Novel Mutations Involving the INSL3 Gene Associated With Cryptorchidism

Gene Associated With Cryptorchidism

Brahim El Houate, Hassan Rouba, Hicham Sibai, Abdelhamid Barakat, Abdelaziz Chafik, El bekkay Chadli, Laila Imken, Natalia V. Bogatcheva, Shu Feng, Alexander I. Agoulnik and Ken McElreavey*

From the Human Genetics Department, Institut Pasteur of Morocco (BEH, HR, AB, EbC) and Division of Pediatric Urology, Casablanca Children’s Hospital, Ibn Rochd University Health Center (HS), Casablanca and Biology Department, Faculty of Sciences, University Chouaib Doukkali (BEH, AC, LI), El Jadida, Morocco, Reproduction, Fertility and Populations, Developmental Biology Department, Institut Pasteur (BEH, KM), Paris, France, and Department of Obstetrics and Gynecology, Baylor College of Medicine (NVB, SF, AIA), Houston, Texas

Purpose: Cryptorchidism affects 1% to 9% of full-term male neonates. Hypospadias is the second most frequent congenital anomaly seen in newborn males. These pathological conditions are part of the testicular dysgenesis syndrome. Insulin-like factor 3 and LGR8 (leucine-rich repeat-containing G protein-coupled receptor 8), acting as a hormone and a receptor, respectively, are involved in control of the first phase of testicular descent via gubernacular development.

Materials and Methods: The study group consisted of 184 patients, of whom 52 presented with unilateral cryptorchidism, 37 presented with bilateral cryptorchidism, 19 presented with cryptorchidism and hypospadias, 1 presented with bilateral cryptorchidism and micropenis, and 75 presented with isolated hypospadias. A control panel consisted of 270 controls, including 127 fertile, and 143 fertile noncryptorchid males. Insulin-like factor 3 mutations were analyzed by direct sequenc- ing and restriction enzyme digestion. We analyzed the ability of the mutant insulin-like factor 3 peptides identified in this study to activate LGR8 receptor in an ex vivo assays.

Results: We identified 3 novel insulin-like factor 3 variants, including C-19G, V18M and R105H, in 3 of the 109 patients (2.75%) but in none of the 270 controls. The V18M mutation in the insulin-like factor 3 signal peptide had a significant deleterious effect in activating LGR8 receptor in ex vivo studies (p ⬍ 0.05). To our knowledge we report the first variant in the promoter region of the insulin-like factor 3 gene in a patient with cryptorchidism in association with micropenis.

Conclusions: Mutations involving the insulin-like factor 3 gene may contribute to other anomalies of male genital development, such as micropenis.

Key Words: urethra, penis, cryptorchidism, hypospadias, mutation

C ryptorchidism is the most common congenital birth defect, affecting 1% to 9% of full-term male neonates.

Hormonal and/or surgical treatment is administered before puberty to prevent the risk of infertility. Hypospadias is the second most frequent urogenital congenital anomaly and it is often seen in association with cryptorchidism.

Many congenital syndromes due to chromosomal aberration or monogenic disease often present as cryptorchidism in association with hypospadias. Many groups have suggested that gonadal development pathologies may be part of a com- mon disorder, which was introduced by Skakkebaek et al as TDS (undescended testis, hypospadias, poor semen quality and testicular germ cell cancer).

Epidemiological studies suggest a correlation between these 2 entities and they may share a common etiology.

Testicular descent is a biphasic process. During the first intra-abdominal phase the testis is held by the gubernacula near the inguinal region as the fetus enlarges, whereas the cranial suspensory ligament regresses. In the inguinal phase the gubernacula migrate and elongate toward the scrotum.

The 2 factors INSL3 and LGR8, acting as a hormone and a receptor, respectively, are involved in control of the first phase of testicular descent via gubernacular development.

INSL3 is expressed extensively in the Leydig cells of fetal and adult testes.

