Activation of the pathogen-inducible Gst1 promoter of potato after elicitation
by Venturia inaequalis and Erwinia amylovora in transgenic apple
(Malus
domestica)
M. Malnoy
1, J.P. Reynoird
2, E.E. Borejsza-Wysocka
1& H.S. Aldwinckle
1,*
1Department of Plant Pathology, Cornell University, Geneva, New York, 14456, USA
2Pe´pinie`res Delbard, Unite´ de Micropropagation, Malicorne, 03600, Commentry, France
Received 4 April 2005; accepted 8 September 2005
Key words: beta-glucuronidase, expression, fire blight, Malus domestica, promoter, transgenic
Abstract
Rather than using a constitutive promoter to drive transgenes for resistance against fungal and bacterial
diseases in genetic engineering of apple (Malus domestica) cultivars, a promoter induced only after
infection was preferred. The ability of the Pgst1 promoter from potato (Solanum tuberosum L.) to drive expression of the gusA reporter gene was determined in two genotypes of apple: the fruit cultivar Royal Gala and the M.26 rootstock. b-glucuronidase activity in the transgenic lines grown in a growth chamber was determined quantitatively using fluorometric assays and compared to the activity in Cauliflower Mosaic Virus (CaMV) 35S promoter-driven transgenic lines. In both apple genotypes, the Pgst1 promoter exhibited a low level of expression after bacterial and fungal inoculation compared to the level obtained with the PCaMV35S promoter (15% and 8% respectively). The Pgst1 promoter was systematically acti-vated in apple at the site of infection with a fungal pathogen. It was also actiacti-vated after treatment with salicylic acid, but not after wounding. Taken together, these data show that, although the Pgst1 promoter is less active than the PCaMV35S promoter in apple, its pathogen responsiveness could be useful in driving the expression of transgenes to promote bacterial and fungal disease resistance.
Introduction
Constitutive promoters and non-specific promot-ers such as PCaMV35S (Cauliflower Mosaic Virus) and nos (nopaline synthase) have been frequently used as experimental tools to assess the effects of transgene expression in many plant species. With such promoters, a gene is expressed in the majority of tissues during most phases of plant growth and development. This limited tem-poral and spatial regulation may be suitable for proof of concept experiments, but presents a number of potential drawbacks for use in
genet-ically improved crops. For example, the presence of transgenes driven by constitutive promoters may result in homology dependent gene silencing, particularly when the promoter is highly active (Vaucheret et al., 1998). Thus gene expression under the control of inducible promoters is pre-ferred in any strategy to produce transgenic plants with transgene-mediated improvements in resis-tance to pathogens. Such a pathogen-inducible promoter should be strictly regulated, primarily responsive to multiple pathogens and not respon-sive to abiotic stress factors (Stuiver & Custers, 2001). A relatively small number of these promot-ers have been studied extensively.
Most apple (Malus domestica) cultivars are
susceptible to two important major diseases, fire
*Author for correspondence E-mail:hsa1@cornell.edu DOI 10.1007/s11248-005-2943-7
blight, caused by the necrogenic bacterium Erwinia
amylovora (Burr) and apple scab caused by the
ascomycete fungus Venturia inaequalis (Cooke). Several strategies have been used to enhance resistance against fire blight, including the use of lytic peptides such as attacin (Reynoird et al., 1999), and lactoferrin (Malnoy et al., 2003a), and against apple scab including the use of endoch-itinase (Bolar et al., 2000, 2001). However, all the transgenes tested so far were under the control of the PCaMV35S promoter. This may lead to undesirable accumulation of transgenic proteins in the consumed fruits. An evaluation of gene promoters specifically induced by bacterial and fungal pathogens is therefore needed in apple. To address these concerns we have undertaken a study of the efficacy of the inducible promoter Pgst1 in transgenic apple plants.
The potato defense gene Pgst1 (formerly called Pprp1–1) encodes a glutathione S transferase (Hahn & Strittmatter, 1994). The promoter of this gene has been previously shown to mediate rapid and local transcriptional activation in response to different types of plant microbe interactions (fungus and virus). Transcription from this pro-moter is not induced by environmental abiotic stimuli such as wounding or heat shock (Martini et al., 1993; Strittmatter et al., 1996).
In this study, we report the analysis of expres-sion profiles of the potato Pgst1 gene promoter in apple genotypes in response to biotic and abiotic stresses.
