Thesis
Reference
Ecology and genetics of the rare plant "Aster amellus" L. in a fragmented landscape
MAYOR, Romain
Abstract
La fragmentation du paysage a été reconnue comme l'une des forces agissant négativement sur la biodiversité. L'isolement peut perturber l'échange de gènes entre les populations, favorisant des déséquilibres de Hardy-Weinberg et augmentant ainsi dramatiquement des risques de chute de "fitness" par consanguinité. Dans le but de mettre en évidence une potentielle érosion génétique d'espèces en situation de fragmentation, nous avons étudié 31 populations du rare "Aster amellus" L. 7 marqueurs microsatellites analysés sur 2600 individus ont montré des fortes situations de "drift" et de consanguinité dans les populations isolées, ceci notamment dû à un flux de gènes usuels limité à une distance de 30m. La dépression de "fitness" par consanguinité a été détectée, ces effets se sont révélés être purement génétiques, puisque 865 relevés de végétation nous ont permis de contrôler sur des possibles artefacts écologiques. Ceci implique une menace de déclin des populations en situation de fragmentation.
MAYOR, Romain. Ecology and genetics of the rare plant "Aster amellus" L. in a fragmented landscape. Thèse de doctorat : Univ. Genève, 2008, no. Sc. 3996
URN : urn:nbn:ch:unige-6328
DOI : 10.13097/archive-ouverte/unige:632
Available at:
http://archive-ouverte.unige.ch/unige:632
Disclaimer: layout of this document may differ from the published version.
de biologie végétale Dr. D. Aeschimann
Ecology and Genetics of the Rare Plant Aster amellus L.
in a Fragmented Landscape
Thèse
présentée à la Faculté des Sciences de l’Université de Genève pour obtenir le grade de Docteur ès sciences, mention biologie
par
Romain Mayor de
Genève (GE)
Thèse - 3996 -
Genève 2008
La Faculté des sciences, sur le préavis de Messieurs R. SPICHIGER, professeur ordinaire et directeur de thèse (Département de botanique et de biologie végétale), D. AESCHIMANN, docteur et codirecteur de thèse (Département de botanique et de biologie végétale), M.
FISCHER, professeur (University of Bern, Institute of Plant Sciences, Bern, Switzerland) et de Madame C. LAMBELET, docteur (Conservatoire et Jardin botaniques de la Ville de Genève, Chambésy, Suisse) autorise l’impression de la présente thèse, sans exprimer d’opinion sur les propositions qui y sont énoncées.
Genève, le 30 juin 2008 Thèse - 3996 -
Contents
Chapter 1 General Introduction 5
Chapter 2 Identification and characterization of eight 19 microsatellite loci in Aster amellus L. (Asteraceae)
Chapter 3 Inbreeding and inbreeding depression in the rare perennial 27 Aster amellus L. in natural conditions with biotic and
ecological interactions
Chapter 4 Effects of distance, density and population size on 51 gene flow in the rare Aster Amellus L.
in a fragmented landscape
Chapter 5 Effects of ecology and genetic among fragmented 75 populations of the long-lived Aster amellus L. in
experimental conditions with biotic and abiotic treatment
Chapter 6 Synthesis 97
Résumé 102
References 107
Remerciements 117
Appendix 119
Chapter 1
General Introduction
This thesis deals with the effects of fragmentation on a rare plant species. We will first introduce the theoretical background and present general aspects of the study, thus giving the reader the option to go directly to the synthesis in the final chapter. The corpus of the thesis (Chapters 2 to 5) itself presents important information including graphics and details of procedures. Complementary information, provided in the introduction, can help to understand the corpus, but care has been taken to avoid overlap of contents.
From Sadi Carnot to fragmentation
In the last 20 years, there has been an increasing interest in the population biology of wild species to assess the threats induced by human activity. Indeed, since the thermodynamic treatises of Sadi Carnot (1824), it has expanded from a rural lifestyle to an urban and industrialised one. Extensive farming has been replaced by intensive farming: traditional, fragmented, agricultural land has been grouped to form extended areas without natural habitats, and semi-natural habitats have been abandoned. This has had three evident effects.
The first is the destruction of habitat leading a given population directly to its death. The second is the reduction of habitat size. The third is the fragmentation of remnant populations.
We will focus on the effects of fragmentation which, as we will see, are intimately bound to the first two effects. Other consequences of the industrial revolution, such as pollution, are not considered in this study.
Fragmentation
Fragmentation is the process whereby one unified entity is divided into smaller entities. For a group of individuals called a population, living in a given landscape and participating together in reproduction, fragmentation of the landscape has two major impacts. First, one big
population breaks up into several small populations which form a metapopulation; second,
individuals previously “connected” in the reproduction process become isolated, impeding in this way the maintenance of panmixia.
Small and isolated populations are more susceptible to perish through stochastic processes such as environmental perturbation, demographic change, and genetic drift (Shaffer 1987). They have to face a diminution of gene flow and therefore an increase of inbreeding and the perpetuation of genetic drift without possible rescue.
In order to tackle the fragmentation issue, we studied a rare plant whose populations are like islands surrounded by intensive farming and urban areas.
Inbreeding
Inbreeding is caused either by autofecondation or by non-random association of conspecifics in the reproduction process (Keller & Waller 2002). As a general consequence, an increasing number of individuals in the subsequent generations become homozygote at different loci.
From generation to generation, the number of homozygote loci increases at the individual level and thus at the population level.
In order to assess inbreeding in small populations, we analysed the mean observed heterozygosity of the populations with 7 microsatellite markers, and related it to census sizes of the populations. Microsatellites are small regions in the DNA where base pairs are repeated in sequences of 1bp to 4bp. They are neutral codominant markers, thus ideal for studying inbreeding, drift and gene flow (Estoup et al. 1998; Ouborg et al. 1999; Ross et al. 1999).
Drift
Drift is a stochastic process in which the set of alleles of a population at generation t0 is progressively lost in subsequent generations (Ellstrand & Elam 1993). The reason for this is that in the reproduction process, one individual gives only half of its alleles to one offspring.
Drift is less visible in large populations where the initial diversity of alleles at t0 is nearly preserved because the possibility for an individual to give more than half of its alleles is increased by the number of fecundation events. Moreover if a certain allele is rare in a given population (large or small), its chance of being transmitted to the next generation is enhanced if it is carried by a larger number of individuals, i.e. in larger populations. This leads us to the concept of purge (see section on purge).
In order to assess genetic drift in small populations, we analysed the average gene diversity of populations with seven microsatellite markers and related it to census population sizes.