The serum concentration of INSL3 in the adult human is about 1 ␮ g/ml.

This hormone is synthesized as pre-prohormone containing a signal peptide, B chain, C peptide and A chain.

Cleavage of signal peptide followed by the formation of disulfide bridges and C-peptide exclusion yields the mature hormone, which is composed of the A chain and B chain. A relatively short promoter region of approximately 200 bp appears sufficient to drive Insl3 gene transcription.

In this proximal region several evolutionary conserved target sites were identified for general transcrip- tion factors and specific transactivators of sexual differenti- ation, such as SF1 and DAX1.

Insl3

male mice show bilateral cryptorchidism and this gene may be responsible for causing cryptorchidism in humans. Several groups have Submitted for publication June 29, 2006.

Supported by National Institutes of Health Grant R01 HD37067 (AIA), the GIS-Institut des Malade Rares and the Direction des Affaires Internationales de l’Institut Pasteur, Paris, France.

* Correspondence: Reproduction, Fertility and Populations, Depart- ment of Developmental Biology, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris, Cedex 15 France (telephone: 00 33 1 45688920;

FAX: 00 33 1 45688639; e-mail: [email protected]).

0022-5347/07/1775-1947/0 Vol. 177, 1947-1951, May 2007

T

J

U

Printed in U.S.A.

Copyright © 2007 by A

U

A

DOI:10.1016/j.juro.2007.01.002

1947

crease in cAMP, in transfected cells over expressing cloned LGR8 and in gubernacular cells.

Knockout mice, whose Lgr8 gene is altered, have a cryptorchid phenotype identical to that in Insl3 knockout mice.

In humans the unique missense mutation T222P was identified in the ectodomain of LGR8 receptor in 5 patients.

METHODS

Patients and Controls

A total of 184 patients of Moroccan ethnic origin were studied, including 89 males with cryptorchidism, 75 with isolated hy- pospadias, 19 with a combination of cryptorchidism and hypo- spadias, and 1 with cryptorchidism and a micropenis. Most patients were boys (average age 7 years) who were under- going surgical correction for cryptorchidism or hypospadias at the visceral surgery service at Casablanca Children’s Hospital (Centre Hospitalier Universitaire Ibn Rochd Casa- blanca). All patients had sporadic disease. We had also se- lected 270 controls, including 127 donors with proven fertil- ity and 143 without cryptorchidism. All controls were of Moroccan origin. Informed consent was obtained from all subjects and from the parents of children.

Mutation Screening

The whole coding region of INSL3 gene as well as 200 bp in the promoter region starting from the site of transcription initiation was sequenced in all subjects. DNA was extracted from peripheral blood samples using standard techniques.

Exon 1 was amplified using 5=ctctgggagaagtacatccaag=3 and 5=cactcctggctaacggctctgg=3 primers. For exon 2 the primer sequence was 5=actcagtgggatgtgtgg=3 and 5=tctgcagttgactc- cacagg=3. PCR conditions were denaturation at 95C for 5 minutes, 35 cycles at 95C for 45 seconds, at 62C for 35 seconds and at 72C for 5 minutes with final extension at 72C for 10 minutes. Amplicons were sequenced by the dye ter- minator on an automated DNA sequencing machine using the same primers as for PCR.

Expression Constructs

Human cDNA INSL3 expression constructs corresponding to 2 allelic variants detected during mutational screening were obtained by site specific mutagenesis, as previously described.

All mutant cDNA fragments were fully se- quenced and recloned into eukaryotic cell expression vector pcDNA3.1/myc-HisB (Invitrogen™) to ensure the absence of any additional mutations.