Materials and methods Bacterial strains
The wild-type strain of E. amylovora (Ea 273) and its transposon mutants (Table 1) were grown overnight at 28°C on Kado medium containing
kanamycin or rifampicin (20 mg ml)1) for the
transposon mutants. Inocula were prepared by suspension in distilled water at a concentration of
7.5107
cfu ml)1. Pseudomonas syringae pv.
tab-aci (B86–7) strain was grown at 28°C on Kado,
inoculum was prepared as described for E. amy-lovora.
Fungus strain
A mixed inoculum of Venturia inaequalis isolates 1805-2, 1777-8, 1771-2, 1778-6 and 1810-1, repre-senting the five races, 1–5, was used (Table 1). Inocula were prepared by suspension of the conidia in distilled water at a concentration of
2.7107
conidia ml)1.
Plasmid constructs
Two binary expression vectors, pBI121 and pBI101.1:Pprp1-1 were used. pBI121 (BD Biosci-ence Clontech, Palo Alto, CA) contained an nptII-based expression cassette as the selectable marker and a gusA-intron expression cassette adjacent to the right border of the T-DNA. pBI101.1:Pprp1–1
Table 1.Bacterial strains and fungal isolates used in this study
Strains and isolates Relevant characteristicsa Reference or source
Erwinia amylovora
Ea273 (CU 0273) Wild-type isolated from apple S.V. Beer E.a 273 G73 (CU 4277) hrc V:: Tn5-gusA1; HR)P) Wei et al., 1992 E.a 273 dspED1521 Deletion of 5’ dspE; Hr+; P) Bogdanove et al., 1998
E.a 273 D N–W (CU 5114) D (hrpN-hrpW)::aphII; Hrr; Vr(almost HR)) S.V. Beer
Pseudomonas syringae
pv tabaci Wild type, isolated from Nicotiana tabacum Venturia inaequalis Isolate 1805-2 Race 1 Isolate 1777-8 Race 2 Isolate 1771-2 Race 3 Isolate 1778-6 Race 4 Isolate 1810-1 Race 5 a
contained an nptII based expression cassette as the selectable marker and the gusA-intron under the control of the Pgst1 promoter. These binary vectors were introduced by electroporation into the supervirulent Agrobacterium tumefaciens strain EHA105 (Hood et al., 1993).
Plant material and transformation
The apple cultivar Royal Gala (RG) and the rootstock M.26 were chosen for this study because they can be genetically transformed at high effi-ciency (Borejsza-Wysocka et al., 1999; Norelli et al., 1999). Leaf segments were excised from
in vitrogrown shoots of these two cultivars three
weeks after subculturing. Transformation experi-ments were carried out as previously reported (Borejsza-Wysocka et al., 1999; Norelli et al., 1999) using Agrobacterium tumefaciens strain EHA105 containing pBI121 or pBI101.1:Pprp1-1 binary vectors. DNA was isolated from the youngest leaf of putative transgenic plants and non-transformed control plants as described by Cheung et al. (1993) and the PCR procedure was as described by Bolar et al. (1999). In order to check for the presence of promoter-GUS fusions, specific primers were designed to amplify a fragment overlapping the promoter region and the gusA sequence (Table 2). Non-transgenic RG, M.26 and transgenic clones were propagated in vitro (Norelli et al., 1998). Acclimation of the plants was performed as described by Bolar et al. (1998).
Determination of ploidy level
Ploidy level in the transgenic and untransformed clones was estimated by flow cytometry. Nuclei were isolated from in vitro leaves by manual chopping with a razor blade directly into the buffer described by the manufacturer (Partec, Mu¨nster, Germany). After addition of 4,6 diamino
2 phenyl indole dihydrochloride (DAPI; 2% v/v) and filtration through a 20 lm nylon mesh, the mixture was analyzed with a cytometer (Partec II; Partec).
Inoculation procedures and plant treatments Erwinia amylovora
The youngest expanded leaves from self-rooted plants in a growth chamber were inoculated by cutting the leaves transversely with scissors dipped
in a suspension (7.5107cfu ml)1) of the virulent
E. amylovora strain Ea273 or water (control).
Venturia inaequalis
The youngest expanded leaf was tagged and the plants were inoculated with a suspension of
V. inaequalis (2.7106 conidia ml)1), using an
atomizer connected to compressed air (Yepes & Aldwinckle, 1993). The plants were incubated in a mist chamber (16 h photoperiod of 40 micromol
m)2s)1, 18±1°C and 100% relative humidity) for
48H and later moved to a growth chamber. Abiotic elicitor
Salicylic acid (Sigma, St Louis, MO) was applied by spraying with an atomizer.
