HAL Id: hal-00532415
https://hal.archives-ouvertes.fr/hal-00532415
Submitted on 4 Nov 2010
HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from
L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de
infection in farmed European tench ( L)
A. Aranaz, A. Gibello, J. Álvarez, A.I. Mata, A. Rodríguez, C. Fallola, J.F.
Fernández-Garayzábal, L. Domínguez
To cite this version:
A. Aranaz, A. Gibello, J. Álvarez, A.I. Mata, A. Rodríguez, et al.. infection in farmed European tench ( L). Veterinary Microbiology, Elsevier, 2008, 131 (3-4), pp.393. �10.1016/j.vetmic.2008.04.017�.
�hal-00532415�
Accepted Manuscript
Title:Mycobacterium peregrinuminfection in farmed European tench (Tinca tincaL)
Authors: A. Aranaz, A. Gibello, J. ´Alvarez, A.I. Mata, A.
Rodr´ıguez, C. Fallola, J.F. Fern´andez-Garayz´abal, L.
Dom´ınguez
PII: S0378-1135(08)00141-7
DOI: doi:10.1016/j.vetmic.2008.04.017
Reference: VETMIC 4004
To appear in: VETMIC
Received date: 11-1-2008 Revised date: 7-4-2008 Accepted date: 10-4-2008
Please cite this article as: Aranaz, A., Gibello, A., ´Alvarez, J., Mata, A.I., Rodr´ıguez, A., Fallola, C., Fern´andez-Garayz´abal, J.F., Dom´ınguez, L.,Mycobacterium peregrinum infection in farmed European tench (Tinca tincaL), Veterinary Microbiology(2007), doi:10.1016/j.vetmic.2008.04.017
This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Accepted Manuscript
Mycobacterium peregrinum infection in farmed European tench (Tinca tinca L) 1
A. Aranaza, A. Gibelloa,*, J. Álvareza, A. I. Mataa, A. Rodríguezb, C. Fallolac, J.F.
2
Fernández-Garayzábala, L. Domíngueza 3
a Laboratorio de Vigilancia Sanitaria Veterinaria (VISAVET), Departamento de 4
Sanidad Animal, Facultad de Veterinaria, Universidad Complutense de Madrid, 5
Avda. Puerta de Hierro s/n, 28040 Madrid, Spain 6
b Departamento de Medicina y Cirugía Animal, Facultad de Veterinaria, Universidad 7
Complutense de Madrid, Avda. Puerta de Hierro s/n, 28040 Madrid, Spain 8
c Dirección General de Medio Ambiente, Junta de Extremadura, Badajoz, Spain 9
* Corresponding author. Tel.: + 34 91 3943900; fax: + 34 91 3943908.
10
E-mail address: gibelloa@vet.ucm.es 11
Keywords: Mycobacterium peregrinum; European tench; mycobacteriosis; farmed fish 12
Revised Manuscript
Accepted Manuscript
Abstract 13
This work is the first description of Mycobacterium peregrinum as an etiological 14
agent for mycobacteriosis in farmed fishes. We report the mycobacterial infection in 15
farmed European tench (Tinca tinca L) which was confirmed by culture, molecular 16
identification methods (PCRs aimed at 16S rRNA, rpo and hsp65 sequencing), and 17
histopathology. Since M. peregrinum infection has been described in humans, their 18
clinical significance in fishes should be considered of healthcare interest. With this case 19
report, we also show that a multidisciplinary approach was needed to overcome 20
difficulties associated to diagnosis of piscine mycobacteriosis.
21
Accepted Manuscript
1. Introduction 22
Mycobacteriosis of fish is a generic term used to designate a typically subacute 23
to chronic progressive disease caused by different Mycobacterium species, being 24
Mycobacterium marinum, M. fortuitum, M. chelonae and M. abscessus (Kusunoki and 25
Ezaki, 1992; Decostere et al., 2004) the most commonly identified. However, some new 26
mycobacterial species, such as M. chesapeaki, M. shottsii, M. montefiorense and M.