Inbreeding depression and drift depression
The threat of inbreeding is inbreeding depression. Three cases of inbreeding depression are postulated: the lethal recessive case, ovedominance, and partial dominance. The lethal recessive case is characterised by a strong selection on inbred genotypes which give no chance of survival. Overdominance is the case where homozygotes are less fit than
heterozygotes; this permits survival of inbred individuals, but with a genetic load implying a constant pressure on the individual’s fitness. Partial dominance is the case where slightly or mildly deleterious recessive alleles are partially masked by dominant alleles (Charlesworth &
Charlesworth 1987; Leberg & Firmin 2008).
Drift depression occurs when the variability of alleles is diminished through genetic drift, thus decreasing the capacity of a population to adapt itself to changing conditions (Barrett & Kohn 1991) (see section on purge). Moreover, loss of alleles could lead to inbreeding by drift (Jacquard 1968; Glémin 2003) resulting in cases similar to those of inbreeding.
In order to detect inbreeding depression in natural conditions and in controlled ex situ conditions, we measured fitness traits of plants and related them to the level of inbreeding measured with microsatellite markers.
Purge
A purge is the possibility of a given population to eliminate deleterious alleles. It may simply happen by genetic drift (case were drift has a positive effect) or by inbreeding (Glémin 2003).
In both cases, small populations have a greater chance to experience a purge. The reason for this is that deleterious alleles are better conserved in large populations, either through lack of drift or through maintenance of deleterious alleles among heterozygous individuals. Purge may be viewed as a possible rescue for small populations, but it should not be thought of as having a generally positive effect. A good example of this is the maintenance of high polymorphism of melanin genes in insect species (True 2003); the debate about the role played here by selection is ongoing, but variability seems to be important in this case although a morph is not always advantageous. In our study, we did not test whether a purge occurred, but we introduced this term because a purge may lead to failure in the detection of inbreeding effects in small populations. Moreover we were faced with a confusing pattern between purge and maternal effects in ex situ experiments (see Chapter 5).
Gene flow
Gene flow is the process whereby genes “travel” throughout an entire population or among the populations of a metapopulation. In plants, gene flow is mediated by pollen dispersal, seed dispersal (Levin & Kerster 1974) and clonal propagation (Johansson 1993; Johansson &
Nilsson 1993). A panmixia situation is produced by gene flow between individuals of a population. Any interruption in gene flow causes a rift in panmixia. The longer the
interruption, the more we loose panmixia. One current rule says that one migrant per generation is sufficient to maintain panmixia in a metapopulation (Wright 1931). However simulations showed that 5 to 20 migrants are not sufficient to reach a Hardy-Weinberg equilibrium between populations (Lacy 1987) . Rupture of gene flow increases situations of genetic drift and in this way prevents rescue by heterosis.
In this study, we analyse how gene flow is influenced by fragmentation parameters:
isolation by density in terms of number of surrounding individuals around one individual and number of surrounding populations around one population, isolation by size of populations in terms of the number of counted individuals in a given site and isolation by distance.
Ecological parameters
We have seen how genetic parameters can influence the fate of populations; however fate of populations can also be driven by physical abiotic or biotic pressures. This is what we call environmental stochasticity (see section on fragmentation). In plant species, ecological parameters are extremely important because fate lies there: to stay in place alive or to die.
Playing an evident role among fitness traits of plants, ecological parameters clearly act as a noise relative to inbreeding effects, and a measured negative fitness trait in small populations could be due to inadequate habitat conditions. Typically, a clearing that closes under pressure from lignified species will create shade which is disadvantageous for herbaceous plants and this inadequate environment will cause deleterious fitness traits in herbaceous plants.
In order to control but also to assess the effects of ecological parameters on measured fitness traits in natural conditions and in ex situ experiments, we used ecological factors of Landolt (1977) based on 865 square-metre vegetation surveys ; other ecological parameters were altitude and vegetation height.
Studied species
We studied Aster amellus L. (AA) from the Asteraceae family for different reasons. First, it belongs to the angiosperm group of the plant kingdom. Angiosperms present several characteristics which are ideal for the study of inbreeding in natural and experimental conditions. They are easy to recognize and their taxonomic situations are in most cases well defined. Because of their stationary property, counting them and assessing their ecological parameters was simple.
Reproductive systems of plants present a great variety of cases ranging from apomixes to complete outbreeding. Reproduction could be monitored via caging experiments. Moreover, plant behaviour was controlled through experimental conditions where plants were submitted to various controlled biotic and/or abiotic pressures. Second, AA is a rare plant living in calcareous grasslands which are typically fragmented habitats through change in land use (Zoller & Wagner 1986b; Zoller & Wagner 1986a; Stöcklin et al. 2000; Köhler et al. 2005).
Indeed populations of AA are like islands in an intensive agricultural landscape, forming an ideal model to study fragmentation effects.
Distribution of the species
Aster amellus is a central-European species. Its north-east distribution limit is West Siberia by the Tobol river (57°14’N/67°2’E) and its south-west limit is South-West France in the Tarn (44°5’N/3°5’E). The distribution area is interrupted by the Alps (Jäger 1992) (Fig. 1). Our study is situated in the western range of the species (Fig 1).
Fig. 1 Area distribution of Aster amellus L. ( ____ ), A. amelloides Bess. ( _|___|_ ) and A. ibericus M. Bieb. ( _||___||_ ) (Jäger 1979). 1: 57°14’N/67°2’E, +- Aleksandrovska, E Tyumen (Russia); 2: 52°38’N/16°30’E, +- Poznan (Poland); 3: 42°N/21°27’E, Skopje (Macedonia); 4: 49°N/12°E, +- Regensburg (Germany); 5:
51°18’N/12°E, +-Leipzig (Germany); 6: 48°20’N/2°50’E, +- Montereau, S Paris (France); 7: 44°5’N/3°5’E, Millau, E Toulouse (France); 8: Extreme SW and NE studied populations limiting the study area:
45°57’N/5°54’, +- Seyssel (France), S Genève and 47°32’N/8°10’E, +- Brugg, NW Zürich (Switzerland).
Ecology of the species
Aster amellus is a concurrent-stress-strategic species (Frank & Klotz 1990). It grows in warm hilly to montane areas, in limestone substrates with carbonated to eutrophic humus, normally on basic to neutral pH, in dry soils (mesophilic to xerophilic species); the substrate materials are gravel, calcareous sand, clay, loess and silts. AA is a heliophilous to semi-heliophilous species growing in grasslands, clearings, edges, slopes, waysides and clear forest (Rameau et al. 1989) . It belongs to several phytosociological groups: Festuco-Brometea (Mesobromion), Geranion sanguinei, Berberidenalia, Quercion pubescenti-petraeae, Cephalanthero-fagion, Erico-pinetelia (Molinion pinion) (Rameau et al. 1989; Delarze et al. 1998; Oberdorfer et al.
