• Aucun résultat trouvé

by Victo r

N/A
N/A
Protected

Academic year: 2022

Partager "by Victo r"

Copied!
137
0
0

Texte intégral

(1)
(2)
(3)
(4)
(5)

Sequen ceandEvolutionof Apoli poprotei nA-Iin ThreeSa huouids

by VictorA.ll.Drover

A thesissubmittedtothe School of GraduateStudies

inpartialfulfilmen t of the requ irem entsforthedegreeof

MasterofScience

Depart ment ofBiochem istry MemorialUniversityof Newfo und land

Janu ar y 1995

(6)

.+.

NaliOnalLibr31)'

01Canada Bibliol~uena lionale

duCanada Acquisitionsand DirectiOndesacqiJ$tionset llibl,ographicSorvicesBraflCh de~siWicesbibliographiques :J'J 5WdnD''''' S/<ool 39S"""W'*'!1M ifllZ"'o:~Ckdarl(> ~Ai:l[~roo)

The author has granted an irrevocablenon-exclusivelicence allowing the National Library of Canada to reproduce. loan, distribute or sell copies of his/herthesis by any meansand in any form or format, making this thesis available to interested persons,

The author retains ownership of the copyright in his/her thesis.

Neitherthe thesis nor substantial extractsfrom it may be printed or otherwise reproduced without his/herpermission.

L'auteur aaccordeune licence irrevocable et non exclusive permettant it la Blbllotheque nationale du Canada de reproduire, preter,distribuer ou vendre des copies de sa these de quelque rnanlere et sous quelque formeque ce solt pour mettre des exemplaires de cette these it la disposition des personnesInteressees.

L'auteur conservela proprfete du droit d'auteur qui protege sa these. Ni la these ni des extralts substantiels de celle-ci ne doivent etre lmprlmes ou autrement reproduits sans son autorisation.

ISBN 0-612-17590-1

Canada

(7)

Abst ract

AeDNAlibrary was construct edfrom brown rrotu livertlssuo ,md(lI lt'

clone,BTLB27,co ntainingthe processedmRNA transcrip t ofapolfpoprototu A-I wasisolate d and sequenced.This sequence wastheu comparedIII

. ,ll

(ltlll'f

kn ow n apo A-1eDNA/genomicDNA SCC]UCIlCt'San dthephylll~Cl1YoftilL' represen ted speciesinferred.TheSC'1l1CllCCSisolatedfrom the fishSpCl'il'S

groupedoutsid e both avianandmammalian soqucncos while the avia n sequence"'<ISan Olllgroup tothe mamma ls.Thephytogcnc ucuvcalso re vealed that rodents diverged frnm the mammals be foroli1 ~ll m\ll'Plls, carn ivores, artlodactyle, and primates. Using the dJN A / gl 'llll lllk DNA com p arison s,the inse rtionSilL'Sofapolipoprotein A-IlntruusIIandIIIwen- predicted and amplified using the polymcrnsc chain n-artion and subseq uentlyseque nced.Wefind thattherearetwoloci forapolipoprotcinA~

I, one of which has undergone major evolution ary l'h"ll~l'S. Ahm, phyloge neticinfere nceustng intronIIseque ncesSliPPOI'(till'findingsfrom the eDN A sequences. Molecu lar clocks were constructed Irnm Illl' phylogene tic dataandthe accepte dfossilrecord to estimate Ihe time of various evolutiona ry events.We find that the accepted lime for the diver gence of rut and mo use ismuch too recent. Es tima tes of the divergence times ofthreesalmonidspeciesas welli1Sa genomeduplication event wh ich precededsalmo nidspeciat ionarc also greaterthan currentacceptedvalues, alth o ughthedifferencesarc notCISgrea tas thatobserv ed fortheroden t lin eage.

(8)

Acknowledgments

AllhIJugh itisnot [>O!IO!IOihlc10thank ever yone whohascontributed to thi!lOproject. the re arc anumber ofpeople towho m Iam grea t ly indebted.WillieDavidsonhas beenaconstantsource of guidance and support thro ugh o ut llib projectaswellasmyHonoursdissert at ion. WilliewasinFnctthedrivingforcewhichled thepath ofmy career towards res earch nudsubs equentlyallowedme 10 thinkandactwi t h relative freed om.Iti!>this Inter pointforwhich Iam mostgratefu l.

Sylvia Burtl cu has also contrib uted treme ndo usly. Her tec h n ic al expe rtise lind ever-cheerful person ality has made the whole experiencebothcd ucmiunnlantienjoyable.Iamalso thankful for the helpfulwords.laughs. arguments. and beers suppli ed inabundant quantities bypeople suchasColin McGowan, John Goodier .Caroli ne Hursr. Blair Pritchcu, Tony Nakla. Dorothy Crutcher. Annette Greens lade.and Michelle Normore . The continued moral support by Christie Dean nnd myparents,Bruccand LindaDrover.is alsogrea tly upprccimc•I. Finall y, I would like to thank the Bioc hcm istry Department ut Memorial University of Newfoundland .

(9)

Table of Con tents

Abstract ii

Acknowledgmen ts... .. iii

Table of Contents iv

iv

List ofTables .. .. vi

Listof Figures vii

Listof Abbreviati on s lx

ChapterI 1

General Introduction 1

1.1Composition and metabolismofhighdensitylipopro teins 2 1.2 Struct ureand funct ionof apoA.I... . ..l 1.3 Organization and expressionof theapoA-1gene.... . 5

1.4 Lipid metabolismin fish ... . Ii

1.5Evolut ionofsalmonids lJ

1.6 Evolutionandpopulati on genetics using variable genetic

eleme nts... . 11

1.7 Goals andObjectives. . 13

Chapter II 20

Isolationand Characterization of apoA.1eDNA andMatureProtei n 20

2.1INTRODUCTION . 21

2.1.1 Preparatio nof eDNA... . 21

2.1.2 Apolipoprotei n purification usingsequenti.,Iflotation " 2.1

2.1.3 The poly merasechain reaction (PCR) 23

2.2 EXPERIMENTA Land DISCUSSION 25

2.2.1Isolationand seque ncing of an apoA-1c10Mfromitbrow n

Irout live r,eDNAlibrary... . 25

2.2.2 Isola tion ofHD L from brown trout serumandpartial

purificationof epon- l. 26

2.2.3Amplificationand sequencing of genomicDNAto investiga te thecDNA deletionobserved in thepBTLB27seq uence.i.. .21) 2.2.4 Comparisonof humanandbrowntrout apoA·1seque nces 31

ChapterIII 51

IsolationandCharacterizationof apoA.1InterveningSeque nces II

and III in ThreeSalmonids... .. 51

3.1 INTRODU CTiON .52

3.1.1 The Orig insand Evolutio nof Interven ingSequences .52

3.1.2In tro n Mapp ing Using PCR.... . .54

3.2 EXPERIMENTALANDDISCUSSION .56

3.2.1Isola tio nand Sequencingof apoA-I: IVS11.. SfJ 3.2.2Isola tion , Seq uencing,andPedigreeanalysis of apoA· I:IVS III SK

(10)

Chapter IV _ 81 Evolu tionary AnalysesUsing ApoA-IeDNAand Intervening

seq uences»; .. 81

4.1 INTROD UCTI ON . 82

a.t.t Phylogcnctlc Recon s tructio n using MolecularSequences 82 4.1.2 UsingConse rvedSequencesas a 'Molecular Clock'.... . 87

4.2 EXPERIMENTA LandDiSCUSSi ON 88

4.2.1Inferr in g PhylogenyUsing apoA-1eDNAand Inte rvening

Sequences... . 88

4.2.2Constr uctin g Molec ularClocks Using the FossilRecord.; . 93

References _ 111

(11)

List of Tables

Table 1.1. Chemicaland physicalchnractcrisfics ofsonw

apottpoprotetns . J

Table 1.2. A comprehen sivereferencelist(If<Ill knownapll !\-[cDNI\

nnd genomicseq ucnces.. . .. 7

Table3.1. Expected slzo (in basepilir:;)ofproducts produced from111l' amplificationof <Inapo A· [ fragment fromIlsingprime r 65 and primer

68Up/68Lo.... ...(1,5

Table4.1. A listing of evolution arybrunchpoin tsanddiverg ence tinll':-i basedon thefossil record.Distance csumonons from the l'!JN /\und IVStrees as well ns references arcslw wn ... .. '''1

vi

(12)

List of Figures

Fi~.1.1. Schema ticrep rese ntationofthe!reversecho lesteroltranspo rt pathway _...•...•..._..__ _ _.._ ...•...•.•...•.. .. •._.._14 Fig. 1.2.Ahypotheticalschemefor theevolutionof epolt poprct etn