27
haemophilum, among others, have also been implicated as responsible of mycobacterial 28
infections in fish (Levi et al. 2003; Rhodes et al. 2003; Whipps et al., 2007).
29
Mycobacteriosis is common in marine and freshwater fish-species worldwide, 30
including either ornamental fish (Pate et al., 2005; Beran et al., 2006), research facilities 31
(Kent et al., 2004), wild fish (Diamant, 2001; Poort et al., 2006) and cultured fishes as 32
sea bass, striped bass, seabream, snakehead, channel catfish, turbot and Atlantic salmon 33
(Knibb et al., 1993, dos Santos et al., 2002, Brocklebank et al., 2003), where the disease 34
usually produces mortalities between 2-10% (Dos Santos et al., 2002; Ghittino et al., 35
2003). The most important species involved in mycobacteriosis of fish are also zoonotic 36
bacteria responsible of human cutaneous infections associated with manipulation of 37
infected fish or contaminated water (Decostere et al., 2004). The occurrence of human 38
infections with other non-tuberculous mycobacteria (NTM), as M. smegmatis, M.
39
peregrinum and M. septicum, has also increased during the last years (Brown-Elliot &
40
Wallace 2002). Recently M. peregrinum has been implemented as a cause of disease in 41
zebrafish research facilities (Kent et al., 2004), and this is the first description of 42
infection by this bacterium in farmed fish (European tench).
43 44
Accepted Manuscript
2. Material and methods 45
2.1. Farm and animals of the study 46
This study was carried out in European tenches (Tinca tinca L.) from a farm 47
located in western Spain, with a previous history of low mortality averages 48
(approximately 4% per year). Mortalities occurred generally in adult fish over 500 g, 49
and post-mortem examination of dead fish in the farm revealed the presence of 50
numerous granulomas. European tenches (n = 14) of 750-1000 g and about 300 mm 51
long were captured and sent to the laboratory for microbiological analysis.
52
Tenches were euthanized with tricaine methanesulfonate (MS-222), necropsied 53
under aseptical conditions and examined for lesions. Ten of the tenches examined 54
presented clinical signs suggestive of systemic mycobacteriosis with external dermal 55
ulcers and internal granulomatous-like lesions, mainly in spleen, liver and kidney. Four 56
tenches were apparently healthy and no clinical signs or lesions were observed. Samples 57
from liver (hepatopancreas), kidney and spleen were taken from affected tenches for 58
histopathological and microbiological (culture and PCR detection) study.
59
2.2. Histopathology 60
Tissues were fixed in 10% neutral-buffered formaline, embedded in paraffin, cut 61
in 4-μm sections, and stained with haematoxylin-eosin (H&E) and Ziehl-Neelsen´s acid 62
fast stains. Histological diagnosis of mycobacteriosis was based on the observation of 63
multiple granulomas in visceral organs and the acid-fast bacilli load in affected tissues.
64
2.3. Culture 65
Auramine staining of smears from tissue samples was performed by the method 66
of Smithwick (1976), and observed by transmission fluorescence microscopy. Tissue 67
Accepted Manuscript
samples with granulomatous-like lesions from each animal were pooled, homogenized 68
in sterile distilled water, decontaminated with 0.35% hexadecylpyridinium chloride for 69
30 minutes (Corner & Trajstman, 1988), centrifuged at 3.500 r.p.m. (1068 x g) for 30 70
min, and sediments cultured onto selective media (0.2% pyruvate-enriched Löwenstein- 71
Jensen and Middlebrook 7H10). Culture media were incubated aerobically at 30oC and 72
checked weekly during 4 weeks for growth.
73
Before decontamination, samples were also cultured for detection of common 74
bacterial fish pathogens onto Columbia blood agar plates (bioMérieux España S.A.) and 75
incubated for 72 hours at 30ºC.