2001). The Flora of SSSR (Tamamshyan 1959) indicates the same types of biotopes. In our
study we were mainly concerned with Geranion sanguinei and Molinion pinion, but variants as listed above were also observed.
Morphological descriptions with data measured in natural conditions
AA is a hemicryptophyte perennial plant with (1)-5-(30) cm rhizomes (observed). One genet produces (1)-3-(68) straight pubescent stems to a height of (3)-35-(83) cm. From the ground to the terminal capitulum (with bracts under the capitulum), a stem produces (3)-21-(43) leaves which are rough like a cat’s tongue, with a lanceolated to oval shape and a dark greenish colour. Inferior leaves are attenuated by a petiole and measure (1.7)-6-(15.1) cm length (with petiole) and (0.6)-1.7-(4) cm width. One stem produces (1)-4-(34)capitula with lilac ligulated female flowers and yellow tubulous flowers, producing 0.1 to1.5 mm-wide dark-brown pubescent cypselae, weighing (0.1)-0.47-(1.2) mg with a whitish to yellowish pappus of around 4 mm length. As vegetative parts, AA also produces (1)-3-(22) rosettes with (2)-5-(12) long leaves attenuated by a petiole and measuring (1)-7.6-(17.7) cm length (with petiole) and (0.6)-2.2-(5.2) cm width. We observed these values in in situ conditions, but some experimental conditions showed a drastic increase in plant production, for example stems carrying more than 400 capitula (Chapter 5).
Reproduction
Aster amellus is known to be entomogame but self-compatibility was mentioned (see Chapter 3 for details). Seeds are mainly dispersed by wind but only over short distances (see Chapter 4) and seed banks are known to be transient (Thompson et al. 1997; Cerabolini et al. 2003) (see Chapter 5). Clonal propagation is possible by production of lateral ramets, but was not found to be high except in certain situations. For example, in one site we collected three separate DNA samples in a 50-cm-long patch filled with ramets separated from each other by
less than 5 cm where we observed no microsatellite variation; Bonnier & Douin (1990) also signalled multiplication by the underground system. In our study we considered AA as an outbreeder and we collected DNA from sufficiently separated individuals.
Biotic interaction
The biotic sphere of AA individuals encompasses surrounding conspecifics, surrounding plant species, parasitic strikes and herbivory (see Chapter 3), mycorhizal associations, and
pollinators. Münzbergová (2006) studied the effect of the ploidy level of Aster amellus on plant–herbivore interaction. Mycorhizal association is under study (Hanka Plachá). In our study, 238 plant species were in competition with Aster amellus.
Overview of measurements
Between September 2003 and 2007 we worked with 19 to 31 populations of Aster amellus along the Jura (France–Switzerland). Populations were situated in three main regions, Upper Savoy, the Geneva Basin and Aargovia, and in one small region, Le Landeron (see Chapter 3 for map).
Population size
In the 31 studied sites, we counted the number of individuals at each 2m/2m square of the populations (see Chapter 4 for details) and we calculated the total population size. Each count was geopositioned in order to obtain one map of the density of individuals per population.
Genetic parameters
Two thousand six hundred individuals from 31 populations were analysed through seven microsatellite markers developed at the Botanical Garden of Geneva (Chapter 2; eight
markers are presented but only seven were finally used). We defined the level of inbreeding per population by the mean observed heterozygosity and average gene diversity per
population (Chapter 3). Moreover we calculated the Fst matrix of populations and kinship coefficients of individuals, and other related statistics (spatial autocorrelation, Sp statistics) (Chapter 4). Finally we calculated estimators of population sizes with a linkage
disequilibrium method and with a coalescent approach (Chapter 4).
Ecological parameters
Eight hundred and sixty-five vegetation records were made in 31 populations in order to assess ecological parameters of the populations (see Chapter 3 for method and table of population characteristics). We defined the humidity, luminosity and nutritive substances of the sites. Moreover we used the herbaceous vegetation height which we measured in each site and the altitude of sites as other environmental covariates.
Growth experiment
We set up ex situ experiments in different soil conditions as an abiotic treatment and under competition with a perennial herb, Bromus erectus, as a biotic treatment. Around 400 plants from 23 to 31 populations were used in each treatment, resulting in a total of 1200 plants (with individuals in the benign conditions) (Chapter 5). Moreover we set up one in situ experiment in order to obtain a treatment integrating all natural pressures, but growth was very low and mortality very high so this experiment could not be compared with ex situ experiments.
Measurement of fitness
Between 2003 and 2005 we collected cypselae in 19 to 31 populations and measured germination rates in chamber conditions and in in situ conditions.
Between 2005 and 2007, we followed 1600 individuals marked with stakes in 31 populations. We noted whether they were in reproductive or in vegetative form. In 2005 and 2006, we measured phenotypic plant traits: number of rosettes, number of stems, number of leaves, length and width of leaves, number of capitula, number of cypselae, weight of cypselae, and germination rate (2005) (Annex 2). We noted also the number of parasited leaves and the number of infected cypselae (see Chapter 3). We calculated cumulative
vegetative production, reproductive production, reproductive output, and cumulative parasitic strikes.
In our ex situ experiment we measured the same fitness traits as in natural conditions, except for the germination rate and parasitic strikes (Chapter 5) (Annex 3).
Structure of the thesis
Chapter 2 presents the characterisation of eight microsatellite markers with technical indications and linkage disequilibrium tests.
Chapter 3 assesses the effect of population size on the levels of inbreeding and genetic drift. We then analyse the effect of inbreeding depression on separate and cumulative fitness traits measured in natural conditions. Ecological parameters were analysed as covariates with heterozygosity and their interactions were also tested.
Chapter 4 analyses the effect of fragmentation parameters (isolation by density, isolation by population size, isolation by distance) on gene flow within and between
populations. Census sizes of populations are also compared with effective sizes inferred from molecular markers.
Chapter 5 analyses the effect of inbreeding depression on separate and cumulative fitness traits in ex situ conditions with biotic and abiotic treatments. We monitored the effects of ecological parameters in source populations. We also analyse the effect of inbreeding depression on the germination rate in in situ conditions and in chamber conditions using cypselae collected over three years; ecological influences and maternal effects are examined.
Finally we present one small seed stock experiment which was carried out to assess the viability of seeds in natural conditions.
Chapter 6 summarizes our findings and conclusions, and is appended with a French summary.