The 203 bp INSL3 promoter fragment was obtained by PCR from human genomic DNA with the primers INSL3-pro- moterF, 5=-ggtaccAGACTCGTTGCCCAGTGCTCCC-3= and INSL3-promoterR, 5=-CCATGGTGGTGGGTGGCGCC-3=, con- taining KpnI and NcoI restriction sites an the 5=ends. The fragment was cloned into KpnI and NcoI sites of pGL4.11[luc2P] luciferase reporter vector (Promega, Madi- son, Wisconsin). The mutant variant of the promoter de- tected in this study was obtained from the WT promoter

dase activity was measured with a galactosidase reagent kit (Promega).

Functional Analysis of Mutant INSL3 Peptides We analyzed the ability of the mutant INSL3 peptides iden- tified in this study to activate LGR8 receptor. Methods were described previously.

Briefly, cells transfected with LGR8 were challenged with different amounts of conditioned medium from HIT cells expressing recombinant INSL3 peptides in the presence of isobutylmethylxanthine. The amount of INSL3 in conditioned medium was determined using an INSL3 RIA kit (Phoenix Pharmaceuticals, Belmont, California). Cells were harvested, washed and lysed with cAMP extraction buffer.

The cAMP level was detected by Biotrak™ enzyme-linked immunoassay. All experiments were repeated at least 3 times using HIT and 293T cells from independent transfec- tions.

Analysis of Promoter Activity

The activity of WT and mutant promoter constructs was analyzed as described previously.

TM3 mouse Leydig cells were grown in a 1:1 mixture of Hamm’s F12 medium and Dulbecco’s modified Eagle’s medium with 4.5 gm/l glucose, 1.2 gm/l sodium bicarbonate and 15 mM HEPES (92.5%), horse serum (5%) and fetal bovine serum (2.5%). After 24 hours of cultivation in a 12-well plate precoated with poly-L- lysine (Sigma®) cells were transiently transfected with expres- sion plasmids by FuGENE6® transfection reagent. At 48 hours after transfection cells were subjected to luciferase assay with a Dual-Luciferase Reporter Assay System (Promega) accord- ing to manufacturer instructions. ␤ -Galactosidase activity served as an internal control and it was determined with a

␤ -galactosidase detection kit (Promega). Transfection was performed in triplicate and experiments were repeated 3 times.

Statistical Analysis

We analyzed a total of 540 chromosomes in 270 control subjects to achieve more than 95% power to determine miss- ing the muted bases as a polymorphism in the population studied.

Results are expressed as the mean ⫾ SE. Statis- tical analysis was performed by 1-way ANOVA with statis- tical significance considered at p ⬍ 0.05. Data were obtained by fitting the curve with Origin™, version 3.5.

RESULTS

The INSL3 gene was sequenced in all 184 patients in this

study, including 52 with unilateral cryptorchidism, 37 with

bilateral cryptorchidism, 19 with cryptorchidism and hypo-

spadias, 1 with bilateral cryptorchidism and micropenis, and

75 with isolated hypospadias. We identified 3 mutations in

the case population, that is 2 variants in the coding sequence

and 1 in the promoter region (fig. 1). These mutations were

not observed in the control population (0 of 270) or in pa-

tients with hypospadias (0 of 75). Therefore, the prevalence

of INSL3 mutations in all patients was 1.6% (3 of 184), including 2.75% (3 of 109) in those with maldescended testis and 0% in those with hypospadias.

Mutations in the Coding Region

Two novel heterozygous missense mutations in the coding sequence of the INSL3 gene were found in 89 patients with isolated cryptorchidism (2.75% or 3 of 109). A G52A nucle- otide sequence substitution that was predicted to result in a valine-to-methionine change at amino acid 18 in the signal peptide was identified in an individual with unilateral crypt- orchidism. This G52A substitution abolishes a restriction site for BstNI and gives rise to a different restriction pattern of the PCR amplified mutant DNA. This mutation was also present in the father of the patient but not in any of the 270 matched control samples.

In exon 2 a novel substitution of an arginine-to-histidine residue (R105H) was identified in the peptide C region in a boy who presented with cryptorchidism. This nucleotide change G319A gives rise to a restriction polymorphism be- tween the mutant and normal allele by digestion with NlaIII. By restriction enzymatic digestion we confirmed the presence of the variant and excluded it in a series of 270 ethnically matched control samples.