76
2.4. Molecular diagnosis 77
Samples were simultaneously processed for DNA extraction following the 78
method of Casas et al. (1995). The identification of isolates from culture media as genus 79
Mycobacterium was determined by two PCR-assays based on the amplification of the 80
16S rRNA and rpoB genes; whereas the identification from DNA directly from infected 81
tissues was determined by amplification of rpoB gene. In the first reaction, the 82
amplification targets a 1030 bp DNA product specific of 16S rDNA Mycobacterium 83
spp. by using the primers Mycgen-F and Mycgen-R (Table 1) and the amplification 84
conditions described by Boddinghaus et al. (1990). In the second reaction, the primers 85
M-5 and RM-3 were used to amplify a sequence of 136 bp DNA fragment belonging to 86
the rpoB gene from NTM following the amplification conditions described by Kim et 87
al. (2004). In both cases, a PCR mixture (50 µl) containing DNA template (50 to 70 ng 88
of chromosomal bacterial DNA or 10 µl of DNA extracted from bacterial suspensions 89
or fish granulomes), 2 mM MgCl2, 1 µM of each primer, 0.25 mM of each 90
Accepted Manuscript
deoxynucleotide triphosphate and 1.5 U of DNA polymerase (Biotools; B & M 91
Laboratories S.A., Madrid, Spain) in 1x reaction buffer was assembled. The amplicons 92
were visualized by electrophoresis on a 2% agarose gel stained by ethidium bromide and 93
illuminated with UV light.
94
The identification of isolates to species level was carried out by PCR 95
amplification and further sequencing of the 16S rRNA and the 65 KDa heat-shock 96
protein (hsp) genes. The amplification of 1500 bp of the 16S rRNA gene was performed 97
using universal primers (Table 1). Also, a 439 bp fragment of hsp65 was amplified with 98
the primers Tb11 and Tb12 described by Telenti et al. (1993).
99
Amplicons were purified with the Qiaquick PCR Purification kit (Quiagen 100
GmbH, Hilden, Germany) and both strands of 16S rRNA and hsp65 genes were 101
sequenced with the DyeDeoxy (dRhodamine) Terminator Cycle Sequencing kit in an 102
automatic ABI Prism 373 DNA sequencer (Applied Biosystems) (C.I.B. Sequencing 103
Facilities, Madrid). The DNA sequences of the clinical Mycobacterium isolates were 104
compared with those available in the GenBank/ EMBL databases 105
(http://www.ncbi.nlm.nih.gov) using the BLAST software 106
(http://www.ncbi.nlm.nih.gov/BLAST).
107
Accepted Manuscript
3. Results and discussion 108
Ten out of the fourteen fishes received showed macroscopic lesions in internal 109
organs compatible with mycobacteriosis (Fig. 1A). The histopathological study was 110
focussed in liver (hepathopancreas), kidney and spleen where we found the most 111
important microscopical findings, although the hepathopancreas always exhibited the 112
most severe lesions.
113
We observed several histopathological findings: 1) initial granulomas composed 114
by numerous grouped macrophages in the central area surrounded of lymphocytes and 115
plasma cells (Fig. 1B). Ziehl-Neelsen stain of these samples revealed the presence of a 116
great number of acid-fast bacilli within macrophages (Fig. 1D); and 2) late granulomas 117
composed of multiple coalescing granulomas characterised by eosinophilic necrotic 118
central area surrounded by multinucleated giant cell in scarce number, macrophages, 119
lymphocytes and plasma cells (Fig. 1C). In some cases the lesions were so intense that 120
the architectural disorganization made organ recognition difficult. In addition, some 121
examined fishes displayed a wide portal-portal bridging fibrosis associated with intense 122
infiltration of lymphocytes, plasma cells and macrophages; this process originated a 123
parenchyma collapse given place to small nodular foci of hepatocytes (micronodular 124
cirrhosis). The hepatic parenchyma displayed also a severe hydropic degeneration of 125
hepatocytes. The renal interstitium presented a moderate to severe chronic infiltration of 126
round cells, mainly lymphocytes, plasma cells and macrophages, especially in those 127
cases where granulomatous lesions were found. These changes could be due to the 128
increase in the hematopoietic capacity of the kidney in response to the infection. All 129
these pathological findings suggest that these granulomatous lesions had been induced 130
Accepted Manuscript
by a Mycobacterium infection.