Chapter 2
Identification and characterization of eight microsatellite loci in Aster amellus L. (Asteraceae)
with Y. Naciri Molecular Ecology Notes (2007) 7, 233-235
Abstract
Eight polymorphic microsatellites were developed in the perennial herbaceous Aster amellus L. (Asteraceae), and characterized on three populations from France and Switzerland. The number of alleles ranged between 4 and 30 depending on the locus, and mean number of effective alleles was 5.8. The average gene diversity equalled 0.744 (range: 0.419-0.957) and the overall differentiation was found significant (θ = 0.092, P <0.01). Three loci displayed significant heterozygote deficiencies, which might indicate the presence of null alleles.
Amplifications were detected on eight loci in Aster alpinus L.
Keywords: Aster amellus L., Aster alpinus L., microsatellite, fitness, population genetics, conservation.
Aster amellus L. is a perennial species widespread in central Europe. It is locally endangered in Switzerland (Moser et al. 2002). Fragmented landscape and abandoned management are suspected to be the main reasons for the observed population decrease. One consequence of such a decrease is the perturbation of the breeding system (Widén 1993). Microsatellite markers were developed in order to analyse inbreeding rate and to infer the species genetic structure at a regional scale.
Estoup and Martin’s protocol (1996) was used for microsatellite isolation and
characterisation. Total DNA extraction was achieved following Doyle and Doyle’s protocol (1987). DNA was digested using HaeIII, RsaI and AluI (Qbiogen), and the mung bean exonuclease was used to fill out sticky ends. Digested fragments were ligated into
pUC19/SmaI/BAP plasmid following the manufacturer’s protocol (Amersham Pharmacia) for blunt-end cloning. DH5α competent cells (Invitrogen) were transformed using the ligation product. Two libraries were necessary to obtain a sufficient number of usable loci. 10,000 clones were pricked out in total and transferred on Hybond-N+ membranes (Amersham).
(TCT)8, (AAT)8, (AG)10 and (AC)10 DIG labelled oligonucleotides were used as probes for the hybridization phase and positives clones were detected with the anti-DIG-AP antibody (Roche Molecular).
A total of 174 positive clones were found and sequenced and 99 contained at least one microsatellite motif. We found 22 Poly(A) (9≤n≤64), 13 (CA)n (7≤n≤24), seven (GA)n
(9≤n≤53), four (TAA)n (13≤n≤19), two (GAA)n (7≤n≤9), one (CTAA)11, four perfect compound motifs (15≤n≤32), 27 imperfect motifs (8≤n≤37), and 19 compound imperfect motifs (13≤n≤22).
We selected 18 loci, for which unlabelled reverse and fluorescent forward primers were designed manually because most of the microsatellite flanking regions were located in areas composed of repeated but imperfect motifs (Genebank accessions DQ514673-DQ514680 and
DQ534911-DQ534920). Nonetheless, we checked for the absence of dimer formation in all pairs of primers with OLIGO 4.0-s® software (National Bioscience Inc.). Preliminary tests allowed discarding 10 loci, because of non specific amplifications or high suspicion for null alleles. The eight remaining loci were screened on ABI377 automated sequencer and scored using GENSCAN ANALYSER® software version 3.1 (Applied Biosystems). 90 individuals from three large populations of Aster amellus L. (Pâquis: Haute-Savoie, and Sergy: Bassin
Genevois, France; Nätteberg: Argovie, Switzerland) were DNA extracted using an enzymatic method modified from Manen et al. (2005): after 6h incubation leading to complete cell walls digestion, 2μl of AGOWA® magnetic particles with 100μl of AGOWA® binding buffer were used to isolate DNA from cell components. The DNA, fixed on magnetic particles, was
washed two times and then eluted in 60μL TE PH8. PCR were made using the QIAGEN®
Multiplex kit which provides a Multiplex PCR Master Mix already containing HotStartTaq®
DNA polymerase, a multiplex PCR buffer at 6mM MgCl2, dNTPs and a factor MP which improves annealing and elongation. The following conditions were applied: 15 min at 95°, 35 cycles composed of 30 s at 94°, 90 s at annealing temperature (Tm, Table 1), 60 s at 72°, followed by 30 min of final extension at 60°. Multiplexing was performed using a set of three primer pairs at 58°C annealing and a set of five primer pairs at 62°C annealing (Table 1).
PCRs were conducted in a final volume of 5μL with 2.5μL Master Mix, 0.5μL primers mix (10μM each in initial volume), 1μL H2O and 1μL DNA. The results were analysed using
FSTAT 2.9.3. (Goudet 2001) . Bonferroni corrections were carried out in multiple tests for adjusting the nominal levels.
A high polymorphism was found with a number of alleles ranging from 4 (Aam.J15) to 30 (Aam.D10) overall individuals (Table 1). Allelic richness per population was very close to the census number of alleles due to the balanced sampling (Rs range: 2.0-21.7). Mean number of
effective allele was 5.8 (Ne range: 1.7-15.9), indicating that about half of the alleles were rare or not frequent.
Positive and significant deviations from Hardy-Weinberg Equilibrium were found for three loci (P = α/8, Table 1): Aam.H231 for Pâquis, Aam.B3 for Pâquis and Nätteberg and Aam.D10 for Pâquis and Sergy. Aam.D10 is a long microsatellite (GA)38, for which the presence of multiple Stutter bands could have hidden the presence of a nearby allele. Such misleading records would result in heterozygotes underestimation, but do not explain that a non significant Fis was found in Nätteberg. The presence of null alleles is therefore suspected for these three loci at least in some populations. Negative deviations from HWE were
detected for Aam.J15 but with non significant Fis. The systematic excess in heterozygotes found for this locus could be due to undetected amplification artefacts or to balanced selection.
The overall differentiation was equal to θ = 0.092 (P <0.01). Linkage disequilibrium was not detected at the 5% level in any of the three populations (P < 0.05/28), which indicates
physical independence of the eight loci.
The eight loci were tested separately on Aster alpinus L. All loci gave successful
amplifications except Aam.A12 for which two individuals did not amplify (Table 2). The number of alleles ranged between one and seven. Although some loci showed secondary peaks (Aam.A12, Aam.H231, Aam.B3, Aam.D10, Aam.J15, Aam.G431), amplifications were detected within the allele size range of A. amellus or in the very close vicinity, except for Aam.J15 (Table 2).
The microsatellite loci described here will be used to assess the genetic differentiation of Aster amellus L. at a regional scale and to address the question of the effect of fragmentation on genetic diversity.
Acknowledgements
We wish to thank S. Caetano and R. Niba for technical assistance, Drs. D. Aeschimann and C.
Lambelet for having provided financial support, C. Habashi as well as I. & T. Lindenberger for their help in the field and Prof. R. Spichiger for his support.