Fluorometric GUS assay
GUS activity in apple was quantified using the procedure described by Gittins et al. (2000). Leaf tissue (20 mg) was ground in 500 ll of assay buffer (40 mM sodium phosphate pH7, 4 mM EDTA,
0.08% SDS (w/v), 0.08% Triton 100 (v/v),
10 mM b-mercaptoethanol) containing methanol (1/4 v/v). After centrifugation for 15 min at 13000 g, 150 ll of supernatant was mixed with 350 ll of assay buffer and 200 ll of 4
methylum-belliferyl b-D-glucuronide (4 MUG ; 4 mM)
sub-strate was added. An aliquot of 200 ll was
Table 2.Primer pairs used in this study
Primer Sequence Size of amplified fragment (bp)
Gst1–GUS F CTAGCCACCAGATTTGACCA 957
Gst1–GUS R TCCCGCTAGTGCCTTGTCCAG
CaMV35S GUS F GACGTAAGGGATGACGCACAAT 1450 CaMV35S GUS R CAGCAGCAGTTTCATCAATCA
immediately added to 800 ll of stop buffer (0.2 M
Na2CO3) to be used as a time zero control. The
remaining mixture was incubated at 37°C for 60 min. The amount of 4-MU product was deter-mined using the DyNa Quant 200 fluorometer (k excitation 365 nm/k emission 455 nm; Hoefer LKB, Lorton, VA). b-glucuronidase activity was normalized to the protein content of extracts determined by the method of Bradford using bovine serum albumin as a standard (Bradford, 1976). For each treatment, 6 to 10 replicates from 2 or 3 separate experiments were assayed.
Results
Generation of transgenic lines and analysis ofgusA
expression following fungal and bacterial infection Transformation experiments with binary vectors pBI121 and PBI101.1:Pprp1-1 harboring the
PCaMV35S and Pgst1 promoters, respectively,
were performed on leaves detached from in vitro shoots of M.26 and RG. The transformation rate per leaf varied from 15% to 80% according to the genotype. Integration of the promoter-gusA-fusion was confirmed by PCR analysis of lines growing on kanamycin selective medium. Flow cytometry showed that all transgenic lines were diploid. Several vigorous 2n lines harboring the Pgst1 (5 RG and 6 M.26 lines) and PCaMV35S (5 RG and 5 M.26 lines) promoters selected after PCR anal-yses were micropropagated in vitro and acclimated in a growth chamber. For comparison, untrans-formed lines of RG and the rootstock M.26 were propagated in an identical manner.
Expression of the PCaMV35S-gusA and
Pgst1–gusAfusions was measured in extracts from
the transgenic lines without treatment or 10 days after spraying with water or with V. inaequalis conidia (Figure 1). Among the PCaMV35S–gusA
lines GUS activity varied from 65 nM 4
MU min)1mg protein)1 in transgenic RG line
TRG-171 plants to 135 nM 4 MU min)1mg
pro-tein)1 in transgenic M.26 line T26.642 plants
10 days after water or V. inaequalis inoculation. GUS activity values were similar in the untreated leaves (data not shown). In both RG and M.26, expression of the PCaMV35S promoter was very similar. A lower range of variation was observed among the Pgst1-gusA lines 10 days after
inocula-tion with V. inaequalis. GUS activity after water treatment was 1.5 to 7.9 fold less than after
V. inaequalisspraying in M.26 lines and 2.8 to 4.6
fold less for RG lines. GUS activity in untreated leaves of untransformed M.26 and RG Pgst1-gusA lines was negligible (data not shown).
The pattern of expression of the same trans-genic lines 48 h after inoculating leaves with the virulent Ea273 strain of E. amylovora was similar to that after V. inaequalis inoculation. There were similar differences in activation of gusA between the control and the E. amylovora treatment, as
between the control and the V. inaequalis
treatment.
Based on these analyses, two transformants with each promoter for each apple genotype that had high GUS activity when sprayed with virulent races of V. inaequalis or inoculated with a virulent strain of E. amylovora were selected for further studies.
