA C perf. C mis. Mock ssRNAC perf. C mis.
24hrs 9hrs 9hrs
24hrs
2040 6080 100
%Cy5+ cells 0
Mock
GFP
Cy5
ssRNA C perf. C mis.
24hrs 9hrs
FIG 3
C
20 40 60 80
0 100
Mock C perf.
-IFNß +IFNß
C mis. C mis.3 C mis.5
% GFP+ cells
Mock C perf. C mis. C mis.3 C mis.5 - + - + - + - + - + IFNß
RIG-I
Rel. ATPase activity
20r
C perf. C mis.
0 2 4 6 8
C mis.3 C mis.5
B
5’ GG AAAAGCAGGGAGACAAAGACAAAAAGGC 3’ CC UUUUUGUCCCUCUGUUUCUGUUUUUCCGU
C mis.3 C
5’ GGCA AAGCAGGGAGACAAAGACAAAAAGGC 3’ CCGU UUUGUCCCUCUGUUUCUGUUUUUCCGC
C mis.5 A
5’ GGGAGAAACAAGGGCGGCAACAACCAACAAA 3’ CCCUCUUUGUUCC
V perf.
5’ GGGAGAA CAAGGGCGGCAACAACCAACAAA 3’ CCUUUUU GUCCCC
V mis. A
A
E
5 10 15
0 20
Mock ssRNA -IFNß +IFNß
C perf. C mis. V perf.
% GFP+ cells
V mis.
D
Rel. ATPase activity
C perf. C mis.
0 2 4
V perf. V mis.
NS
NS NS
AUUUUAA AUUUUAA
FIG 4 A
- RIG-I RNA -
Input - + + + + P P M ss -
Pull-down - + + + + P P M ss -
RIG-I
Actin
B
100
0 2 4 6
Time (min.)
C perf.
C mis.
% RIG-I bound
50 -
Time (min.) 0’ 1’ 3’ 6’ 1’ 3’ 6’
C perf. C mis.
Compet.
50 0
C perf. C mis. ssRNA -
±16.6100
±10.565.3
14.1±1.1 5.2
% RIG-I bound ±0.9
100
C
C perf.
Time (min.) 1’ 1’ 3’ 3’ 6’ 6’
ATP + Mg + - + - + -
100
2040 6080
1’ 3’ 6’
+ ATP - ATP
Time (min.)
% RIG-I bound 0