Motif GenBank Primers Dye Tm Size range Nb Nat Pop Na Rs Ne Ho He Fis Aam.F58 (GT)11 DQ514673 5'GATAGAGTGTTTGTCTGTGAGTG3' VIC 58 74-88 30 13 Pâquis 8 7.9 4.627 0.733 0.798 0.081ns
5'TGTGGAACCCCTAAGCCG3' 30 Sergy 8 8 6.294 0.967 0.853 -0.133ns
30 Nätteberg 8 8 3.6 0.733 0.734 0.002ns Aam.A12 (TAA)18 DQ514674 5'GGCATAAAAACATTCCTATACG3' NED 58 97-139 29 12 Pâquis 6 6 2.339 0.586 0.583 -0.006ns
5'ATTCAATTAGTTTCCATATCCC3' 30 Sergy 8 7.8 3.939 0.667 0.76 0.123ns
30 Nätteberg 11 10.9 5.921 0.833 0.845 0.014ns Aam.H231 (TG)11AAAT(TG)4 DQ514675 5'TGAACATGATAATGATGAGGATG3' 6-FAM 62 138-148 30 5 Pâquis 4 4 2.171 0.3 0.553 0.457**
5'ACCAAAATTCTTATAACACCTTC3' 30 Sergy 4 4 1.917 0.333 0.489 0.318ns
29 Nätteberg 4 4 2.726 0.621 0.645 0.037ns Aam.B3 (CTAA)10 DQ514676 5'TAGTGAAATAATGTGATACTACTCC3' NED 62 133-173 30 10 Pâquis 4 4 2.62 0.4 0.629 0.417*
5'GTTTGAACCAATGGAAATCCTGC3' 30 Sergy 8 7.9 5.202 0.7 0.814 0.181ns
28 Nätteberg 6 6 3.246 0.321 0.712 0.548***
Aam.D10 (GA)38 DQ514677 5'AAATGATTTGTGTGGTGCG3' VIC 62 135-195 30 30 Pâquis 21 20.7 15.929 0.7 0.957 0.269***
5'GTTTATCTGTTAAAGTGACTGG3' 29 Sergy 18 17.7 10.383 0.517 0.927 0.442***
29 Nätteberg 22 21.7 14.017 0.931 0.945 0.015ns Aam.A415 (AT)19 DQ514678 5'CCAGAAGAAGATTACATAAGAGTG3' 6-FAM 58 173-209 29 19 Pâquis 12 11.9 8.087 0.862 0.892 0.034ns
5'TCAATAGTGTGTTTATTTGCAAGC3' 29 Sergy 17 16.8 7.787 0.759 0.889 0.147ns
30 Nätteberg 18 17.8 15 0.966 0.949 -0.019ns Aam.J15 (TAA)7AAA(TAA)5 DQ514679 5'TGGAAATTATAGAGCCTATCAAGCAG3' NED 62 197-206 29 4 Pâquis 2 2 1.788 0.517 0.447 -0.157ns
AGTGATGTTTA 5'TCTCCGGCTATCAATCCTCTTTTGC3' 30 Sergy 4 3.9 1.706 0.533 0.419 -0.273ns
(TAA)8 29 Nätteberg 3 3 2.069 0.759 0.522 -0.455ns
Aam.G431 (TAA)15 DQ514680 5'CTATCCTACACTAACAATCCACT3' 62 262-304 30 13 Pâquis 9 8.9 6.316 0.733 0.858 0.145ns
5'CATCTTCCCTCTCTTAACCTAC3' VIC 30 Sergy 13 12.7 7.692 0.767 0.887 0.135ns
29 Nätteberg 7 7 3.832 0.793 0.751 -0.056ns Table 1 Characteristics of eight microsatellite loci in Aster amellus L. tested on three populations from France: Pâquis (Upper Savoy), Sergy (Geneva Basin) and Switzerland: Nätteberg
(Aargovia). Tm, annealing temperature in °C; Nb, sample size; Nat, total number of alleles overall populations; Pop, studied populations; Na, number of alleles within populations; Rs, allelic richness per population; Ne, effective number of alleles per population; Ho, observed heterozygotie; He, expected heterozygotie; Fis, significant value are indicated with *, ** and ***, α being equal to 0.05, 0.01 and 0.001 respectively, with adjusted nominal levels P = α/8.
Aam.F58 Aam.A12 Aam.H231 Aam.B3 Aam.D10 Aam.A415 Aam.J15 Aam.G431 Size range in A.
amellus
74-88 97-139 138-148 133-173 135-195 173-209 197-206 262-304
Alleles found in A.
alpinus
70 97, 118, 130, 139
140, 144, 146, 150
133, 165, 169
145, 149, 153,165, 169, 173,185
171, 173, 177, 187, 189, 193
200, 203, 224
262, 277, 280, 292 Successful
amplifications
5 3 5 5 5 5 5 5
Table 2 Amplification of the eight microsatellite loci in 5 individuals of Aster alpinus L..
Chapter 3
Inbreeding and inbreeding depression in the rare perennial Aster amellus L.
in natural conditions with
biotic and ecological
interactions
Abstract
Reduction in population size can lead to inbreeding, thus negatively affecting plant fitness traits. Under natural conditions, ecological factors may also play a key role in measured fitness traits, leading to misinterpretation of results. Several studies have clearly shown inbreeding effects due to small population size, but inbreeding depression in natural
conditions has not always been proved. Environmental variables and biotic interactions could be reasons for non-detection of deleterious effects due to inbreeding. Strategies of the species should also be considered for better comprehension of results.
To assess the effects of inbreeding, we studied 31 populations of the infrequent Aster amellus in natural conditions. (1) Using microsatellite markers, we found that the effect of population size on heterozygosity and gene diversity was high. (2) We found significant inbreeding depression in the germination rate and reproductive output when taking into account ecological factors and biotic interactions. (3) Vegetation height had a positive effect on plant productivity but a negative effect on total fitness. (4) Biotic interactions were higher at higher altitude and so in less fragmented landscape. (5) More outbred populations
responded better to potential seed feeder.
Aster amellus plants were found to be highly affected to inbreeding and drift caused by small populations and consequently showed clear signs of inbreeding depression. Pressure caused by surrounding competition diminished reproduction of the species but enhanced vegetative maintenance.