Effect of wounding on PCaMV35S and Pgst1
promoter activity in transgenic lines of apple In potato, the Pgst1 promoter is not responsive to abiotic stimuli such as wounding (Strittmatter et al., 1996). Some experiments were performed to characterize the effect of the wounding alone or coupled with a fungal inoculation procedure, on the activity of these two promoters in apple. Leaves from two transgenic lines per promoter fusion were sprayed with V. inaequalis or water. Similar leaves were wounded by scissor cuts and sprayed with conidia or water. All these treatments induced the PCaMV35S promoter weakly (data not shown). The Pgst1 promoter was weakly activated following wounding, and strongly acti-vated after inoculation with and without wound-ing (data not shown).
These data indicated that the Pgst1 promoter is not wound-inducible in apple and that scissor cutting is a reliable technique of inoculation for further assessment of E. amylovora effects on these promoters.
Time course of activation ofPgst1 promoters
following pathogen inoculation and the effect
of mutants ofErwinia amylovora and of other
bacterial pathogens
GUS activity was monitored in leaves from 6 selected transgenic lines (T26-986, T26-1003,
Figure 1.GUS activity in independent transgenic lines of apple containing the PCaMV35SP-GusA (a) or Pgst1-gusA fusions (b and c). GUS activity was measured 10 days after inoculation with Venturia inaequalis at 2.5105conidia ml)1, 48 h after
inocu-lation with Erwinia amylovora at 7.5107cfu ml)1or with water. Bars represent confidence interval at a=0.05 among 10
T26-643, TRG-1046, TRG-1047 and TRG-171) at 0, 3, 7, 10 and 12 days after inoculation with
V. inaequalisor 0, 3, 6, 12, 24, 48, 72 and 96 h after
inoculation with E. amylovora, or after water treatment (Figure 2). The PCaMV35S-gusA lines showed weak activation after treatment with V. inaequalis, E. amylovora and water in the first hours following the treatment (data not shown). This activity decreased 72 h after inoculation of the leaves with E. amylovora, at the time when necrosis first became visible in the inoculated leaves.
In Pgst1-gusA lines, maximum GUS activity was observed in both apple genotypes 10 days after inoculation with V. inaequalis and 48 h after inoculation with E. amylovora. This activity reached 11% and 6% of the GUS activity of
PCaMV35S–gusA levels of transgenic lines M.26
and RG, respectively, after inoculation with V. inaequalis. After inoculation with E. amylovora, GUS activity increased and reached 20% and 10% of the GUS activity of PCaMV35S-gusA trans-genic lines of M.26 and RG, respectively. At this time point, GUS activity increased modestly in the
Pgst1–gusA transgenic M.26 lines after water
treatment. However, this activation was 4 and 5 fold less than obtained after inoculation with
E. amylovora and V. inaequalis, respectively. In
Pgst1–gusA transgenic RG lines, GUS activity
remained low after water treatment.
In response to another bacterial pathogen (Pseudomonas syringae pv tabaci), the Pgst1 pro-moter was activated during an incompatible inter-action in M.26 (data not shown) and RG transgenic lines (data not shown).
Avirulent mutant strains of E. amylovora with mutations affecting the hrp and dsp regions were investigated in order to understand the role of pathogenicity factors of E. amylovora in induction of the disease. The Pgst1-gusA transgenic M.26 line T26-986 showed different GUS activity in response to these mutants (data not shown). Similar results were obtained with the Pgst1-gusA transgenic RG line TRG-1047 (data not shown). These results show the important role of the hrp and dsp genes in activation of the Pgst1 promoter. It is activated weakly after inoculation with water and with the hrpN-W and dspE/A mutants of
Erwinia amylovora(22% and 42% respectively, of
the GUS activity obtained after treatment with
E. amylovora wild type). This suggests that the
pathogenicity factors harpin N and W, and DspE encoded by these genes are essential for induction of this promoter. When inoculated with these bacterial mutants, PCaMV35S-gusA transgenic lines showed no significant difference in GUS activation (data not shown).