J;l'flt.'S(ad apted[ro m ChanandLi,1992)... . _ _ __ 16

Fi~.1.J.Phyloge neticrelationshipswithinthefamil y Salmonidae

[adaptedfromMurataetal1993)_ .18

Fig.2.1.Aschema ticrep resentat ion ofcDNAsyn thesisusing the SuperscriptPlasmid System for cDNA Synthes is andPlasmidCloning 33 FIg 22 Schematic represe ntationof astandard amplification cycleused Inthe polymerase chai nreactio n .... . ... . . ...35 Fig.2.3.Alignmentof IIpoA-1cDN Aseque ncesof brown trou t(BT), Atlantic salmon(AS). nnd rainbowtrout (RT)showingthe primer designed10sequenceoverthe unknownregionofpBTLB27.... .37

~~~t~~ts ~~1~~n;::~~~~~s~~Wi~~ r: ~~:lf~r;~~~i~LO~tC~~~~t~~~~~~

.39

Fig.25.50s-PAGEanalysisofprotein iso latedfromHDL(follo win g deJipidation)...•...__ _ ~...•..•...41 Fig.2.6.Semi-quan titativeIon-exchangeofbrowntrout apoA-I from DEAE-scp hade x withNaCI _..__ _.. __ _~_...•_•...43 Fig.2.7. Amplificationofthe87bpdeletion region in threesalmonids

using primers 63and 65 ~__ .. 45

Fig.2.B.Thecom p lete cDNAsequence ofapoA-1inbrow ntrou t,Salmo

trutta...•..._ __ __ _ 47

Fig2.9.Alignmentofhuman(topsequence)andbrowntrout(bottom

sequence)apoA-1nrmnoacidsequcnces __ _ 49

~~n~,~~1~~~;~~~~i~~r;~~~~~~ .. :.~~~~~~ .. ~~~~ .. ~~ .. ~~.:.~~~~~.~ .. ~~~~.~~ .. ~~~

67

rig.3.2.Alignmen tofIVSIIandIIIseq uencesfrom three snlmonid

~pl'Cics... .69

Fig.3.3.Proposed evolu tionarychangesin twoapoA-Iloci based on

sequencedatil(Fig.3.2)... .. 71

rig . 3.4.AmpljfkatlcnoftheIVSIIIusingprimers 66and67at various

iln ncillin g temperatures(TA)... . 73

(13)

Fig. 3.5.AmplificationandrearnpltficatinnofrvsIIIllsilll-:prtnwrs(1(,

and 67. .. 75

Fig.3.6.Amplificationofth e variablernicrcsatclutcwithin IVSIIIin anAtlant ics nIm onyb rown trou t hybrid fam ily 77 Fig.3.7Amplification oftworegions of apu A-1usinglocus spcdflc

primers. .. .. 71-)

Fig.4.1. ClnstalV alignme nt of apoA-1cONA sequences 101 Fig.4.2.ClustalV alignmen tof apoA· I:IVSIIscquences.c. . 105 Fig.4.3.UPG MA trees produced from eDNA (Al andIVS-Il(B)datu

using the program MEGA . .. 107

Fig.4.4. Molecularclocks producedfrom cDN A endIVS II data... . llJ<J

"iii

(14)

List of Abbreviations

ilpoA-r,npolipoprotcinA·J CETP,cholcstcryl ester transfer protein 11DL, highdensitylipopro tein(s)

13M,the micros,1lcllitccontainedwithinIVSIIIof ilpoA·J insalmon tds 10 1.,inter med iate densitylipoprotcin(s)

[VS, Interveningsequence(intron) LAAT,lec ithin alcoholncyttransferasc Le AT,lecithin-choles te rolacyl transfcrnse LDL, lowdensitylipoprotein(s) MYA, millionsofyeors nHDL,nascentHOL OTU,operationaltaxonomicunit RAPD, randomlyamplifiedpolymorphic DNA SlNE,shortinterspersed nucleotid e elcment(s)

UPC MA,unwclghtcdpairgroupmethod usingarithmeticaverages VLDL.verylowdensitylipoprotcin{s)

(15)

Ch apter I

General Introduc tion

(16)

Lipop rotein s arc macromolecular complexes consisting of trtocylglyccrol, phospholipid , ch olestero l,and protein. They are found circulatingin theplasma and actas themalntransportersof lipidsbe tween tissues. In mammals the re are five types of plasma lipoproteins.

ChylomicrousMe transient lipop roteins produced intheintestine followinga mealhigh in fat. Theother fou rlipoproteinsnrcdistinguished bytheir hydrated densities as high, intermediate, lo w and very low density lipoprotein s(HOL, IDL,LOL, end VLDL, respectively;Babin,1987).Besides density,the lipoproteinscan bedistinguis hed bytheirchemica lcomposi tions (Table1.1).OneofthemostImpo r tantdifferences betweentheselipop r o teins istheir apoltpoprotcincontent.Thedistribution ofthe npollpoproteins gives eachlipoproteina distinctfunctionandthus plays a key role inlipop rotein metabolis m. Thisresearchfocuses onopollp opr o telnA-I(apoa -l),the main proteinco mponen tof HOL.

HDL precursors (nascent HDL;nHDL) are produ cedin the liver,the intestine, andthrough the lipolysis ofchylomicrons nnd VLDL(Eisenberg, 11.)84).Althc~lgheach ofthese nHOLhilsaslightlydifferentcomposition,they all contai nlowlevels oftriglycer ideandunesterifiedcholesterolandhigh leve lsof phospholipidandapoa -I.Becausetheseprecursor particlesarelow in cholesterol they nrc excellent acceptorsof excesscholesterol fro m peripheral tissues. Once thenHDLparticleassoctatcewith the cellmembrane,

"pnA-!activateslecithin-choles te rol ecyltr ansferase(t eAT;Aronet ol.,1978) which callthenesterifythe free choleste rolwithinthe cell.Thehydrophobic

(17)

II I I Ch

TobleLl. erruca am hvslca Cmractcnsucs0 some ncotoorutclus.

Lipopr otein VLDL LOL IIDL

Molecul ar Wcig hl (llt") 5<,

I

2.)

I

,llIH-IU I>

Dens ity(~/Ll O.9!J·U)06 l.OO6-1.0(i.'\ Ul6..1·1.210

Com ncnt J'cr<cl\ ta'~'C(l lll'u,; il iull

~~~~Ct~~l~:t:~ol

~ I

10

I

4

H 2

Este r ifiedCholeste rol 12 37 ts

Ph osp holip id 18

'0 ,.,

Protein 10 23 55

Maioranoltco orotcm C-1. C_lI,C-III ,E U A-I,A-II

(18)

chclostcrylestertransfcr prote in(CETP;Franconeet(/1.,1989).nHOLcon! ains bothLCATendCETP.Togethe r,theyraisethe cholestcry lester conten t01the lipoproteinthe reby producing rna ture HDL(HOL).Oncefor med, HOL is directedto theliver where excesscholesteroles teris cxtractcd bya tleas tfou r mechanisms (Assmenn rI nt.,1992)andthenexcretedthroughbile acid synthes isnod secretion.Theseprocesses make upthe reversecholesterol trans p ort pathway(Schmitz etnt.,1985; Fig1.1)and are thought to be respons ible forthe inverse relatio nshi p between HDlseru m cholesterol conce n trations andthe risk of developing ischnemichear t disease (Miller nnd Mi11er,1975).The high incidenceof coronaryheartdisease hasthus ge n e rated muchinterestinHDLand,ofcourse, apoA-1.

1.2Structurean dfunction ofap oA-I.

ApoA-Jis asoluble, grouprapoltpoprotelnandcontains between238 (Atlanticsalm on;PowellrIal., 1991) and 243(hum:m: Karathanas is eJal., 19lJ3)aminoacids.Ashort leader sequence of 23 to24amino acids tags apoA-I for secretion and isthusremoved beforethe protein ente rsthe plaama (PownallandGallo, [r.,1992). Onceinthe plas ma,apce-Icanspontaneously associatewith lipid (Chan andLi,1992),aphenomenonthat is accompanied by an increase inthe u-hellcal conten t of apoA-I{Morrise t tcJaI.,1977).

Altho ug h th ree-di mensional crystal structures are not availab le for npoltpo protetns.Chou-Fnsmananalysispredicts arepe titivehelicalcontent for apoA-1. Furth er more,thehydrophobic mo ment algorithm indicatesthat ilpoA-1is more emphi pa thic than the typical globularprotein(Powna lletai.,

(19)

198 3).Theoccurre nceof prohnesinthesecondarystructureof<'lpoA·1is otso quite intriguing.In most cases, theyoccurat siresbetweenrepeatedhcttcal segmentsandexh ibitaminima in thehelicalmo men t (Pownallt'IIII.,1l.JH6).

The sepiecesof evidencepointtow arda hypothe ticalmodel dcscrfbing the mechanism wherebyapoA-1associateswiththelip id moleculestoformHOt.

The hydrop hobicsideof each amp htpnthtc p-hclix caninternetwit hIhr-lipid molecules.Theproltn cs between eachofthese helicesallow adja cent helices 10inte ract with the lipidsina differentorientation,therebycllmpCn~llin};(m thespheric a lordis coidalnatureof HDL.Inthisarrengcrncn t, the hydrophilic sideof the helicesremainsexposedto th eplasma 1\\soll1blizl'HDL andIii int e ra ct withotherproteinssuch<1Sreceptorsandenz}'Llll's.

1.3Organizationandexpressionof theapoA-' g(m e.

Although much research hasbe en devo tedto till'structure and functionof the np o.A-!protein, valuable Informati on has alsobe enobtatncd from the structureand organization ofthe t1poA-1codingregio n.'rhohigll levelofexpression ofthi s gene facilitCl tes theisolation andclortlngofit~

cDNA. Consequ en t ly,eDNAsequences have b{.'{'11 de term ine d for five mammals and two samontd species(Table1.2).WhImtheinfe rredamino acid seque nc eswerecompa red, a number of sim ilarities wereno ticed, For insta nce, theproli ne residues wh ichseparate theprop osedu-hehces arc high lyconse rved. Theregi on betw e enthes eprcltncsconsistsofeither11or 22 amino acids which arethemselves conse rved throughout apo A -r.