Key words: Aster amellus, fragmentation, inbreeding, drift, inbreeding depression, population size, ecological parameters, competition, stress, strategy, parasite strikes, biotic interactions, microsatellite, germination rate, cumulative production, reproductive output, fitness
Introduction
Deterministic effects such as overkill, habitat destruction, fragmentation, and introduced species lead to a reduction in, and isolation of, populations (Hedrick et al. 1996) . Small and isolated populations are stochastically more susceptible to genetic drift and inbreeding, which may lead to inbreeding depression (Ellstrand & Elam 1993). Inbreeding is characterized by an excess of homozygotes in a given population. Overdominance and/or partial dominance will then affect the fitness components (Charlesworth & Charlesworth 1987; Keller & Waller 2002). Drift is characterized by a loss of allelic diversity in each generation we might see a loss of alleles due to non-reproductive individuals or death. Drift may enhance a more rapid fixation of deleterious alleles and so negatively affect fitness.
Several studies have shown the negative effect of low population size, genetic drift, and inbreeding on fitness traits (Reed & Frankham 2003; Reed 2005; Leimu et al. 2006), but this is not the case in certain species or for certain fitness components (Lammi et al. 1999;
Luijten et al. 2000; Hooftmann & van Kleunen 2003; Bachmann & Hensen 2007). Beneficial purging in these small populations together with a more favourable environment are possible reasons for the contrasting results. Methodology, for example choosing whether to count genets or ramets for perennial species could also explain failure to detect inbreeding depression (Pluess & Stöcklin 2004).
Parasite strikes are known to be lower in fragmented populations (Kruess &
Tscharntke 2000) and so could counterbalance negative effects due to inbreeding (Colling &
Matthies 2004). However, disappearance of parasitic interaction might decrease responses to stochastic parasite strikes enhanced by specific year conditions (see (Hoehn 2006) for an example of drought-enhancing fungal pathogens) and so could submit small and fragmented populations to hazardous strikes that are not controlled, either by a loss of recent contact with the pest or by inbreeding depression.
Long-lived perennial species invest more in survival than in reproduction if conditions are not suitable (Crawley 1985). A study on Senecio jacobea L. showed increased mortality in individuals producing more capitula (Gillman & Crawley 1990) . Hartemink et al. (2004) also showed that short-lived perennials tended to produce as many flowering parts as possible and long-lived perennials, such as Succisa pratensis Moench, minimized their reproductive output in stress conditions. As our studied plant was a long-lived species we were attentive to
production of plants.
Seed mass is known in certain species to influence germination and subsequent stages in early life (Castro 1999). Seed mass embed maternal effects (ecological and genetic) and embryonic genetic (Esau 1977), a more recent study on Arabidopsis suggest that maternal sporophyte and endosperm only worked in determining seed mass, without embryonic activity (Jofuku et al. 2005). Control of seed numbers and seed mass is also known to be intrinsically linked (Primack 1987), and dependent to resource availability (Stephenson 1981). Deleterious genetic controls on either mass, number, and/or their interactions, may be linked to
inbreeding. We focused one part of our analysis on these relationships.
Since 1950 intensive agricultural practices have modified the landscape structure, by a deterioration of the environmental matrix. Use of the calcareous grasslands of south-west central Europe became economically non-viable (Köhler et al. 2005) and was therefore progressively abandoned (Stöcklin et al. 2000). Thanks to recent conservation management efforts, fragments of calcareous grassland are now maintained. Habitats are no longer
abandoned, but are nevertheless always small and fragmented and could be compared to small islands among intensive agricultural areas (Stöcklin et al. 2000).
To assess the effect of this currently fragmented landscape on genetic and fitness components, we studied 31 populations of the perennial Aster amellus in calcareous grasslands along the Jura between Upper Savoy (France) and Aargovia (Switzerland). We
wanted to answer the following questions: (1) Are the heterozygosity and gene diversity of the populations affected by population sizes? (2) Are specific seed (cypselae in our case) components (mass, number, germination, and their relationships) affected by inbreeding of the populations? (3) Are populations affected by inbreeding depression with respect to cumulative production, reproductive output and total fitness? (4) How do ecological parameters and parasite infections interact with our findings? (5) Are parasite interactions affected by inbreeding of the populations?
Materials and Methods Study species
Aster amellus L. is a central-European species. Its north-east distribution limit is west Siberia by the Tobol river (57°14’N/67°2’E) and its south-west limit is south-west France in the Tarn (44°5’N/3°5’E). The distribution area is interrupted by the Alps (Jäger 1979). The species grows on limestone and dry soil, in warm hilly to warm montane belts. It is heliophilous to semi-heliophilous, growing in grasslands, clearings, open forests, edges, slopes and waysides (Rameau et al. 1989).
Aster amellus is a perennial, hemicryptophyte species with a concurrent-stress strategy (Frank & Klotz 1990). It overwinters under the soil surface, buds appear in March and
differentiate into rosettes or stems throughout spring. (Münzbergová 2006) indicates 8 cm between ramets of a genet, but our observations indicate (1)-5 cm-(30) and we use this average distance for our measurements. A genet can produce (1)-3-(68) ramets, a stem (1)-4- (34)capitula and an infructescence (6)-64-(146) cypselae (measures 2005-2006, on 1600 plants, in 31 populations along the Jura). A cypsela is a heterocarpous fruit containing one seed coated by the ovarian walls and the calyx; the all forming one unique structure. This is usually confused with the seed, but in our sense it is not equivalent because a developed fruit
doesn’t mean that it contains a developed seed. Flowering time is in August-September, followed by fructification in October-November. Seeds are trichometeochore and partially ethelochore (Müller-Schneider 1986). Without wind, with 0.8 m/s fall speed and 0.35 m capitulum height, we can calculate a seed dispersion distance of 0.44 m and with a 27 m/s wind speed; seeds could reach up to 12 m (Tackenberg 2001). Aster amellus is an
entomogame generalist; during our observation in the field, we saw three Apidae species (Apis, Ceratina, Epeolus), six Syrphidae species and Lepidoptera. Literature indicates self- incompatibility of the flowers (Kovanda 2005; Münzbergová 2006), which was confirmed with an ex situ experiment involving caging capitula (unpublished data), but intracapitulum or intercapitulum fecundation was not tested. Seeds stock is normally transient (Thompson et al.
1997; Cerabolini et al. 2003) (see Chapter 5).
On vegetative parts, we saw insect herbivory traces, leaf miners, mushrooms (Ramularia, Cerospora, Phoma, Phyllostica, (determination by Adrien Bolet)), Orthoptera eggs and Gasteropoda. Mammalian herbivores feed on capitula, whereas cypselae are eaten by Coleophora obscenella Herrich-Schäffer (Baldizzone & Tabell 2002). We frequently saw a fluorescent orange larva, which was potentially a seed feeder, Diptera, from the cecidomyiid group (Mark Shaw pers. com.). However, we obtained only a larval form, so we were not in a position to clearly assess the species. We maintained it as a potential seed feeder and use
“orange larva” in the text to indicate the species. From a caged growth of collected capitula, we obtained one Euderus sp. (determination by Hannes Baur), which parasitizes Lepidoptera larvae.