Spatial and temporal expression ofPgst1 promoter
in response to fungal inoculation
In tobacco the Pgst1promoter shows local and rapid activation in response to infection by Phytophthora infestans, which causes an incom-patible reaction (Martini et al., 1993). Experi-ments were done to confirm that this promoter shows the same pattern of spatial induction in apple. GUS activity was measured in the inocu-lated leaf and also in upper and lower untreated leaves of the selected Pgst1-gusA transgenic lines. The Pgst1 promoter showed maximum activity in the untreated lower leaves 10 days after inocula-tion with V. inaequalis (Figure 3). This activity was almost two fold more than that obtained in the inoculated leaves in the Pgst1-gusA transgenic M.26 line T26-986. No GUS activity was detected in the upper leaves of the Pgst1-gusA transgenic M.26 line T26-986. No difference in GUS activity was detected in the treated and neighboring untreated leaves of the Pgst1-gusA transgenic RG line TRG-1047 (Figure 3). The
PCaMV35S-gusA transgenic lines showed stable expression of
GUS activity in treated and untreated leaves throughout the duration of the experiment (data not shown).
Effect of salicylic acid concentration on the
activation of thePgst1 promoter
The presence of a phytohormone responsive cis element in the Pgst1 promoter was sought by spraying salicylic acid on the surface of transgenic leaves. Salicylic acid weakly increased GUS activ-ity in the Pgst1-gusA transgenic M.26 line T26-986 during the first 12 h post inoculation. During these first 12 h no difference of induction could be observed after a treatment with two concentra-tions of SA (5 and 50 mM). A strong increase in GUS activity appeared in the transgenic M.26 line 24 hours after treatment. No difference in GUS activity was observed in the PCaMV35S-gusA line after these treatments (data not shown).
0 1 2 3 4 5 6 0 2 4 6 8 10 12 14 TRG-1046 V.inaequalis TRG-1046 water TRG-1047 V.inaequalis TRG-1047 water
Time post inoculation (days) 0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14 T26-986 V.inaequalis T26-986 water T26-1003 V. inaequalis T26-1003 water
Time post inoculation (days)
GUS activity (nM 4MU/min/mg protein)
GUS activity (nM 4MU/min/mg protein)
0 5 10 15 20 25 30 0 10 20 30 40 50 60 70 80 90 100 T26-986 E. amylovora T26-986 water TRG-1047 E. amylovora TRG-1047 water
Time post inoculation (hours)
GUS activity (nM 4MU/min/mg protein)
(a)
(b)
(c)
Figure 2.Time courses of activation of promoter Pgst1 fusions in leaves of representative transgenic apple lines, M.26 (T26.986 and T26.1003) (a and c) or Royal Gala (TRG.1046 and TRG.1047) (b and c) inoculated with Venturia inaequalis (a and b) or with Erwinia amylovora(c). Each datum point represents the mean of 6 replicates obtained from 3 separate experiments. Bars represent confidence interval at a=0.05.
Discussion
Genetic engineering is a potentially powerful tool for creating disease resistant plants, thereby offer-ing an alternative method of disease control, or in some cases control of a disease inadequately controlled at present. Researchers have identified numerous plant and pathogen genes that can be used to increase crop resistance toward invading pathogens. These strategies involve both expres-sion of gene products toxic to certain pathogens, and also enhancement of the plant’s own natural defense mechanism. Such introduced genes usually are placed under the control of strong promoters, such as the PCaMV35S promoter which yields
constitutive expression of the gene product in all plant tissues at all stages of growth. Use of a promoter that allowed restricted expression of the desired gene product exclusively at the sites of pathogen invasion would be a preferred effect in many cases. Ideally, expression of the gene prod-uct would be limited to cells surrounding infection sites and would not occur in other parts of the plant.
In order to improve fire blight resistance of apple cultivars without undesirable effects on potentially beneficial plant-associated bacteria or risk to human health, we have undertaken a search for this type of promoter. Knowledge of genes involved in plant-pathogen interactions is still very
0 5 10 15 20 25 0 2 4 10 12 upper leaf treated leaf lower leaf
Time post inoculation (days)
T26-986
GUS activity (nM 4MU/min/mg protein)
0 1 2 3 4 5 6 0 4 8 10 12 upper leaf treated leaf lower leaf
Time post inoculation (days) TRG-1047
GUS activity (nM 4MU/min/mg protein)
6 8
2 6
(a)
(b)
Figure 3.Time courses of Pgst1-gusA activation in the upper and lower leaves of representative transgenic apple lines M.26 (a, T26.986) or Royal Gala (b, TRG.1047) inoculated with V. inaequalis. Each datum point represents the mean of 6 replicates obtained from 3 separate experiments. Bars represent confidence interval at a=0.05.
limited in the case of fire blight, and no homol-ogous promoters have been characterized, with the exception of the promoter PYPR10 in apple which is inducible by fungal and abiotic stress (Pu¨hringer et al., 2000). We therefore selected the Pgst1 promoter from potato (also referred as Pprp1-1) (Martini et al., 1993) and designed experiments to evaluate its performance in apple using the gusA reporter gene, prior to using it to control the expression of a functional transgene.