Furthermor e , when apoA-1was compare d to othe r ap ohp oproteins, this internal repeatwas stillobserved,as was a 33aminoacidregionatthe am ino

(20)

intragenic duplications of acommonances tral gene(Kimura,1983).Fig.1.2 illustrates theevol utionofvar io us epollpopro tel nsbase d uponthenu m ber of11/22aminoacidrepeat s'.Itwasalsonoticed thatapoA-Iwasa ra p idly evolving gene. Whencomparedtothe B-globin gene, whichev olvesatthe aver ageratefor35 mammaliangenes[l.letIll., 1985),apoA-Ihas a25%higher rateofnon-synon ymoussubstitut ions (O'hlligln etIll.,1990).However ,the ove rallstructure ofapo A-1appearstohavebeenretainedin allspecies studiedto date.

The gene structureofapoA-1 has also bee n stud ied in a numberof species (Ta ble1.2).Acom parison of these sequence sreveal edthre eIntronsor interveningsequences(lVS)which arespliced fromtheprima ry transcr ipt before tra ns lation . The firstintranislocatedinthe5'-untranslatedregion and the othertwooccurinthecodingregion.How ever,the placementof the twolaller IVSapp ears conspicuouslynon-rand om .IVSIIsepara tesmost of th eleader peptidefromtherestof theprotein whileIVSIIIse parates the in itinlBarntno-acldblock fromthe11/22aminoacidrepeats.As the la tte r is theproposedlipid -bindingdomain, the IVSsee m toseparate apoA-I into

IRec ent com parisons betweenapoA·1Ollc!rntkl r semlMCf§fro mvariousspecies andhum a n npoE/.l poA-IV~ulillestIh~l lheolpoA-tgeneisanc e stral to bothapo Eand apoA·IV.Prote in productscorcspondm gtothesegen eswoul d notbepresent in salmenidsillthis scenario (l'llW l'll cl .11.,1991).

(21)

Tobie1.2.Acomprehensivereferencelistofall known "poA-1eDNAand enomicsequences,

5 1~5 NA,lienee ,c nt>Olic5l'1Il'1lC't'

Human Lawr'al.,19113 Knmthan nsts1'1al.,IYY;'l Baboon Hixson tf lll,, 1988

Monkey MU(lilyandMarn Ui,I9'J2

Cow O'h Uiginctal~1990

Pig DirchlMlIcr,"111.,I'm

Dog Luo dill.,1989

Rabbit PanctIli.,1987

Rot Haddadel al.,198 6

"""'"

Stoffeldnt.,1992

Chicken Bhallach a ryya1'1al.,1991

Atlanticsalmon Powclletuf.,1991 Ralnbow nout Delcuveelaf.,1992

(22)

1.4Lipid metabolism in fish.