Study sites
In 2005, we investigated 31 populations of Aster amellus in the Jura (Switzerland-France) along a 246 km transect, distributed in three main regions: Upper Savoy, the Geneva Basin and Aargovia, and one small region, Le Landeron (Neuchâtel) (Fig. 1).
Fig. 1 Distribution of the 31 studied populations across the four study regions, situated between the 45°/47°N latitude and the 5°/8°E longitude. The two distal populations were separated by 246 km. We provide also the Swiss distribution of Aster amellus (in dark grey on the general map). Please refer to Table 1 for code and coordinates of populations. CRSF, Centre of the Swiss Flora Network.
In September 2005, we counted separately flowering ramets and reproductive genets (ramets separated by less than 5 cm were considered as one genet (see description)) with hand-counters in each 2x2 m squares of the populations. All surfaces were georeferenced with
the help of a Trimble GeoXT® GPS, working with ARCPAD software version 6.03 (ESRI) and connected to a Hurricane Antenna. Coordinates were then corrected by postprocessing using GPSCORRECT software and a fixed antenna based in Geneva (data collected by the Geneva measurement service). With the positioning material, we built a 10/10 m virtual grid and marked physical points with wooden stakes at each grid node. In total, 865 such points were marked on in the entire set of 31 populations (minimum 10 points per population). At these specific points, in addition to the traditional count (see above), we inventoried the
POP NAME CODE REG X Y Z STEM POP SIZE LUM HUM SUB VEGH HET GD
Bois de la Grille BG GB 496267 118871 389 51 21 3.481 2.441 2.407 41.0 0.493 0.473
Crottes CR GB 510938 111803 437 52 71 3.280 2.491 2.395 49.1 0.426 0.521
Hermance HER GB 508619 127495 411 69 101 3.560 2.102 2.256 34.4 0.636 0.601 Chanières 2 CH2 GB 492785 115573 405 116 141 3.488 2.263 2.363 30.8 0.499 0.591 Chanières 1 CH1 GB 492555 115911 406 43 161 3.497 2.338 2.260 29.9 0.650 0.647 Bouffard BOU GB 491008 117114 390 118 181 3.429 2.614 2.388 26.9 0.564 0.586 Rebaterre REB US 474430 101064 458 154 206 3.399 2.374 2.516 29.5 0.566 0.621 Champcoquet 2 CC2 GB 487857 111460 393 252 239 3.444 2.297 2.242 34.3 0.586 0.586 Trembley TR US 480310 101431 493 150 368 3.439 2.421 2.292 27.5 0.513 0.592 Repentance REP GB 488022 110854 385 130 480 3.457 2.375 2.320 28.2 0.566 0.615 Vuache VU US 482799 102088 679 506 521 3.507 2.169 2.244 35.1 0.489 0.584 Franclens FRA US 475644 100057 475 271 610 3.430 2.513 2.422 36.1 0.604 0.648 Schihalden 4 SC4 AR 654491 258515 455 737 695 3.695 2.065 2.260 23.4 0.660 0.687 Schihalden 1 SC1 AR 654100 258579 446 258 871 3.396 2.185 2.142 32.6 0.634 0.683 Allondon 2 AL2 GB 488978 117406 375 1084 871 3.628 2.079 2.215 35.6 0.544 0.557 Allondon 1 AL1 GB 489072 119824 404 1530 901 3.608 2.049 2.223 42.2 0.582 0.635 Aecheberg 3 AE3 AR 646279 252779 497 209 925 3.640 2.276 2.226 30.9 0.596 0.575 Frût FRU US 474100 100387 441 255 1015 3.610 2.301 2.399 21.7 0.693 0.717 Hundruggen HU AR 651133 258663 525 224 1029 3.500 2.297 2.145 23.1 0.672 0.718 Landeron 2 LAN2 LAN 571499 212302 495 4826 1041 3.440 1.931 2.033 34.3 0.572 0.668 Sparberg SP AR 654462 264432 553 617 1097 3.421 2.362 2.250 35.1 0.718 0.746 Champcoquet 1 CC1 GB 487560 111326 374 1335 1592 3.419 2.382 2.314 34.3 0.688 0.676 Schihalden 2 SC2 AR 654232 258681 474 1919 1701 3.607 2.188 2.292 37.2 0.657 0.698 Eggberg 2 EG2 AR 642580 251690 569 2250 1809 3.515 2.123 2.470 44.9 0.665 0.729 Thoiry TH GB 486211 121926 656 2073 2679 3.649 1.961 2.199 24.2 0.600 0.695 Landeron 1 LAN1 LAN 571530 213088 614 6332 3260 3.613 2.054 2.214 38.8 0.556 0.666 Eggberg 1 EG1 AR 642924 251600 532 2547 4820 3.583 2.137 2.183 30.0 0.616 0.682 Sergy SE GB 487918 124683 659 2287 7194 3.482 2.021 2.223 26.6 0.678 0.728 Pâquis PA US 480162 90570 615 986 8294 3.494 2.036 2.248 26.3 0.617 0.673 Hessenberg HES AR 649952 261086 505 4484 15350 3.495 2.299 2.126 22.9 0.690 0.758 Nätteberg NAT AR 649659 260664 484 9751 30927 3.547 2.244 2.137 24.7 0.689 0.749 Table 1 Population parameters of the 31 studied populations, classified by population size in number of vegetative + reproductive genets (POP SIZE) (we provide also number of stems (STEM)). Ecological parameters according to Landolt (1977) are luminosity (LUM), humidity (HUM) and nutritive substances (SUB). We measured also vegetation height (VEGH).
Genetically parameters are mean observed heterozygosity (HET) and average gene diversity (GD). Z is the altitude from the see level, X and Y are projected Swiss coordinates. We provide population name (POP NAME), code of the populations (see Fig. 1) and region of origin (REG): AR, Aargovia; GB, Geneva Basin; US, Upper Savoy; LAN, Le Landeron.
number of vegetative genets. This was then used to estimate the number of vegetative individuals in every 4 m2 plot by using a binomial function, y=a*x2+b*x+c, where y is the number of vegetative individuals and x is the number of reproductive individuals. We then
calculated the total number of individuals per population. At the marked points we also made, during July 2006, 1 m2 presence/absence vegetation records, following the New Binz
nomenclature (Aeschimann & Burdet 1994). Landolt (1977) values were used in a weighted average formula according to Diekmann (2003) for calculation of the ecological parameters.
In the years 2005 and 2006, we also measured the vegetation height by measuring the size of representative grass in the 1 m2 plots (Table 1 for population characteristics).