In this study, we produced a population of transgenic lines of two genotypes of apple in which the expression of the gusA gene was driven by the constitutive PCaMV35S promoter and the induc-ible Pgst1 promoter. Activation was measured by GUS assay in 5 or 6 transgenic lines for each genotype and construct. A high level of variability was observed in the M.26 and Royal Gala transgenic lines with the Pgst1 promoter. The range of variation observed for the PCaMV35S promoter was similar to the variation of gusA expression under the same promoter in transgenic apple (Pu¨hringer et al., 2000) but the level of expression of the gusA gene was more than six times higher in our experiments. This difference can be explained by the different vectors that we and Pu¨hringer et al., 2000 used. Several hypothe-ses could explain the high variability of expression of the gusA gene between the different lines, including the influence of the number, position and integrity of the transgene insertion. Therefore, in such a study, the individual transgenic lines selected for more detailed promoter analysis should be chosen carefully. In this work we have selected two transgenic lines with strong GUS expression, avoiding the extreme levels of GUS activity.
The pattern of expression of the Pgst1-gusA fusion in apple revealed that the Pgst1 promoter is functional in apple and retains most of its typical features of expression in potato. In fact, it conserved a similar pattern of induction compared to that found by Martini et al. (1993) and Strittmatter et al. (1996) in potato. As in potato, this promoter was not activated by wounding, but it was activated by different pathogens (bacterial and fungal) in apple. Furthermore, we demon-strated that the kinetics of activation of the Pgst1 promoter differed following the pathogen study. It reached a maximum 48 h and 10 days after inoc-ulation with a bacterium (E. amylovora) and with a
fungus (V. inaequalis), respectively, in the two genotypes of apple studied. At that time, GUS activity differed between the two genotypes of apple and also between the treatments with the pathogens. The genotype M.26 had GUS activity that was 2.5 fold higher than that of the genotype Royal Gala regardless of the pathogen inoculated. Similar results were obtained following inoculation with E. amylovora and V. inaequalis. GUS activity was 1.7 fold higher after inoculation with E.
amy-lovorathan the activity observed after inoculation
with V. inaequalis, and this difference was consis-tent between the two genotypes of apple.
Our study in apple also provided evidence of the systemic induction of the Pgst1 promoter following infection with a mixture of five virulent races of the fungus V. inaequalis. GusA expression in neighboring upper and lower non-treated leaves closely followed the expression in the treated leaf. A systemic signal that directly activates the Pgst1 promoter appears to be involved in the two genotypes of apple. This result correlates with the induction of this promoter by salicylic acid and with the low level of systemic induction previously reported in potato after inoculation with
Phytoph-thora infestans(Martini et al., 1993).
Our study provided detailed insight into the role of various pathogenicity regions of the E. amylovora genome. Taking advantage of a panel of well characterized mutants of E. amylovora provided by S.V. Beer (Cornell University, Ithaca, NY), we were able to study the differential response of this promoter to several gene products. The response of this promoter to treatment with an E. amylovora hrp secretion mutant was almost identical to the response to water treatment. This indicates that a functional secretory hrp system is necessary for the activation of this promoter in apple. Treatment with mutant strains unable to synthesize either harpin N and W or DspE/A protein clearly resulted in lower activation of the Pgst1 promoter than the treatment with wild type E. amylovora. Thus, these pathoge-nicity factors, which are secreted via the hrp system, play a complementary role in the activation of the
Pgst1 promoter. These two pathogenicity factors
were also reported to play an important role in the activation of two other inducible promoters in pear (Malnoy et al., 2003b). Recently, Venisse et al. (2003) have demonstrated the important role of these factors in the induction of fire blight infection in apple.