Thecompos itionandmetabolismofplasma lipopr oteinsin fish2has beenwell characterized (for reviewsee Babinand Vernier,1989).Un like mammalian systems, these poikilotherm ic or cold-blooded vertebra tes preferentiall y utilizelipid (as opposed to ca rbohydrate)astheprima rysource ofenergy. This characteris ticmayaccountfor the hyperlipidemicnature of fish serum <ISdemonst rated for rainbow trout (three-fold increase in com pariso n to rat plasmalipidle vels).Cholester o llevelsin thisspecies are alsoelevate d(ashigh astwelvetimesrat levels).Mostfish speciesstud ied exh ibit the standar dapolipo proteinclasses whose main apolipop roteinan d lipidcomponents arehomologous tothosefound inmamm als.Further,the most abun da ntapolipopro teinparticlein bothmammals andfish(rainbo w trout ) isHDL.In addition to themammu ltan apoHpoprotein classes,egg- laying fish (and otheroviparous species ofrep tiles andbirds)prod uce vtte llogcntn, themajor yolkprotein. This ancient proteinassociateswit h lipid s, phosp hate,andvarious met alionsand isused as a food sou rcedu ring embr yogenes is. Recent studies have revealed a sim ilarity between vite llogenin and human <lpoB~100 (the prima ry apolipop rotein of mammalianLOL).Thisraises thepossibili ty that vttellogenl nhasaddition al fun ct ions (b eyond anemb ry onicfood sou rce)and thatthevitellogen in gen e

~~~~:.mH~:~~~r.u::stt~~h~e::;::~:;hg:;se~~I~I~~at!~:i~I~~e~YA~~~~\:~~~~(~~er

Salmonlfor mcs).

(23)

mayhave been the ancestor to the present-day<lpoB-lOO gene(Barberdill ., 1991;Steyreret«I., 1990;Baker,1988).

Enz ymeactivities commo nin mam malianlipidtransport syste msnrc alsopresen tin manyfish species. The prese n ceof

LeAr-

and CET P-like activities as wellaslipoprot ein lipa s e activ ityimp lies thatthe major pathways of cholestero l metabol ism have been conserved. Howe ver,leci thin- alcoholacyltran sferase(LAAT, similar toLCAT)has beenid en tifiedincarp but is not detectableinmammal s.LAATcatalyz e s the transferof fattyad d sin lect hintothe acylmoie tyofwaxestersand may beresp o nsible for someof the plasmawax estersfoundin this species.

Insalmonids,apoa-listhemos tabundantpla s ma pro teinand its eDNAha s beenisolatedfrom tw o species spann ingtwogenera(secTable 1.2). Atlantic salmon(Sallll ogenus) apoA-1eDNAha s beensequencedfrom liver andits dist ributi on oftissueexpressionexamined . Like mamm alian npoe-t, salmon apoA-1ishighly expres sedin the liverand in tes tine. Tracelevels of ap oA-ImRNAwe realsodetecte d insa lmon muscle(Po wellct01.,1991 ).In rainbow trout (Oncorhy nchus genus) two eDNA sequenceshave been isolated. One cop y(apoA-I-l)isthe maj ortrans criptof norm al liver cells while the other (apoA-I-2) is expressedon lyin hepatocell ular ca rcino ma cells.

The ind uc tionofneoplasia byaflatoxtn-Bj selectivelyincreasesthe expres sion ofapoA~I-2aboveand beyo nd that of apoA-I-l (Dek uv o eI01., 1992).To dale, nogenomicsequ e nce has been obtained for an y specie sof snl monidor any otherfish.

1.5Evolution of salmonid s.

(24)

Wit h in the Salmo nidae family there are three subfamilies;

Corcgont nac(whitefish and cisco), ThymalUnae (g raylin gs), andSalmo n inae (common ly referredto<ISsalmontds or tr o uts, char,and salmon).Thelatter in cl udes four gen era(HIiCho, Sa/TJdilllls, Oucor1lyllc/ll/s,and5(11110) with some68species(AllendorfandThorgaa rd , 1984) and h,H.J.--een the subjectof numerous taxon o mic/ sy st ematic studies using a diversearray of ma r kers suc has morphological, allozyme,and nucleotide se quence data (fo r a dis cussion secPhillips and Pley te,1991).fo rexample, short interspe rsed nucleotide elementsclements(SINEs)wereused to recons truct the phylogeny ofsomesalmonids(Mura taetot .,1993;Kidoel al.,1994;Fig.1.3).However, many questionssti ll remainconcerning the classtftcauo nofsomespeciesand eve n the existence of additional genera suc h as Snlmotllymlfs and Brnc/lY11lystax(PhillipsandPleyte, 1991).Muchof this un cer taintyarises fr o m thefacttha t all salmonidsapparentlysh area common tetraploid ancestor (Allendor fand Tho rganrd , 1984).Thus,ma ny genetic loci existinduplicate, whichcan confou ndstu diesdirectly based on the geneticseq uence (Le.

allozymeanalysis ,restriction enzymeana lysis,andsequenc ecomparison).It is es timated that30%ofthese dup licateloci havebeen silenced , 46%have div erged givingrise 10paralogou s loci, while 24%havebeenconserved pro du cing:Isolod(Philli psandPleyte, 1991).Conseque ntly,it isimportantto rom p'Hcort hologousgenes(genes that have evolved directly from an nnccstmtlo c us)ratherthanparalogous(ge neswhichhave arisen from a gene duplication event) when inferring phylogenies.Alternatively,bo th locimay beusedin theca s eof aminoacid or nucleotide seque nce comparison (if

(25)

sequencesare availablefrom each locus) to estimate bolhthe phylogenetic relationshipof the orgenismsnnd whenthe genomeduplica tion occured.

Sverdson (1945) first proposed the notion that salmonids were polyploid(t.e.havingmore than two sets of chromosomes; Svardsou. 1945).

Althoughhis hypothesis tha tthe basic chromosomenumber wasn=lO was incorrect. la ter work supportedhis ideasas salmonids were found IIIhe tetraploid.This was flrst suggesredbyOhnc d 11/. (1968) and is based(Inthree linesof evidence: (1) Salmonidfish have about twice as muchDNAper cell andtwiceas manych romos ome armsas closely relat ed fish, (2) Mulfivnlcnts (i.e.more than two chromosomes whosehomologo u s regions <Ire synapsed bypairs) have been commo nly observed inmeio tic preparations from salm onidspecies, and(3)~almonidsexhibitmanyduplicatedenzyme foe!

(Allendorfand Thorgaard,1984).

1.6Evolution and populationgeneticsusingvariabl egenetic elements.

The study of evolution canbe separated int otwobmad categories:

macroevo lu tion and mtcrocvol utton (Funk and Brooks, l\)YO).

Macroevo lutionfocuses on the evolutionamonglineagesandoperatesover very long periods of time(I.c. tens10hundr eds of millions of years). Thus, conservedsequencesmust beused10study macroevolution (abyp c rv nr teblc region wouldalmostcertain lylose its genetic identity altogether,makingil of littleuse forlong range evolutionary compa risons).The genes ending for conserve d proteins andribosomal RNAsarc commonly used to infe r phylogenyamong; lineages. Althoug hthestructureand functio nofeachof these types ofmolecules have been re tained, the re is enough sequence

II

(26)

vnria tlon over time such that an accurate pattern of evolutionary rela tionships can be determined.For example, the amino acid and nucleotide sequence of conserved proteins suchas myoglobin(Romero-Herr erael at., 1973)and cytochrome c (McLaughlinand Dayhoff, 1972) canbe used to examine deepevolutionary relationships.

Microevolutto noccurs within a lineageand thus operates within the lime-scaleof an individual species or a number of closely related species.The gunl ofpopulationgenetics is to identifymicroevol utionwithin a speciesto determinethe existence/absenceof anysub-species or distinct populations.

Typ lcallv,hy pcrvariable regions such as repetitive elements areused to observe microcvolufion.Th e abundance of repetitiveDNA within the genomes of cukaryoteswas first observed in 1968 (Britten and Khone)by observingthe mtcs ofrea ssociation of denatured DNA. More recently.

repetitive clcmen Is of varioustypes have been iden tified(by DNA cloning andsequencing)and thestudy of their variability has become quite common inpopu lation geneticsand speciea/mdlvtdual identification.A good example ofthis type of repetitive elementis microsatellite DNA: variable genetic clementsconsisting of short DNA sequences(1~5bp)repeated in tandem (Rassmenrtal.,1991).Two importantcharacteristicsofmicrosatc llitesmake litem suitable for individualidentification and pedigree netysts:

1.the len gth of the microsatellite {i.e.the number of repeals) is hyporvariablcnnd thus canbe observedwithina population(ora number ofpopulations) of onespecies,

(27)

2.theregions flanking the rnicrosatcllttcsarc uniq ueandconserved such that oligonucleotideprimers can be designedforthese sites.Thisallows rapidanalysi s of manyindividualsusing thepolymerasechainreaction.

Thus,byamplifyinguniquemicrosatcllitcsfroma population,itis possibleto extractinforma ti o n aboutthe populatio nstruc turebasedonthe sizes o( the mlcrosatellltesand theirdistrib u tion.This procedure b as been usedin awide variety of speciesinclud inghuman (Li ttandLuty,1989),pig(wrntcrol'IIII., 1992),brown trout (Estoup dot.,1993) and DrosilplJilrr[Tnulz,19 H9l.

1.7Goalsand Objectives.

Ingeneral,the ob jectiveof thisresearch was to furthercluiractc rizcthe apoa-lgene insalmon ids an d tolise thisin format ion to examine the evolution of mammals, birds,and fish,To thisend, three majorlines of researchwereexplored:(1)thegenestructureofapoA-1wasexamined.The eDNAsequence ofbrown trou tandtheposit ion/ seq uenceoftwoapllA·1 in tronsfromthreesalmo nids (includ ingbrown tro ut)wereobtained,(2) using the apoA-Isequencesobtained above and nilotherknown apoA-[