131
Although histological lesions were strongly indicative of mycobacteriosis, 132
culture was unsuccessful in most samples analyzed, and mycobacteria were isolated in 133
both Löwenstein-Jensen and Middlebrook 7H10 agars from only two tenches (isolates 134
TCI 1 and TCI 2). Both isolates were identified as Mycobacterium spp. by PCR aimed 135
at the 16S rDNA (Fig. 2A). On the other hand, the 136 bp amplification product of 136
Mycobacterium NTM rpoB gene (Fig. 2B), were obtained from tissue homogenates of 137
four other affected tenches. No other bacteria were isolated from primary cultures onto 138
Columbia blood agar plates.
139
In this study, we used a molecular identification approach to overcome the 140
difficulties associated to biochemical identification of mycobacteria that is lengthy, 141
difficult to perform and can lead to inconclusive results. The 16S rRNA sequence of the 142
clinical isolate TCI 1 has been deposited in the GenBank/EMBL database under the 143
accession number AM884581. Comparative analysis of the 16S rRNA sequences 144
revealed that both Mycobacterium clinical isolates were identical, displaying 100%
145
similarity with the type strain of Mycobacterium peregrinum CIP 105382T (accession 146
number AY457069). As M. peregrinum has similar 16S rRNA sequences to M.
147
septicum (which only 4 substitutions across 1483 bp), the identification of the clinical 148
isolates was also confirmed by sequencing of thehsp65 gene. Sequence analysis of this 149
gene confirmed the identity of the clinical isolates, displaying 99% similarity with the 150
hsp65 sequence of M. peregrinum isolate B1285 (GenBank/EMBL accession number 151
AY379072) of this microorganism. The two point mutations (at nucleotides 617 and 152
800) found in our isolates (GenBank/EMBL accession number EU156064, isolate TCI 153
Accepted Manuscript
1) have been previously described in M. peregrinum (Ringuet et al., 1999).
154
Although M. peregrinum is a fast-growing mycobacteria (Kusunoki and Ezaki, 155
1992), the unsuccessful culture of this microorganism on the media routinely used for 156
the isolation of Mycobacterium spp. has also been observed previously. Thus, M.
157
peregrinum was isolated on Middlebrook 7H10 agar from only 9% of experimentally 158
inoculated zebrafish (Watral and Kent, 2007) and in fishes infected by other 159
micobacterial opportunistic pathogen (Watral and Kent, 2007; Whipps et al., 2003).
160
These findings are in agreement with the lack of equivalence in some piscine 161
mycobacterial infections between the presence of granulomatous lesions, the presence 162
of acid-fast bacilli and the culture growth. Similar results have been also described in 163
mycobacteriosis in birds caused by M. peregrinum (Vitali et al., 2006). M. peregrinum 164
could be considered as an opportunistic pathogen that may affect animals under 165
stressful conditions (i.e. higher water temperature, mating season) (Vitali et al., 2006;
166
Watral and Kent, 2007); thus, some animals would survive the clinical infection 167
although the granulomatous lesions may remain in their internal organs. This fact 168
highlights that an appropriate approach to diagnosis should include histopathology, 169
bacteriology and molecular identification.
170
M. peregrinum has previously been isolated from nodular lesions of cultured 171
marine white shrimp Penaeus vannamei (Mohney et al., 1998) and from different 172
ornamental fish species without apparent clinical lesions (Pate et al., 2005). However, 173
there is a lack of knowledge about the importance and impact of M. peregrinum 174
infections on both wild and cultured-fish populations. There is only one report of 175
mycobacterial outbreaks in zebrafish research facilities byM. peregrinum (Kent et al., 176
Accepted Manuscript
2004), although in this outbreak the identification of the etiological agent as M.