Taken together, our data indicate that the potato promoter Pgst1, is functional in apple and exhibits an induction pattern similar to that observed in potato. It is interesting to note that it is not the first time that a promoter isolated from another botanical family was functional in the Rosaceae. Indeed, the str246C and sgd24 promot-ers isolated from Solanaceae, are functional in pear (Rosaceae), which is botanically quite distant from Solanaceae (Malnoy et al., 2003b). But cross functionality is not true of all pathogen inducible promoters isolated from the Solanaceae. In fact, the hsr203J promoter isolated from tobacco was
weakly functional in the Rosaceae, apple
(Reynoird et al., 2000) and pear (Malnoy et al., 2003b).
The Pgst1 promoter could be used to drive the expression of transgenes for bacterial and fungal disease resistance, as was done with the harpin gene in potato (Li & Fan, 1999), albeit with some potential drawbacks. Its systemic activation in apple could be beneficial, as it may help the plant to mount an active defense in advance of bacterial and fungal spread in the tissues. However, this fact may cause unwanted accumulation of the trans-gene product in fruits. The average level of gusA expression by the Pgst1 promoter in response to bacterial and fungal induction is much lower (15% and 8% respectively) than the constitutive expres-sion driven by the PCaMV35S promoter in apple. Thus, transgenes with a high efficacy in combating
E. amylovoraor V. inaequalis at low levels will be
required. Another strategy will be to define syn-thetic plant promoters that directly control local gene expression in response to pathogens. Patho-gen inducible plant promoters contain multiple cis-acting elements which are responsible for the induction patterns of the promoter, but only some of these may contribute to pathogen inducibility. Therefore, a synthetic promoter containing specific cis-acting elements can prevent a local and ele-vated gene expression after a pathogen attack. Using a range of cis-acting elements (boxes W1, W2, GCG, JERE, S, GST1, and D), Rushton et al. (2002) were able to develop different syn-thetic plant promoters that produced varied pat-terns of induction after treatment with compatible or incompatible pathogens and abiotic stress. Some of these promoters showed an expression higher than the expression obtained with the original vector.
Acknowledgements
We gratefully acknowledge B. Reynoird, P. Munagala and H.L. Gustafson for excellent tech-nical assistance. The authors wish to thank Peggy Abbott for excellent critical reading of the manuscript. This work was supported by a grant from the New York apple growers through a grant from the New York Apple Research and Development Program, and by a special grant from USDA-CSREES.
References
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254. Bogdanove AJ, Bauer DW and Beer SV (1998) Erwinia amy-lovorasecretes DspE, a pathogenicity factor and functional AvrE homolog, through the Hrp (type III secretion) path-way. J Bacteriol 180: 2244–2247.
Bolar JP , Norelli JL, Harman GE, Brown SK and Aldwinckle HS (2001) Synergistic activity of endochitinase and exoch-itinase from Trichoderma atroviride (T. harzianum) against the pathogenic fungus (Venturia inaequalis) in transgenic apple plants. Transgenic Res 10: 533–543.
Bolar JP, Norelli JL, Wong KW, Hayes CK, Harman GE and Aldwinckle HS (2000) Expression of endochitinase from Trichoderma harzianum in transgenic apple increases resis-tance to scab and reduces vigor. Phytopathology 92: 72–77. Bolar JP, Brown SK, Norelli JL and Aldwinckle HS (1999)
Factors affecting the transformation of Marshall McIntosh apple by Agrobacterium tumefaciens. Plant Cell Tissue Organ Cult 55: 31–38.
Bolar JP, Hanke V, Norelli JL and Aldwinckle HS (1998) An efficient method to root and acclimatize micropropagated apple cultivars. HortScience 33: 1251–1252.
Borejsza-Wysocka E, Norelli JL, Ko K and Aldwinckle HS (1999) Transformation of authentic M.26 apple rootstock for enhanced resistance to fire blight. Acta Hort 489: 259–266. Cheung WY, Hubert N and Landry BS (1993) A simple and
rapid DNA microextraction method for plant, animal, and insect suitable for RAPD and other PCR analyses. PCR Methods Appl 3: 31–40.
Gittins JR, Pellny TK, Hiles ER, Rosa C, Biricolti S and James DJ (2000) Transgene expression driven by heterologous ribulose-1,5-bisphosphate carboxylase/oxygenase small-subunit gene promoters in the vegetative tissues of apple (Malus pumila Mill.). Planta 210: 232–240.