Mutation in the Promoter Region

Sequence analysis of a 200 bp fragment upstream of the initiation code revealed a substitution of C to G at nucleotide

⫺ 19 in a patient with cryptorchidism and micropenis. This substitution at position ⫺ 19 gives rise to a Nae I restriction site. This variant was not detected in the 270 control sam- ples.

INSL3 Polymorphisms

The previously reported polymorphisms G27A (L9L), G126A (L42L) and G178A (A60T) were identified with a frequency similar to that observed in other studies (see table). There

was no difference in the frequency of these 3 polymorphisms between patients with cryptorchidism or hypospadias.

Functional Analysis

To assess the functional properties of the 2 variants of INSL3 (V18M and R105H) we analyzed their ability to stim- ulate cAMP production in cells expressing LGR8. INSL3 WT peptide, INSL3-V18M and INSL3-R105H were able to in- duce a cAMP increase in cells transfected with LGR8. The dose-response curve for INSL3-V18M variant showed a con- sistently lower EC

than that of WT INSL3 (p ⬍ 0.05). The R105H dose-response curve revealed no significant differ- ences compared with that of WT INSL3 protein (fig. 2).

Expression analysis of promoter activity did not reveal any difference between WT INSL3 and the C-19G INSL3 variant in TM3 Leydig cells (fig. 3).

DISCUSSION

Most evidence now suggests that a complex interplay be- tween genetic susceptibility and exposure to certain envi- ronmental factors is involved in the development of the F

. 1. Sequence profile of INSL3 mutation. A, (C-19G) mutation

within promoter. B, V18M mutation. C, R105H mutation.

Genotype distribution of INSL3 polymorphisms

Polymorphism No. Cryptorchidism No. Hypospadias A27G:

GG 98 60

AG 9 14

AA 1 1

A126G:

GG 13 8

AG 38 23

AA 57 44

A178G:

GG 50 37

AG 39 24

AA 19 14

F

. 2. Results of 5 representative experiments in 293T cells trans- fected with LGR8 DNA and challenged with conditioned medium from HIT cells expressing WT INSL3 (squares), V18M (circles) and R105H (triangles). INSL3 hormone content in HIT medium was measured with RIA. Points indicate mean ⫾ SE of duplicate mea- surements.

F

. 3. C-19G INLS3 mutation did not affect INSL3 promoter

activity. WT and mutant constructs showed same transcriptional

activity 48 hours after transfection with luciferase reporter con-

structs. Results represent mean ⫾ SE of 3 experiments performed in

triplicate.

reports suggesting that mutations in INSL3 associated with cryptorchidism are rare (2.75%).

The V18M mutation in the signal peptide was found in a heterozygous condition in a boy with unilateral cryptorchid- ism. Analysis of genomic DNA samples from 270 controls males showed no variation at this position.

The possible pathological effect of the V18M variant is supported by functional analysis, which demonstrated sig- nificantly decreased ability to activate the receptor com- pared to that of the WT peptide (p ⬍ 0.05). Of all previously reported mutations only the P49S variant had a deleterious effect on the ability of INSL3 to activate the receptor.

A new mutation described in the signal peptide did not show any deleterious effect in the same appropriate functional test.

Currently little is known concerning the in vivo pro- cessing events of INSL3 pre-prohormones and the precise mechanism by which an alteration in the signal peptide may contribute to the pathogenesis of cryptorchidism remains to be clarified. It is possible that the mutant peptide is not processed correctly and it retains signal peptide, causing decreased activation efficiency. The antibody in the RIA kit was produced to the mature hormone (A and B chains) and they may detect the nonprocessed peptide. Thus, if the cell produced such abnormal peptide, it might still be detected by RIA, although the efficiency of receptor activation might be lower.