sequences,phylogene tic inferencemethods were us e dtoinvesti);atcthe evolution a ryrelat ionshi psbetweenanumberofspeciesufrnammnls,fish, and birds.This informa tionwas alsousedtoest imate ratesofevolutio nnnd divergencelimes of various lineages,(3)duplica teapo A-rloci in salmonids werecompared to determine the changesthat have occurred stncc the genome duplica tion.

I)

(28)

Fig.1.1. Schematic represent at ion ofthe reverse cholesterol transport pathwa y. A, apoA-1is synthesizedin theliver.nHOLpar ticles arc then nsssemblcdnod secretedinlotheplasm a.B, thenHDLparticlesintera ctwith till'peripheraltissues. ApoA-1activatesLeAT whichesterifiesfreecellular chnlesternl.These esters are the ntransfe rred tonHOLvia CETP.Mature HDL is thus formed.C.HDtparticle s return 10the liver where thecholesteryl estersarc extractedand catabolized.Althoughitis likelythatthisfinalstep is re cepto r-mediated .the mechan ismofcholesterylesteruptakebythe liver from HOtand the subsequen tfall'oftheHOtparticle itself isnotwell underst ood.

(29)
(30)

Fi~.1.2.1\hypothetical schemeforthe evolu tion ofapolipoprot ein genes (adilplL'd fromChanandLi, 1992).

(31)

,--- A- A-I

r - '--e- A-IV

[ * e - - E A _r-- A-II

~C-III

' - - - - - - C-II

'-- ..c-- C-I

~C-I'

• Gene duplicati on event

e Dupl ication of 33 or 66 codons

A Deletion of 33 codons

17

(32)

Plg.1.3.Phylogeneticrelationships within thefamilySalmonidae(adap ted from Muratad al,1993).

(33)

/9

Common Name Species Genus

ch urn salmon kctn pinksalm on gorbllscJIrl kokanee netknadonis

chinook salmon ts/Jnwytsc1m

Oncorhyncllus

coho salmon kieutch

rainbowtrout mykiss

J

brown trout trutl a

:1 Sulmo

Atlantic salmon salar

Dolly Varden malma

] Sai ueiinue

white-spottedchar Jeucomaen is

Japanesehuchen perry;

] Hucho

(34)

Chapter II

Isolation and Characterization of apoA- I cDNA and

Ma ture Protein

(35)

2.1INTRODUCTION 2.1.1 Pre parationofeDNA

A eDNAlibrary is a collectionof DNAmolecules wh ichreprese ntiI

population ofmRNAmo lecule s.Esscnttatly,a eDNAlibraryrep resent srh o exp resse dgenes of the tissuefrom whichthemRNAwas iso lated . TheeDN A is propagatedin a cloning"ector and typicallymain tainedinEsdu'rir/JifltoiL A good eDNA library mustexhibitthe following two charncrcrtsucs:

1.Itmustcontain enoughindivid ualclonessuch thailow -abund an ce mRN As are represented.

2. The eDNA mo lecu les arc full-length, thus n..-prcscnttng com plete messa ges .

Ifeitherof theseconditionsis notme t,theiso lation andsequencingof ,1 particular messag e willbeimpa ired .

The rearethree generalstepsinvolvedin constructinga cDNAlib rary.

First,the mRNA mustbeisola ted . ThemRN Aisthenused asthetemplate withreversetranscdptase to producetheeDNA.Finally,theeDNAisli~il led into the app rop ria teclon ing vector.Var iation in this last steppro d uces two broadca tegoriesof eDNA libraries. The simplesttype ofltbmry 10 construc tis arand o mlibrary .Inth iscase, theorient ati on of the eDNAinse rtwithinth e vector is notconstant.Ifa DNAprobeis beingused, the orien tation of the insertdoes not affect the isola tion ofa partic ular donefrum thelibra ry.

However , immu nological detection met hod sreq uire the prese nceufall antigenicdeterminanton theprote in producedfro m the eDNA.Inthis case, only1/6 ofthe clones will beinthe proper orientation and ruadln g frameto expressth e protein.Thus. sixtimes as man yclonesmust be screen ed. Further .

2I

(36)

sequenceanalysis can be troublesome particularlyifa poly-Atail is not presenttoindicate the3' end of the message.Indirectionallibraries, alleDNA insertsmoeclonedin a specific orientation .Besidesmoreefficientscreening and sequence analysis, directional eDNA cloning also facilitates the constructionof subtracted libraries.Thistypeoflibraryistheend-prod uctofa compa risonbetwee ntwo eDNApopula tions.Theresultantlibrary is thus enrichedinmessageswhicharepresentin one popula tionbutno ttheother.

Although there arcvariousmethodsusedtoproduce subtrac ted libraries, each useshybridizationtoremove sequenceinformationcommon to both populations.

The eDNAlibraryproducedfor this research was constructed usingthe SuperScript Plasmid SystemforcDNASynthesisand PlasmidCloning(Ctbco 3RL). Thissystemhas been optimizedin anumber of ways to maximize efficiencyand versatilityofthelibrary.For instance, reverse tmnscr tptase (RT) exhibitsan RNAseactivity. SuperscriptRThasbeen cloned andengineered such thatthe RNAse activityhasbeenabolished.Thisdecreases mRNA degrada tion therebyincreasing both the proportionof full-length cDNAsas wellasfirst-strand yields.Another enhanceme nt used toproduce this dtrcctlonnlllbmryis the use ofaprimer-adapter(Fig.2.1).Inthiscase, a poly dTprimeris comb inedwith a double-stran ded adapter which encodesaNotI restrictionendonu clease site.The polydTregionannealswith the poly A tail of the mRNA andnetsas a primerforfirst-strand synthesis.The finaldouble- strandedproduct will now containa NotIrestriction site.Theadditio nof a SITII adapt erfollowed byaNotIrestriction digest introd ucesasymmetry into the cDNA and allows fordirectionalcloning(Not I restriction sitesare

(37)

relatively rare in vertebrategenomes).Thenon-complemen tary Nill1/ 5111I restrictionsites onthe cloning vectoralso preve ntthe formationofempty cloneswhich do not contain aDNA insertandnrccommon ill random libraries (fora discussionon cDNAlibraries, seetheinstructi onal manual included with the SuperScrip t Plasmid System for eDNASynthesis..nd PlasmidCloning(GibeoBRL».

2.1.2Apolip oprot einpurification usin gsequenti alflotation.

Sequential flotation isthemost commonmethod used hiseparate plasma lipoproteinparticles. Theproced ure exploitsthe factthat the density of each type oflipop roteinfalls withina welldefinedrange (Table1.1) and involves adjusting the density of the plasma/serum followed by ultracentrifugation.Forinstance, thedensityofVLDLisnol greater than 1.{l06 g/mL.Ifthe densityofthe plasmasampleis adjustedto 1.006and centrifuged, all of theparticleswith a densitylessthan 1.006willfloatto thetop ofthe plasma whilemoredenseparticleswillpelletatthe bottom ofthecen trifuge tube.The uppe rmos tVLDLfraction can thenberemoved andtheprocess rep eatedat a differentdensity.This allows the specificseparationof VLDL, LDL, and HDL.A simpleextractionto remove thelipids allows thepro tein componentto be analyzedseparately.

2.1.3Thepolymerasechain reaction(peR) .

The polymerase chain reaction(peR;Mullis and Falonna, 1987)is an iu vitroprocedu re thatuses shortoligonucleo tides(primers)toamplifyspecific DNA fragments fromaDNA temp late. Initially,all the componen ts requ ired

2:1

(38)

forDNArepli cation are mixed with both the primers and thedesir ed template.These compo nents include a hea tstable DNA polymerase(e.g.Taq polymerase isolated fromThennus aouclicus, a bacteriumthat grows inho t waterspr ings). Two characteristicsofTnq polymerasemakeitusefulforpeR:

it isresistant 10 denaturation at high tem per atu res and its optimal tempera tu re forDN Areplicationis740C.

Onceallthe componentsare mixed , theyareheatedto950Cto denatu re any doub lestrandedDNA present. The mixture is thencooled to allow the primersto annealto theapprop riatecomple mentarypositionson thetempl ateD:"JA. Theshortleng thand relatively high concentra tionof the primerspro mote sprimer anneali ngover reannealingofthecomp leme ntary templatestrands. Theactu al temperat ureatwhich annealingoccurs is usually bet ween 400Cand 550Cand isemp irica lly determi ned for each pairof primers . When the primershaveann ealed, the temperatu reof the reactionis raisedttl 72OC.Tnq polymera se willthen replicatethe tem plat esto which primershaveanne aled. For PeR to be successful,theprimers mustanneal to regions which HnnktheDNAfragment of inter es t, bu t always onthe compleme ntarystra nd. lnthis way,the fragm ent ofinterest will be amplifie d by bo th primers, bu tin opposite directions.Thesetwo prod ucts willbe com plem ent arytoeach other. Thus,theproduct ofone primerbecomes th e templatefor theoth erprimerinsubsequent ampli ficat ioncycles andleads to allexpone n tialincreasein the amou ntofampli fiedDNA.In practice,25to 35 cyclesofamplificatio ni.Fig .2.2)are sufficientto produc e products wh ichcan beseenonnn ag<lfose gelafterethid iumbro midestain ing.

(39)

2.2EXPERIMENTALand DISCUSSIO N

2.2.1Is olation andseque ncingofanapoA·1 clone from abrown trou t IiVN, eDNA library.

AcDNA librarywas constructed from mRNAextracted fromtheliver ofabrown trout usingthe SuperScriptPlasmidSystemfor cDNA Synthes is andPlasmidCloning (Glbco BRL; C.McCowan,unpublished results].Inan altem.,t to identifyhighly expressedrncssngcs,randomclones werechosenfor sequencinganda lOmLLB/a mpicillinliquidculture preparedfor each nne.

Plasmid DNA (pDNA)W<lSthen preparedfrom3mL of this cultureus ing the Magic MiniPrep plasmidpreparationkit(Promc ga)in a finalvolume of50~1 1..