Hahn K and Strittmatter G (1994) Pathogen defence gene prp1-1 from potato encodes an auxine responsive glutathione S transferase. Eur J Biochem 226: 619–626.
Hood EE, Gelvin SB, Melchers L and Hoekema A (1993) New Agrobacteriumhelper plasmids for gene transfer to plants. Transgenic Res 2: 208–218.
Li R and Fan Y (1999) Reduction of lesion growth rate of late blight plant disease in transgenic potato expressing harpin protein. Sci. China 42: 96–101.
Malnoy M, Venisse JS, Brisset MN and Chevreau E (2003a) Expression of bovine lactoferrin cDNA confers resistance to Erwinia amylovorain transgenic pear. Mol Breed 12: 231–244. Malnoy M, Venisse JS, Reynoird JP and Chevreau E (2003b) Activation of three pathogen-inducible promoters of tobacco in transgenic pear after abiotic and biotic elicitation. Planta 216: 802–814.
Martini N, Egen M, Ru¨ntz I and Strittmatter G (1993) Pro-moter sequences of a potato pathogenesis-related gene mediate transcriptional activation selectively upon fungal infection. Mol Gen Genet 236: 179–186.
Norelli JL, Mills JZ and Aldwinckle HS (1998) Leaf wounding increases efficency of Agrobacterium tumefaciens mediated transformation of apple. HortScience 31: 1026–1027. Norelli JL, Mills JZ, Momol MT and Aldwinckle HS (1999)
Effect of cecropin-like transgenes on fire blight resistance of apple. Acta Hort 489: 273–278.
Norelli JL, Mills JZ, Jensen LA, Momol MT, Ko K and Aldwinckle HS (1998) Genetic engineering of apple for in-creased resistance to fire blight. Acta Hort 484: 541–546. Pu¨hringer H, Moll D, Hoffmann-Sommergruber K, Watillon B,
Katinger H and Laimer da Caˆmara Machado M (2000) The promoter of an apple Ypr 10 gene, encoding the major allergen Mal d 1, is stress- and pathogen-inducible. Plant Sci 152: 35–50.
Reynoird JP, Abdul-Kader AM, Bauer DW, Borejsza-Wysocka E and Aldwinckle HS (2000) Activation of the Potato gst1 and Tobacco hsr203J Promoters by Erwinia amylovorain Transgenic Royal Gala Apple and M26 Apple Rootsotck. 6th International Congress of Plant Molecular Biology Que´bec, Canada June, 18–24, 2000.
Reynoird JP, Mourgues F, Norelli J, Aldwinckle HS, Brisset MN and Chevreau E (1999) First evidence for improved resistance to fire blight in transgenic pear expressing the att-acinE gene from Hyalophora cecropia. Plant Sci 149: 23–31. Rushton PJ, Reinsta¨dler A, Lipka V, Lippok B and Somssich IE (2002) Synthetic plant promoters containing defined reg-ulatory elements provide novel insights into pathogen and wound induced signalling. Plant Cell 14: 749–762.
Strittmatter G, Gheysen G, Gianizzi-Pearson V, Hahn K, Niebel A, Rohde W and Tacke E (1996) Infections with various types of organisms stimulate transcription from short promoter fragment of the potato gst1 gene. Mol Plant Mi-crobe Interact 9: 68–73.
Stuiver MH and Custer JHHV (2001) Engineering disease resistance in plants. Nature 411: 865–868.
Vaucheret H, Be´clin C, Elmayan T, Feuerbach F, Godon C, Morel J-B, Mourrain P, Palauqui J-C and Vernhettes S (1998) Transgene-induced gene silencing in plants. Plant J 16: 651–659. Venisse JS, Barny MA, Paulin JP and Brisset MN (2003) Involvement of three pathogenicity factors of Erwinia amy-lovora in the oxidative stress associated with compatible interaction in pear. FEBS Lett 537: 198–202.
Wei ZM, Laby RJ, Zumoff CH, Bauer DW, He SY, Collmer A and Beer SV (1992) Harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora. Science 257: 85–88.
Yepes LM and Aldwinckle HS (1993) Pathogenesis of Venturia inaequalis on shoot tip cultures and on greenhouse grown apple cultivars. Phytopathology 83: 1155–1162.