177
peregrinum was not unambiguously confirmed (Kent et al., 2004). In our study, M.
178
peregrinum was isolated and accurately identified from tenches with visible 179
granulomas, being therefore the first report of mycobacteriosis in farmed fishes 180
implicating M. peregrinum. The multidisciplinary approach used in this study allowed 181
us to overcome difficulties associated to diagnosis of piscine mycobacteriosis, and a 182
combination of molecular identification yielded a precise diagnosis.
183
Mycobacterial infections in humans are associated with exposure to fish or 184
contaminated water. Over the last decade, a small but increasing number of sporadic 185
human infections associated with M. peregrinum have been reported (Ishii et al., 1998, 186
Pagnoux et al., 1998, Rodriguez-Gancedo et al, 2001, Koscielniak et al., 2003, Short et 187
al., 2005, Sakai et al., 2005). Most of these infections occur in immune compromised 188
persons, but unusual M. peregrinum infections in non immune-compromised persons 189
have also been described (Ishii et al., 1998). European tench is a cyprinid farmed fish 190
species cultured for human consumption. Although the transmission of M. peregrium to 191
man through the consumption of contaminated fish is very unlikely, the improper 192
manipulation of M. peregrinum infected fish may represent a potential risk for fish 193
farmers or fish processors, as well as it has been described for other zoonotic bacterial 194
fish pathogens (Ghittino et al., 2003). Tenches are also used as live bait for sport 195
activities, and as observed with other mycobacteria, this fish infection could represent a 196
potential source of infection for other wild-fish species (Kane et al., 2007), as well as 197
for humans in the course of recreational water related activities (Ang et al., 2000;
198
Decostere et al., 2004; Primm et al., 2004).
199
Accepted Manuscript
Acknowledgements 200
A. Gibello and A. Aranaz contributed equally to this work. Authors thank to 201
Pilar Liébana for her technical assistance. This work was partially supported by 202
DIBAQ-DIPROTEG.
203
Accepted Manuscript
References 204
Ang, P., Rattana-Apiromyakij, N., Goh, C.L., 2000. Retrospective study of 205
Mycobacterium marinum skin infections. Int. J. Dermatol. 39, 343–347.
206
Beran, V., Matlova, L., Dvorska, L., Svastova, P., and Pavlik, I., 2006. Distribution of 207
mycobacteria in clinically healthy ornamental fish and their aquarium 208
environment. J. Fish Dis. 29, 383-393.
209
Boddinghaus, B., Rogall, T., Flohr, T., Blocker, H., Bottger, E.C. 1990. Detection and 210
identification of mycobacteria by amplification of rRNA. J. Clin. Microbiol.
211
288, 1751-1759.
212
Brocklebank, J., Raverty, S., Robinson, J., 2003. Mycobacteriosis in Atlantic salmon 213
farmed in British Columbia. Can. Vet. J. 44, 486-489.
214
Brown-Elliott, B.A., Wallace Jr., R.J., 2002. Clinical and taxonomic status of 215
pathogenic nonpigmented or late-pigmenting rapidly growing mycobacteria.
216
Clin. Microbiol. Rev. 15, 716-746.
217
Casas, I., Powell, L., Klapper, P. E., Cleator, G. M., 1995. New method for the 218
extraction of viral RNA and DNA from cerebrospinal fluid for use in the 219
polymerase chain reaction assay. J Virol Methods 53, 25-36.
220
Corner, L.A., Trajstman, A.C., 1988. An evaluation of 1-hexadecyl-pyridinium chloride 221
as a decontaminant in the primary isolation of Mycobacterium bovis from bovine 222
lesions. Vet. Microbiol. 18, 127-134.
223
Decostere, A., Hermans, K., Haesebrouck, F., 2004. Piscine mycobacteriosis: a 224
literature review covering the agent and the disease it causes in fish and humans.
225
Vet. Microbiol. 99, 159-166.