An aliquot of9~Lwas removedfrom cnch plasmidprcpornttonand mixed withIp.Lof2M NaOH?2mMEDTA.The reactionwas incubatedill':O llCfor fiveminute sandlOj.lLof1.6Mammoniu mace tate (pH4.H)was then added. This wasfollowed by 40l1Lof 95'X.ethanol (-20DCjand anincubation at·70oC for30 minutes.The precipitated plasmidwas pcltctedthrm,~hcenlri f\l~al ion at 12 000 rpm for 15 minutes (40C)and thesuperna tantcarefullyremov ed.

The pelletwas then washed with 500l1L of 70% ethanol (-2110C) and centrifugedas above forfiveminutes.TI,C supcrnatnntwas again removed and thepellet driedundervacu umfor 30minutesat roomtem perature.The pelletwasfinally suspended inlO~Lof water andsequenced us inJ.;the SequenaseDNA sequencingkit (UnitedStatesBiochemical).Fractionatio nof the reactions through astandard sequencing ~cl(6'X.pulya crylmnidl'/7M Urea/IXTBE(89mM Tris,112mM boric acid,2mM EDTA.pHH.J)fortwo hour s at40 watts yieldedapproximately200bpof5' sequen ce.Elichseq lll~nce was compa redto entries intheGe nBa nk nucleotidesequence dntabaseustng

(40)

the FASTAprogram (LipmanandPearson,1985).The sequence obtained fromtheplasmidpBTLB27 showeda highlevel ofsequence similarityto the apoA-!eDNAsequence reportedfor Atlantic salmon(Powel1ct al.,1991).

Longerfractionationtimesandsequencing withtheUniversal primeryielde d mos t of theremainingsequence including the3' poly-Atail.Although the comp lete sequence hnd not beenobtained,the presenceof the poly-Atail and theATCinitiatio ncodonimplied that the completeapo A-Icodingregion hadbee n isola ted.

To obtain the remaining sequence,anoligonucleotideprimer was designed complementaryto the 3'sequence obtainedabove (Fig.2.3),This primerwasthen used10sequencepBTLB27.The dataobtainedfrom these sequenc ingreactionsoverlappedthe 5'and 3'sequences obtainedabove,thu s giving the comple tesequence of thep13TLB27cDNA inse rt.When thisbrown troutsequencewas compared to rainbowtrout (De lcuveettil.,1992)and AtlanticsalmoncDNAsequences,twothings wereimmediately observed:

1. Apoa- lishighly conserved amongthe three Salmonidspecies, 2. An87 bp region presentin bothrainbow trout and Atlantic

salmon wasnot presentinbrown trout.

To determi neifthis deletionproduceda correspondingphenotype(i.e. a truncated protein),an examinatio noftheepoa-I protein inbrowntroutwas initiated.

2.2.2IsolationofHDLfrombrowntroutserum and partialpurificationof apoA·1.

(41)

Hum an plasma (P.Davis,27.5mL) and brown trout serum (c.

McGowan,29.0 mL) were dialyzedexhaus tivelyagainst a 0.85% (g/HX)ml.]

solutionofKBr(d= l. OO6 glmt,mock solutionA). EachsnrnplcW,1Sthen tra nsferre d to a 30mLultrace nt rifugetube and filled to votnmc/bnlnnccd with mock solu tion A. Both tubeswere the n centrifuged ut 37 SOO rpm/140C/18hours in a 7OTI,fixed-ring leroto r.The VLDLfraction was visibleas a cloudy pellicleat theto p of thelube.Thisfraction wasre mo ve d with a Pasteur pipette and discarded.To obtain the LOt fructinu. the remainingplasm a / serum was adj ustedto d=1.063g/mLby theadditionof 0.083 g/mL ofKBrto eachtube. Bo thtubes were thenbalancedwithmock solution 8(8.22% KBr, d=1.063)and thencentrifuged at 37 SOOrpm l WlC/24 hours.The dear,orangelayer containing LOtwas removedrind discarded.

Thedensity of eachsample was thenadj ustedto d=2.10 }i/mL throughthe addition of0.235 g/mLof KBr to each tube and ccntrtfugcd at 37 SOO rpm / 140C /4 0 hours.Boththe humanand browntroutsamples contained an ora nge laye r similarto the LOt fraction.TheseHDLImction s (3mL andHmt., respec tively)were thendialyzedexhaustivelyagainst asolution of0.15M NaCI/SOmMTrisH Cl(pH 7.5)/ 5m M EDTA and stored at 40C.

To analyzethe protein con ten tof eachHOI.fraction, thelipop ro te in parti cles weredellpid atedas outlinedinFig. 2.4. The dried proteinpellets were then resuspendedin 1.0mL(huma n)and3.0mL(browntrout)of'IX UTE (8M urea /lOmM TrisHCI(pH7.5)/lmMEDTA).AWilL aliq uot (induplicate) of eachprotein sample was then fractio na ted through asodi u m dodecyl sulfate(50S), polyacryl amide gel(slackinggcl·3'Y" polyacryla mide, separating gel-15%polyacrylamide)at80V (stackinggel)and180V (separatingI-::el)until

(42)

the blue dye reachedthebottom of the gel(approximately1hour),Standard proteinmarkersas wellas human apoA-1(Sigma) werealso fractionatedas markers.Tn visualizethe proteinsthe gelwasstainedfo r30minutesin0.2"1"

(w/v )Coomessic Brilliant BlueR-250 (Kodak) in50% (v/ v) ethanol ,10%

(v/v )aceticacidand thendcstained in 20%(v/ v)ethanol,10%(v/v )acetic acid.As shown inFig.2.5,the majorproteinin both preparationsmigrates at or ncarthe same rate as thehuman epoa-Istandard.However,bothsamples show considerable contaminati on . Onecontaminant ofrela tively high concentrationin thebrowntroutsample migrates justbelow 14 4000a .The con taminantismostlikelytobeapoa-Il.This apolipoproteinisthe other mainproteincomponentofHDL(Table1.1)and migratesat approximately13 OOODa(Babin nndVernie r,1989).

Inanattempt to furtherpurifyilpoA-Ifrom browntrout,semi- quantitative Ion-exchangechroma tographywasperformed abatch adsorption method'.DEAE-Scphadex (A-50,Pharmacia)wasusedsincethe inferred nrninoacid sequencesfrom Atlanticsalmon and rainbow troutcDNA sequencespredictthatapca-lwill be negativelycharged at neutra lpl-l.The bindingorelutio nofapoA-1fromthe resin under various conditionswas assayedby50S-PAGE asdescribedabove.

Optimalbinding:of apoA-1intothe resinoccurredat pH7.5inIX UTE (datanut shown)whilemaximum elution occurred betweenO.25Mand O.30M NaCi(Fig.2.6).Althoughsomelow molecularweight contaminationcanbe seenat/bel owO.25M NaCl, most of thehigh molecularweightcontaminati on remai nsboundto the resin.Topurifythisprotein to homogeneity,column

.l!t ll\Exc1 h\ngl.'Chronwtcgrnphy:Principles lindMethods,3tdedition. PhllrmaciaLKB

Uitltl'chmllugy,UPP~U lil,swede n,19lJI,p.49.

(43)

chrom a togra phyusing asaltgradientcouldbeused.Howeve r.ourintention wastodetermine the size of the major proteinspeciesofI-IDL.Itisctcarthnt thisproteinis similar to human apnA-t inboth size andcharge.A:;sulllillh thatitis indeed brown troutapoAI,itis alsoclearthatthe H7bpdeletionill thecDNA is notan actua lphenotype.How ever,atrun catedprotein may haveadecreasedstability, may notbesec reted,orma y notproperlyassemble int oHOtpar ticles.Ineitherof these scenarios,the pur ification protocolLtsL'd for apoa-I wouldno tdetect a trunca tedprotein.Western bloltin)!;(Iftntal liver proteins using anepc a-t-spectttcantibodycouldbe used ttldelL'l't differ entproteinisofor ms.peRustng"poA-1locus-specttlcrrime rsW;lSused toinvestigatethismatterof the 87bpdeletionfurther(sec ChapterIII).

2.2.3Amplif icati on andseq uencing ofgenomic DNA toinvesti gatetheeDN A deletion obse rvedinthepBTLB27seq uence.

To determine the genomic sequence of the cDNA deletion, oligonucleotide primers were designed to flankthe regionCOllla ining thv 87bpdeletion . These20·mers,labeled 63and 6S(SL'Crig.2.H), weredL'Sigll'..'d over regio nstha t nrc100%identicalinthethree snlrnon ldspecies. E.1ChpeR reaction was pe rfor medina]O~Lsolution con talnln g SOmMKCI,101llMTris- HCl (p H9.0), 1.5mM MgC I2, O.2mMof each dNTP, O.5mM(Ifeachprime r, 0.25 units- ofAmpliTaqDNApolymerase (pe rkin Elmcr),andSOngoftem plate DNA. Ampli ficationswerepe rfo rm edin a Cen ampPCRSysteml)(l{)Othe rmal cycler(Per kinElmer) usingthe followin g method: one cycleofLJsoC /3 minutes follow ed by 30 cycles of950C/30sec. (dena t uration), 56(JC.':1(~(.'(.

40"Cunit is definedasthe amountofenzymethatwill incurpuratl! IOnmuJofclNTI'~illI";111 addinsoluble materla lin 30mtnu tos at 74°C.

29

(44)

(a nnealing), and 72C1C/45st.'C.(e xtension ). Plasm id DNA (pBTL B27) and genomicDNAfrum Atlanticsalmo n.bro w ntrout, and rainbowtroutwere usedasn-mplan..'S.Eolchl~Lreaction was then dilutedwith 2pL of6X Ira ckinlldye ())'X ,(wI " ) glycerol. 0.25%(w/v)bromophenolblue.0.25%(w/v)

xylenecya nol

r:n

andfrac tionatedthrough alOOm L3%Nuseivcagarase/lX TA (40mMTrisl-Kl(pH7.5),20mMsodium acetate)gel. Ethidiurn brom ide slainingandU.V.illumination allowedthePeRproducts10bedetectedand pho togrephcd.Theresultsof this experimentare showninFig. 2.7.The po s itive con trol,usingpBTLB27 asthetemplate,givesa single amplification pro d uctatilth!lu gerthnnthe603bpmar ker. Thisisexpe ctedns the eDNA sequence predictsitfragment of613bp. When genomic DNA from the S;lllllUllidswasused,twobuildswereproducedfor each lemplate.Thelargest bandproducedilltheAtlantic Sillman and browntroutre actionsmigrat ed a ltul ehi,')lerthan th e 872bpmarkerH~)()bp).TheeDNAdeleti onis,however, onlyH7bpin length.The additio na llOObp (9()().6IW-2001isduetothe pn.'Sl,.'OCCofanlntronwhichisalsoflankedbyprimers63 ..nd65(seeChap ter III).Surpris ingly, both theAtlanticsalmonandbrown trouttem p latesalso produced abandthat was thesam esize as the positivecontrol. Although conta minat ion ufthe reactionmix withpBTlB27 is one possibleexplanation.