Plants survey and measurements
In September 2005, we precisely marked with 10 cm nails one reproductive and one vegetative plant on a 1 m2 plot at each of the 865 sampling points. We also mapped these plants on a 20/20 cm grid (Fig.2).
Five millimetre-diameter pieces of leaf were collected from the two marked individuals and from an additional
individual outside the 1 m2 plot, but within the 4 m2 square around the physical point.
These leaf materials were directly placed in 1.5 ml tubes filled with silicagel. DNA extractions were done using an enzymatic method coupled with magnetic beads (Manen et al. 2005). We analysed a total of 2600 individuals using seven microsatellite markers, as described in Mayor & Naciri (2007) (locus AamF58 was abandoned 2
1(m) 2(m)
1
3 20(cm)
Fig. 2 Sampling scheme: in the 1 m2 we did vegetation records, marking and mapping studied individuals with the help of a 20/20 cm grid; in the 4 m2 we counted the reproductive and vegetative genets; we defined a genet as a group of ramets separated from each other by less than 5 cm. Filled squares, stakes;
filled circles, DNA sampling; 1, marked reproductive individual; 2, marked vegetative individual; 3, additional non-marked reproductive individual outside the 1 m2 area for microsatellite analysis only.
because of problems in reading it in certain populations). We calculated mean multilocus heterozygosity per individual and then per population, as a measure of inbreeding (Galeuchet 2005a). We obtained average gene diversity with ARLEQUIN 3.01 (Excoffier 2006) .
Between the 1st and 15th September 2005 and 2006 we measured and counted on the marked plant: number of rosettes and/or stems; width and length of the biggest leaf; size of the biggest stem. We calculated leaf area, as an elliptic form.
Between the 20th and 30th October 2005 and 2006, we counted the number of initiated capitula (i.e. with presence of pappus) on the biggest stem and on the totality of an
individual’s stems. We counted, separately, the small and badly developed units, and good ones. We collected one fully developed infructescence per marked plant and dried it for three weeks at room temperature. Cypselae were separated into four groups per capitulum using two criteria: width (≥1 mm, <1 mm) and presence or absence of infection. They were then counted and weighted per group, and cypsela mass was calculated. Number of orange larvae and Coleophora cocoons per capitulum were also counted. In April 2006, the previous year’s non-infected seeds were sown in Petri dishes filled with a 7 g agar in 1 l H2Od mix and placed for three weeks in a germination chamber at a 14/10H and 25/20° day/night regime. Presence of a radicle was counted as germination, even if subsequent development failed.
Between the 1st and 15th September 2006, we classified marked plants as reproductive or vegetative. We counted the number of leaves of the largest rosette for vegetative
individuals and of the highest stem for reproductive individuals (from the base to the terminal capitulum with bracteoles). Additionally, we counted the number of leaves with herbivory traces and the number of leaves with all kinds of parasite attacks including herbivory. In 2007 we surveyed, for one more year, the stages of plants, so in total, we made three years of population observations.
Cumulative fitness traits
We use four different kind of cumulative responses. Firstly we calculated the vegetative production from vegetative plants as the product of number of leaves, area of leaves and number of rosettes. Secondly we calculated the reproductive production from reproductive plants as the product of number of leaves, area of leaves, number of stems, number of
reproductive stems’ capitula and number of cypselae per capitulum; this will not represent the final reproduction but what the plant invests in reproduction. Thirdly we calculated
reproductive output as the product of the rate of stems, rate of reproductive stems’ capitula, rate of developed cypselae and germination rate; this gave a weight to plants which produced highly but poorly, this was because, in the field, we observed a general decrease in quality of cypselae in high/poorly reproductive plants. Fourthly, a cumulative parasite strike was obtained by pooling the rate of infected vegetative and reproductive leaves and rate of developed infected cypsela over two years of sampling.
Total fitness
To take into account the stages of plants (vegetative, reproductive), we calculated a transient- fertility matrix per population that used a stage-fate-fertility table as input data. Stage
represented the stage in the earliest year, and fate the stage in the subsequent year; fertility was the sum of reproductive output (see above) between the earliest year stage and the subsequent year stage. A reproductive individual took the mean of population reproductive output over years 2005–2006 and a vegetative individual took a zero value. These matrices were then used to calculate lambda of the populations, which was here naturally biased because we used only the transient-fertility matrix without taking into account population size change, and without seedling survival. However, this will give a view of the total fitness over three years and also the stable stages situation in percentage of reproductive or vegetative
individuals. Matrixes were obtained with R software (Stubben & Milligan 2007) and are based on the works of: Caswell (2001), Morris & Doak (2002).
Data analysis
We used a type IV mixed model, based on restricted maximum likelihood (REML) (Bates 2007). The type IV model had the advantage of being adapted to unbalanced data sets. For all models we used population identity and population identity x year of sampling interaction as random factors. We firstly constructed a full model with all interactions and then non
significant terms were drooped, provided that this didn't positively perturb the Akaike information criterion (AIC). The tests of significance used the Monte-Carlo procedure with 10000 Markov chains.
Firstly, we analysed the effects of altitude, luminosity, humidity, nutritive substances, vegetation height, heterozygosity, and years of sampling on square root number of cypselae, log10 cypsela mass, germination rate of developed and no infected cypselae and square root number of orange larvae per capitulum. We added as covariates log10 cypsela mass, square root number of cypselae and infection rate of developed cypselae. For germination rate we also did one analysis with average gene diversity instead of heterozygosity.
Secondly, we analysed the effects of ecological parameters (as above) and heterozygosity on square root cumulative vegetative production, cumulative log10 reproductive production, square root reproductive output and cumulative parasite strike.
All analyses were done using the R statistical project (R Development Core Team 2007).
Results
General observations
Between the years 2005 and 2007, 97% of the marked plants had survived. Cypselae <1 mm did not germinate. Thirty-two percent of the cypselae that were non-infected and ≥1mm germinated. In averaging our 865 vegetation records, we found 22 plant species per square meter and in total 238 plant species were recorded (Annex 1).
Inbreeding and drift
Heterozygosity and average gene diversity were positively related to population size.
(R2=0.36, p<0.001; R2=0.63, p<0.001; Fig. 3).
Fig. 3 Population size (reproductive individuals + vegetative individuals) related to mean observed
heterozygosity and average gene diversity. We present R2 coefficient of regression and p value: *** P<0.001.
Cypsela components
Cypsela numbers per capitulum were influenced positively by cypsela mass (maternal
component) and negatively by heterozygosity of the population and by their interaction (Table 2, Fig. 4E). Cypsela mass must be viewed here as representing the general condition of the