Surprisingly analysis of the parents revealed that the father of this patient was also heterozygous for the V18M mutation. However, we cannot exclude the possibility that the father also had cryptorchidism at birth with spontane- ous testicular descent. At the time of the study the father did not have any signs of maldescended testis. It is also possible that some other genetic or epigenetic factors might compen- sate for the deleterious effect of the mutant INSL3 allele in the father in cases of cryptorchidism.

The R105H variant, which is located in the end of INSL3 C-peptide, was found in a boy with bilateral cryptorchidism.

Functional analysis of the variant indicated no significant effect of the substitution on cAMP production ex vivo by cells expressing LGR8 receptor. All other variants described in C-peptide also show no functional effect ex vivo.

This may not be surprising when one considers that C-peptide is nor- mally eliminated during processing of the prohormone in re- laxin family peptides. More studies are needed to understand the mechanism of processing of the INSL3 pre-prohormone.

Recently the region immediately upstream of the site of transcription initiation was shown to be important for reg- ulating INSL3 transcription in mice, rats and dogs.

This 200 bp region contains several evolutionary conserved sites for regulatory factors, including 3 potential SF1 bind- ing sites.

Promoter analysis indicated that all 3 SF1 bind- ing sites were needed to achieve maximal SF1 dependent transactivation of INSL3 promoter. In this study we found a patient harboring a heterozygous mutation at position –19 bp from the transcription initiation site. In 2 previous stud- ies of 13 and 30 patients with a history of familial and sporadic cryptorchidism, respectively, no variants were de-

tion showed no significant difference compared to the WT.

We cannot exclude that the mutation could have an effect on INLS3 expression in a more appropriate cellular context at the moment of testicular descent or this mutation may affect the timing of expression or the specific response to a certain transcription factor. This individual also presented with mi- cropenis. Although the occurrence of micropenis is usually associated with various problems of androgen production or signaling, many cases remain unexplained.

Other investi- gators described an INSL3 mutation that showed deleteri- ous effects on functional analysis in a patient presenting with cryptorchidism and under masculinized genitalia. This opens the possibility that some mutation in INSL3 may be implicated in genital development. This hypothesis could be tested in a large series of individuals with genital anomalies.

However, INSL3 mutations were not detected in individuals presenting with isolated hypospadias or hypospadias and cryptorchidism. Although these 2 phenotypes are often seen together, mutations in the INSL3 gene do not appear to contribute to the phenotype of hypospadias.

CONCLUSIONS

Our data indicate that INSL3 mutations affecting regula- tory elements such as the promoter or those that are excised during processing peptide such as signal peptide and C- peptide may be associated with cryptorchidism. In addition, our data suggest that deregulation of INSL3 expression may be associated not only with cryptorchidism, but also with the development of micropenis.

ACKNOWLEDGMENTS

Anne Truong and Joelle Bignon-Topalovic provided techni- cal assistance.

Abbreviations and Acronyms cAMP ⫽ cyclic adenosine monophosphate INSL3 ⫽ insulin-like factor 3

LGR8 ⫽ leucine-rich repeat-containing G protein- coupled receptor 8

PCR ⫽ polymerase chain reaction RIA ⫽ radioimmunoassay

TDS ⫽ testicular dysgenesis syndrome

REFERENCES

1. Boisen KA, Kaleva M, Main KM, Virtanen HE, Haavisto AM, Schmidt IM et al: Difference in prevalence of congenital cryptorchidism in infants between two Nordic countries.

Lancet 2004; 363: 1264.

2. Skakkebaek NE, Rajpert-De Meyts E and Main KM: Testicular

dysgenesis syndrome: an increasingly common develop-

mental disorder with environmental aspects. Hum Reprod

2001; 16: 972.

3. Akre O, Lipworth L, Cnattingius S, Sparen P and Ekbom A:

Risk factor patterns for cryptorchidism and hypospadias.

Epidemiology 1999; 10: 364.