the s esmallerban dsmayrepresent the presence of apse udoge n e in the Atlill~ticsalmonandbrowntroutgenornes whichlacksboth the 87b pdeletion rogtonas wellasthe intron.

Toobt nln the sequence of the87b p deleti onreg ion of theeD NA sequence,the\lOObp Imgmcnt amplifiedfrombrow n troutgenomicDNA was excis edfromthegeland purified inSOIiL ofwat er using the Wiz ardpe R

(45)

Preps DNA Purification System(Prom c ga). Using9.5~tL ~l(this solution, lilt.' fragmentwas sequencedfrom the3' endusingJ~rend-labeledprimer 6..'; as per the manufacturer' s spe cification s included with the ill1ll1 DNA Sequencing System (cycle sequencing kit, I'romoga).

An

reac tions wen'then fractionated through a standardsequencingge l (above)for-2 hours.TIlt.'H7bp sequence was obtained alongwith3'and 5'flankingseqlll'nCL' .The composite apoA-1eDNA sequence! from brown trout is shown inr:ig. Vi.

The rainbowtrout also producedIwopeRproducts, both of which werela rgerthan the positive con trol.The smalleris-H50hp in length.The difference in size between thtsproductand thelargest productprod uce d frum the other Iwo speciesis due to the presence of a shorter huron(Sl'l'Chapk' r 1Il).Another bandof-1050bpwas alsoprod ucedfrom the rainbow trout template. The originsof this band arc uncerta in.Thus ,each gcoornlcDNA template producedone band of a simila rsizeand oneIh.,1 could IIlll be cosily explained.Tnhopesof clarifyingthis iss lie, amore detailed studyufthe "pnA·

Iintronstructure /sequencewas undertaken(SL'CChapter Ill).

2.2.4Com paris onofhumanand browntrout ;>"oA-1seq ue nces . Using the alignment programClustalV(I-lim;inst'I1/1.,Iyn ),the brown troutapox-tinferred amino acid sequence wasco m pared tothe human apox-Isequence(Fig. 2,9).Althoug h thetwosequen ces shareonly 26% nucleotideidentity, many of the substitutions Me synonymous and the overall structure of the protein has beenconserved.Th is is best demonstra ted in theco nserv a tion of an 11 or 22 'Imino acid repent separatedbypro line

'Gcnbank AccessionItU9383.

.11

(46)

residues.Within cnch repeat we can also observe the repetitivenature ofthe placementof charged residues. Inparticular, a conserved glutamateor aspartateresidueoccurs every 7-8 residues (orap proxim a tely two turns of an u-hcllx). Toge the r, these data imply the conservation of a repeated amphipath lcp-hellxand thus the conservation offunctionas alipid-bin ding do main.The conservation of molecular weight and charge structure,as demonstrated above (, alsosuggest thatthe overall struct ureandfunctionof ilpoA-1is similarin <Ill vertebratespecies.

(47)

Fig. 2.1. A schematic representationofeDNAsynth esisul' illf;thl! Supe n-crtpt PlasmidSystem for eDNA Synthesisand Plasmid Clcutng.The prod uction of asymmetricrestrictionsites oneachend of the eDN A, to allowtheproduc tion ofa directionallibrary, isillustrated.

JJ

(48)

mRNA

Firststrand synthesi s

Secondstran d synthesis

Sail<Idapteraddition

NotIdigestion Sizefractionation

Ligationto plasmid pSPORT 1 Noti-Salleu t

eDNAready fortransform ation

(49)

Fig. 2.2. Schematic representationof a standardamplificationcyclelISl 'tiin the polymerase chain reaction.The temperatures find timesshown fo r each step are unique for each set of primers andtemplate.

.15

(50)

T('O

100 90 00 70 60 50 40 :lJ 20 10

Denature

~~

Time(s)

(51)

Fig.2.3. Alignmen tof apox-IeDN Aseq uences ofbrown trout(On ,At lantic sa lm on (AS), an drainbowtrout(RT) showingthe primer dcstgncd In sequenceover th eunknown re gion of pBTLB27.The sequenceobtained revea ledan87bpdeletion as shown witha ',',The nuclcoudcs in the brown tro ut sequencearenumberedfromthe 5' end of the eDNAseque nce.

37

(52)

~

BT CGTCTGGAGGAGCTGAGGACCCTGGCCGCCCCCTATGCTGAGGAGTACAAGGAGC- - --- - - ----- -- 662 AS CGTCTGGAGGAGCTGAGGACCCTGGCAGCCCCCTACGCTGAGGAGTACAAGGAGCAGATGTrCAAGGCTGTr RT CGTC'I'GGAGGAGCTGAGGACCCTGGCCGCCCCCTACGC'IGAGGhGTACAAGGAGCAGATGATCAAGGCTGTT

BT - - ----- --- ------- ------- -- ------ - --- - --- - -- - ---- - --- --- -- --- ----- - ----A G 79J.

AS GGAGAGGroCGTGAGAAGGTGGCTCCCCTGTCTGAGGACTTCAAGG-CCAGATGGGCCCCGCCGCCGAGGAG RT GGAGAGGTGCG'IGAG.!\AGGTG'TCTCCCCTGTCTGAGGACTI'CMGGGCCAGG'IGGGCCCCGCAGCCGAACAG

BT GCC.ll,.ll"GG.ll,A...a.GCTCATGGATT'T'CT.a.CC.r..GACC.z..TC.n.GCCAGGCCAT 734

.;>,5 GCCAAGCAAA.'\GCTCCTGGC'!'C TCT.'\ C GAG.n.Cc..'\TCAGCCAGGCCAT

RT GCCAAGCAG.:....a.GCTCCTGGC'ITI'CTACGAG.,tI,CCATCAGCCAGGCCAT Primer65

(53)

Fig 2.4.Schematic represen tati on of the dclipidation of opollpo prorctn particles.The procedureou tlined isused for eachmLoflipoprotein.

39

(54)

Su pernatant

Tot,,] npoprcteinpcllet (wnsh5Xwith2SmL

cthcr,-2{)lQ

InjectLP into25mLethanol/

diethyle ther{3:2(v/v),-2O"C).

Placeat.2().'C£or9O minutes.

Ccntnfugeat2500rpm for10minulesat-2O''C

Pellet

j

suspcnd in25mLe ther (-20''0nndccntrifugcat 2500rpm for 10minutes.

Pehet _

Centrifugeat-2O'C,2500 rpmfor10minutes I - - - -- - - Pellet

,

Sup ernatan t (discard)

(55)

Pig . 2.5.5DS-PAGE analysisof protein isolated from HDL (fn[J (}will~

de lipidation).Duplicate samples fromhu man andbrowntrou t IIDLwere loa dedwith humanapoA-1(HS;Sigma )as wellasa protctn marker (M, ElectrophoresisCalibrationkit, Pharmacia; Phosphorylase b,Bovine Se rum Albumin,Ovalbumin,Carbonic Anhydra se, SoybeanTrypsinIn hibito r,and u-Lactalbumln).The molecularweight (Da)of each ma rke rprote inis shown.

41

(56)

Size (Da) M 97000 66200 45000 31000 21000 14400

human brown trout IplasmaI serum

HS , - - - - , HS

(57)

Fig.2.6. Semi-quan titativ eion-excha n ge of browntroutapoA-rfrom DEI\E- sephadex withNaCl. Afterincuba t io n of the DEAE-Scphadcxwthbrown troutHOtproteinextract, theresinwaspellcted and thesupernatant was exam inedwith50S-PAGE.HS,humanapoA·!(Sigm<l).

4.1

(58)

Concentration of NaCl (M) HS 0.05 0.10 0.15 0.20 0.25 0.300.35 0.40 0.45

nnnnnnnnnn

... ... -

(59)

Fig. 2.7.Amplificationofthe 87bp deletionregion inth ree salnumids llsing primers 63 and 65. Three genomic templates,brown trout (BT),rainbowIrll\ll (RTl,and Atlantic salmon (AS), were amplified. As a positive control, pBTLB27 was also used as a template(+ve).All amplifications and a sizl' marker (M, 0X174DNA digested with HIH' III) WCI'Cthen Iructlountcd through Nuseiveagarose, stained withcthidium bromide, and photographed under V.V.light. Note: A negativecontrol reaction (lacktngtemplate DNA) was performedbutno bandswe reobserved.

(60)

+ve BT RT

AS

M Size (bp)

1353 1078 872 603

(61)

Fig. 2.8.The comple teeDNA.sequence of ilpllA-1 ill brown trout,511111/(/IrIIllll.

The eDN Anndinferr ed amino add sequences are shown.Theinitiatiuu and stopcod ons arc shown in bold type-face.The polyedcnylations;~nal is underlined .Prim e r sitesaredesig nated withstra ight arro w andinlru n/ pxoll boundariesare indicated witha right-angled arrow.

(62)

:---~~~~:::

. . : :.... 1l1lJ\

CI'GGCTCl'TGCAcrcACCATCCTGCTGGCCGCA<fT~~~TGTI'CCCATGCAGGC

L A L A L T I L L A A A T O A V P M Q A TGATGCTCCCTCTCAGC'IGGA.GCA'I'G'I'GAAGGTAGCCATGATGGAGTACATGGCTCAGGTGAAGGAGACCGGACAGAGGT

D A P S Q L f ; H V K V A M M E Y M A Q V K E T G Q R

CCATCGACC1'1'C'IGGATGACACAGAGITCAAAGAGTACAAEG';;;~~';;TCCCAGAGCCTroACAACCTACAGCAGTAT

S ! D L L D O T E F K E Y K V Q L S Q S L D N L O O Y GCCCAGACCACCTCCCAGTCCCTGGCCCCCTACAGCGAGGCCITCGGCGCTCAGTrGACTGATGCCGCCGCCGCCGTGCG

A 0 1 ' T S O S L A P Y S E A F G A O L T O A A A A V R CGC'I'GAGGTCATGMGGACGTGGAGGACGTGCGCACACAGCTGGAGCCCAAGCGCGCCGAGCTCAAGGAAGTCCTGGACl...

A £ V ~l K 0 V £ 0 V R 'r- 0 L E P K R A £ L K -" V L 0

AGCACATAGACGAGrACCGCAAGAAGC'IGGAGCCCCTGATCAAGGAAATCG'ITGAGCAGCGCCGCACCGAGCrGGAGGCC K H I D E Y R K K L E P L I K E I V E Q R R T E L E A TTCAGGGTr.:r...AGA'IGGAGCCCGTTG'I'GGAGGAGATGCGCGCCAAGGTGTCCACCAACGTGGAGGAGACCAAGGCCAAGCT

F n V K H E P V V E E ~l R A K V S T N V E a T K A K L

CATGCCCATCGTGGAGACCGTCCGTGCCAAGCTGACCGAGCGTC'ffiGAC-GAGCTGAGGACCCTGGCCGCCCCCTATGC'I'G

» P I V E r V R A K l- T E R L E E L R T L A ;\ l' Y A

AGGAGTACAAGGAGCAGATG'ITCAAGGCTGTIGGAGAGGTGCGCCAGAAGG'I'GGGGCCCCTG.i.\CCAACGAC!'TCAAGGGC

E -" Y K E 0 i~ F K ." V G I:': V R -" K V G P L T N 0 F K G

C.i\GGTGGGCCCCGCCGCCG..ll,.GCAGGCCAAGGAAAll.GCl'CATGGATITCTACGAGACCATCAGCCAGGCCA'TGAAGGCAt;;:

c V G P A A E O . " 1-: E K L M 0 F Y s T I S 0 A M K A aaCa c g ctc t.c a a c c g g a c c c t.CCCt.Cc ctc c c t t c c c g t.c t.c a c t.c a c a c t g a c t c a c a c a c c a t a c g t ac c ac g c t.a a tg c c a a a c t g a t g c a c t t c c t c t g c ag t ga c atg g c agg a c t ctt g c t c t c t c t a ac c a c c a c c a c a t g c g c t c a ag c g c acgcaagcgcagacactaacacactattJcatacattcagttttgaactgtgt tcagggcctgtgtgcacaatcctgggc ctgcacaaattcgactgtactatgaacatcaagtgtgaatattcttgtgttgctgcttgttcaagatagctgtgtgcttc

gaaacagct.c~caccatactgt ttcatact(a)n

8023

160

"

240 76 320103

400

>2,

480156 560 183 640

209

720236 800 262 8BO 960 1040 1120 115B

(63)

Fig 2.9.Alignment of human (topsequence) and brown trout(lm n llm sequence)npoa-Iamino acid sequences.The threeFunctlonnl rcgfons nrc shown:theleader peptide(residue ·24 to -1w.r.tthe humansequence).tbcN- terminal33 amino acidconserved peptide(residues11 to 43),andthe lipid bindingdomain(residues44 to241).Thelatte risseparatedinto22 or II aminoacid repeats.Amino acids 1-10have notbee n assigned a particular function.

(64)

-2 4 +1 f<fKlI.AVLTLAVLFLTGSQARHFWQQDE PPQSPWDR MKFLALALTI LLAAATQAVPM-QA DA PSQ-- LEH

~~ekA~~~R~~~g¥gS~~¥gEL5~~~~~~~~

LKL L DNWDSVTSTFSKLREQLG VQLSQSLDN LQQYAQTTSQSLA PVTQEFWDNLEK ETEGLRQEMS PYSEAFGAQLTDAAAAVR!l.EVM KDLEEVKAKVQ KDV EDVR TQLE PYLDDFQKKWQEEMELYRQK VE PKRAELKEVLDKHIDEYRKKLE PLHAE LQEG ARQ KLHE LQEKLS PLIKE IVEQRRTE L EAFRVKME PLGEEMRD RARAHVDALRTHLA PW E EMRA KVST NVEE T KA KLM PYSDELR QRLAARLEALKENGG PIVETVRAKLTERLEELRTLAA ARLAEYHAKATEHLSTLS EKAK PYAEEYKEQMFKAVGEVR EKVG PALEDLRQG LL

PLTNDFKGQVG

PVLESFKVSFLSALEEYTKKLNTQ PAAEQAKE KLMDFYETISQAMKA-

10 8 4340

65 62 87 84 98 95 120117

142 139 164 161 18 6 18 3 208 205 219 21 6 243 239

(65)

Chapter III

Isolation and Characterization of apoA -I In tervening Sequences II and III in Three

Salmo nids

51

(66)

3.1INT RO DUCTI ON

3.1.1 TheOriginsand Evolutionof Int ervenin gSequen ces .

Ifthe structure of atyp ical gene is examined amongvariousgenornes, there is a clear discrepancy- cubacteria,archnebacteria, and organelles generally lack intro nsequences suchthai the genes consist ofcontinuous stretchesof DNA, which arc directly relatedto the amino acidsequence, whereasmost eukaryotcsexhibit genes interruptedbystretches of non-coding inlron DNA (Hollandand make,1990;PalmerendLogsdon,1991). The lackof coltncarttybetween the geneand amino ncid sequencein eukaryoteswasin itself a stilrtlingdiscovery(Brcathncch cIal.,1977; Breathnachand Chambon, 1981) but posed no interesting question: did the ancestor to prokaryotes/cu karyo tescontainintronswhich have subsequen tly been lost in thebacteriallineage or have cukeryotesgained tntronssince thedivergence ofthe bacteriallineage?The forme rtheory is referred to as the 'in trons-ea rly' theory or the cxontheory of genes whilethe latter is called the'Introns-le te' theory.

Each of thesetheories have beenverycontroversialand theissue remains unresolved.However,onemajorargument,thatof excn shuffling, has risen aboveallothersand is recognizedhere. The concept of exon shuffling was first proposed when itwas observed thatmost proteins containing more than 200 aminoacids consistedoftwo or more struct ura l domains(Hollandand Blake,1990). For instance, one domainmight be a bindingmotifwhile theotherdomainmight contain acatalyt ic site.The arrangementof the bindingmotifand thecatalyticsitewouldbe such that both wouldoccur at the interface of thetwo structural domains. This type of

(67)

arrangeme ntis seenin the various dchydrogcnascs whichhn\'esimilur bind ing properties butdifferent catalytic activities(Holland andmake,lY90).

Itthus seemed intuitive that two smallerprotein s had been joined to produce onelarge protein througha mechanism involving gene fus ion, i\lthUll~h this type ofprotein production would bevery advantageo us from all evolutionary perspecti ve,a reasonablerncchnnisrnwas not available. CClll' dup licationfollowed by recombinationseemed reasona ble excepttlunthere wouldbe a high probability of frame -shift mutatio ns. The discoveryof intronsineukaryotes provided thistheorywith theflexibilityit required.If crossing over occurredbetween the intronsof the two gl'nes, then the possibility offrame-shi ft mutations wouldbe greatly decreased(Holland and Blake, 1990).

Exo n shuffling inandofitself does not provideevidence for ctther the early orlate theoryof intron origin.Howe ver cxonshuff ling,as evide ncedby theplacementof intronsbetween struc tur nl/Iuncrlo na l dom ai ns . has been observed in a number of proteins such as pyruvate kinase, phosp hogl ycerata te kinase, andvariousdchydrogcnascs.GiventhelIgcor suchglycolyticandotherenzymes, thisprovidesstro ngsupportforthe ea rly existence of introns, Although this concept met with resistance from propo nen tsof the intronlate theory,it continu ed toha ve a strong influence onthe issu e ofintro n origin until 1994. Stoltzfusefnl.(1994)tested the theory that intro ns divided proteins intodomainsthat were autonomous andcould indepe ndentlyfoldinto domainsor smallerunits of protein structure such as secondary structures and motifs, They detected no evidence o( a co rrespond ence betweenexonsandprotein structurein four ancie n tpro te ins,

(68)

whichim p liedthaithe cxon theoryof genesisunfounded.Thus,therole of inlrons in evolutionbypromotingexonshufflingseems toberestricted to relativelymodemproteins.

3.1.2IntronMapp ingUsing PeR.

Oncethe eDNAsequenceofa gene hasbeen determined,thelocation oftheind ividualcxonswithinthe entire genecan alsobedete rminedif genomicclonesfor the genearcavailable.ThisPCR·basedte chnique is referred toas exon-mapplng(Niuand Crouse.1993). Subclonesofthe genomicclonesnrctypicallyprepared inanapp ropriate vectorand exon- specific primersarc usedwith vector-specificprimers10mapthepositionof the exonwithin the frag mentaswellasprovidesequence in formati on concerning theinlron/cxo nboundary.Inherent inthis technique is ann prior;kno wledgeofthe exon structureof thegene such thatappropriate primerscanbemade compl emeo tarytotheeDN A sequenceinplacesthat willrepresenteach ofthe exons.One sourceof such infor mation wouldbe thesequenceofthe same genein aclosely relatedspecies.

Ifthe cDNAsequence isknown andadditionalinformationaboutthe presence oflntroneis available,intron mapping can alsobeperfo rmedin a similar fashion.In thecaseofepcx-I,anumberofgene sequenceshave been published(Table1.2) lindthepresence/sequence oftheintro nsdetermined.A com pariso n ofthese seque nces revealed tha t theintron/exoninser tion site in each sequencewasconserved. Because thiswastrue forthedistan tly related humanandchickensequence,itwashypoth esizedthatit wouldhold true in fishaswell.Tode termine the insertion site ofintron Uand IIIinthe

(69)

salmo ntds,the cDNA sequencesofhuman,chicken,and browntroiuwere aligned (see section 4.1 fora discuss iononsequence angnmcnt).The point uf introninsertion in the human and chicken was then noted in the brown trout sequence.Two pairs of primers were designedto flankeachof the putative intron insertion sites (see Fig.2.8). Unlike cxnn mopplng.thts technique uses genomicDNA as a template ratherthan genomic su bcloucs.

As a result,onlyIVS for which bothflanking regionsme known will be able to be amplified.In thecase ofapoa -l,IVSI is in the 5'-lllltr<1nslalL'1.irC~il\ll .Ttl determinethis sequence, a genomic library wouldhave to be constructed.IV$

Icould then be isolated byusingi1vector-specific primer and a cDNA derived primer to amplifythe entire 5' region. Alterna tively,5' RACE (Rapid Amplification(If cDNA Ends)couldbeused to determinemoreofthe 5' apoA-!sequence.PeR analysisof genomic DNA could the nyield afril~ment containingthe intron.

In snlmontds, intron and exon mappingis nn important conce rn.

Following the genome duplicationevent, milnygenes become functiona lly redundant. This allowed mutations to be incorporated at one loc us whilelhe other retainedthe original structureand function.The loci now have two possiblefates:duplicateexpression will eitherbelost orre tained (Alle ndorf and Thorgaard, 1984). The former is quite common in snlmonids as approximately 50% of the duplicatedlocidonot produce detectable protein products(Allend orf and Thorgaerd,1984).Ifthe expression of the loci is not affected,additiona lfates arepossible(Fig. 3.1). One way to detectbethtypes of changes wouldbe to examine theintron/exon structure(If genes at different

55

Références

Documents relatifs

In the present article, we investigated the inhibitory effects of QS-13 on angiogenesis in vivo in a Matrigel plug assay and in vitro on HUVEC proliferation, migration and

Using in situ hybridization, we have detected perikarya that conta.in the messenger ribonucleic acid (mRNA) encoding salmon GnRH in two teleost species, Atlantic

Over the past 10 years, endogenous viral sequences have been discovered and characterized in the genome of numerous crops, including badnavirus sequences in the genome of banana,

Over the past 10 years, endogenous viral sequences have been discovered and characterized in the genome of numerous crops, including badnavirus sequences in the

Although most FGFR2 mutations found in patients with Crouzon and Pfeiffer syndromes are located in exons 8 (IIIa) and 10 (IIIc) that encode the extracellular part of

Previous studies showed the potential of selective breeding to increase n-3 LC-PUFA levels in salmon tissues, but knowledge on the genetic parameters for individual muscle fatty

Cette étude nous montre que la Dimedone et l’ortho-phénylènediamine deux produits commerciaux et bon marché, réagissent pour donner l’intermédiaire

Based on all these arguments, the current research was conducted in order to determine the optimum proportion between Met and CysTSAA in the total of sulfur amino acids