4. Nef S and Parada LF: Cryptorchidism in mice mutant for Insl3. Nat Genet 1999; 22: 295.

5. Tashima LS, Hieber AD, Greenwood FC and Bryant-Green- wood GD: The human Leydig insulin-like (hLEY I-L) gene is expressed in the corpus luteum and trophoblast. J Clin Endocrinol Metab 1995; 80: 707.

6. Bay K, Hartung S, Ivell R, Schumacher M, Jurgensen D et al:

Insulin-like factor 3 serum levels in 135 normal men and 85 men with testicular disorders: relationship to the luteiniz- ing hormone-testosterone axis. J Clin Endocrinol Metab 2005; 90: 3410.

7. Bullesbach EE and Schwabe C: The primary structure and the disulfide links of the bovine relaxin-like factor (RLF). Bio- chemistry 2002; 41: 274.

8. Koskimies P, Levallet J, Sipila P, Huhtaniemi I and Poutanen M: Murine relaxin-like factor promoter: functional charac- terization and regulation by transcription factors steroido- genic factor 1 and DAX-1. Endocrinology 2002; 143: 909.

9. Adham IM and Agoulnik AI: Insulin-like 3 signalling in testic- ular descent. Int J Androl 2004; 27: 257.

10. Ferlin A, Bogatcheva NV, Gianesello L, Pepe A, Vinanzi C, Agoulnik AI et al: Insulin-like factor 3 gene mutations in testicular dysgenesis syndrome: clinical and functional characterization. Mol Hum Reprod 2006; 12: 401.

11. Kumagai J, Hsu SY, Matsumi H, Roh JS, Fu P, Wade JD et al:

INSL3/Leydig insulin-like peptide activates the LGR8 re- ceptor important in testis descent. J Biol Chem 2002; 277:

31283.

12. Gorlov IP, Kamat A, Bogatcheva NV, Jones E, Lamb DJ, Truong A et al: Mutations of the GREAT gene cause crypt- orchidism. Hum Mol Genet 2002; 11: 2309.

13. Ferlin A, Simonato M, Bartoloni L, Rizzo G, Bettella A, Dottorini T et al: The INSL3-LGR8/GREAT ligand-recep- tor pair in human cryptorchidism. J Clin Endocrinol Metab 2003; 88: 4273.

14. Bogatcheva NV, Truong A, Feng S, Engel W, Adham IM and Agoulnik AI: GREAT/LGR8 is the only receptor for insulin- like 3 peptide. Mol Endocrinol 2003; 17: 2639.

15. Truong A, Bogatcheva NV, Schelling C, Dolf G and Agoulnik AI: Isolation and expression analysis of the canine insulin- like factor 3 gene. Biol Reprod 2003; 69: 1658.

16. Collins JS and Schwartz CE: Detecting polymorphisms and mutations in candidate genes. Am J Hum Genet 2002; 71:

1251.

17. Sadeghian H, Anand-Ivell R, Balvers M, Relan V and Ivell R:

Constitutive regulation of the Insl3 gene in rat Leydig cells.

Mol Cell Endocrinol 2005; 241: 10.

18. Feng S, Cortessis VK, Hwang A, Hardy B, Koh CJ, Bogatcheva NV et al: Mutation analysis of INSL3 and GREAT/LGR8 genes in familial cryptorchidism. Urology 2004; 64: 1032.

19. Koskimies P, Virtanen H, Lindstrom M, Kaleva M, Poutanen M, Huhtaniemi I et al: A common polymorphism in the human relaxin-like factor (RLF) gene: no relationship with cryptorchidism. Pediatr Res 2000; 47: 538.

20. Sasaki G, Ogata T, Ishii T, Kosaki K, Sato S, Homma K et al:

Micropenis and the 5alpha-reductase-2 (SRD5A2) gene:

mutation and V89L polymorphism analysis in 81 Japanese

patients. J Clin Endocrinol Metab 2003; 88: 3431.