226
Accepted Manuscript
Diamant, A., 2001. Cross-infections between marine cage-cultured stocks and wild fish 227
in the northern Red Sea: is the environment at risk? In: Rodgers CJ (ed) Proc 228
OIE International Conference on Risk Analysis in Aqutic Animal Health. Office 229
International des Epizooties, Paris, p. 202-208 230
Dos Santos, N.M., do Vale, A., Sousa, M.J., Silva, M.T., 2002. Mycobacterial infection 231
in farmed turbot Scophtalmus maximus. Dis. Aquat. Org. 52, 87-91.
232
Ghittino, C., Latini, M., Agnetti, F., Panzieri, C., Lauro, R., Ciappelloni, R., Petracca, 233
G., 2003. Emerging pathologies in aquaculture: effects on production and food 234
safety. Vet. Res. Commun. 27 suppl., 471-479.
235
Ishii, N., Sugita, Y., Sato, I., Nakajima, H., 1998. A case of mycobacterial skin disease 236
caused by Mycobacterium peregrinum and M. scrofulaceum. Acta Derm.
237
Venereol. 78, 76-77.
238
Kane, A.S., Stine, C.B., Hungerford, L., Matsche, M., Driscoll, C., and Baya, A.M., 239
2007. Mycobacteria as environmental portent in Chesapeake Bay fish species.
240
Emerg. Infect. Dis. .13, 329-31 241
Kent, M.L., Whipps, C.M., Matthews, J.L., Florio, D., Watral, V., Bishop-Stewart, J.K., 242
Poort, M., Bermudez, L. 2004. Mycobacteriosis in zebrafish (Danio rerio) 243
research facilities. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 138, 383- 244
390 245
Kim, B-J., Hong, S-K., Lee, K-H., Yun, Y-J., Kim, E-C., Park, Y-G., Bai, G-H., Kook, 246
Y-H., 2004. Differential identification of Mycobacterium tuberculosis complex 247
and nontuberculous mycobacteria by duplex PCR assay using RNA polymerase 248
gene (rpo B). J. Clin. Microbiol. 42, 1308-1312 249
Accepted Manuscript
Knibb, W., Colorni, A., Ankaoua, M., Lindell, D., Diamant, A., Gordin, H., 1993.
250
Detection and identification of a pathogenic marina Mycobacterium from the 251
European seabass Dicentrarchus labrax using polymerase chain reaction and 252
direct sequencing of 16S rDNA sequences. Mol. Mar. Biol. Biotechnol. 2, 225- 253
232.
254
Koscielniak, E., de Boer, T., Dupuis, S., Naumann, L., Casanova, J.L., Ottenhoff, T.H., 255
2003. Disseminated Mycobacterium peregrinum infection in a child with 256
complete interferon-gamma receptor-1 deficiency. Pediatr. Infect. Dis. J. 2: 378- 257
80.
258
Kusunoki, S., Ezaki, T., 1992. Proposal of Mycobacterium peregrinum sp.nov, nom.rev, 259
and elevation of Mycobacterium chelonae subsp. abscessus (Kubica et al.,) to 260
species status: Mycobacterium abscessus comb. nov. Int. J. Syst. Bacteriol. 42, 261
240-245.
262
Levi, M.H., Bartell, J., Gandolfo, L., Smole, S.C., Costa, S.F., Weiss, L.M., Johnson, 263
L.K., Osterhout, G., Herbst, L.H., 2003. Characterization of Mycobacterium 264
montefiorense sp. nov., a novel pathogenic Mycobacterium from moray eels that 265
is related to Mycobacterium triplex. J. Clin. Microbiol. 41, 2147-2152.
266
Mohney, L.L., Poulos, B.T., Brooker, J.H., Cage, G.D., Lightner, D.V., 1998. Isolation 267
and identification of Mycobacterium peregrinum from the Pacific White Shrimp 268
Penaeus vannamei. J. Aquatic Anim. Health 10, 83-88.
269
Pagnoux, C., Nassif, X., Boitard, C., Timsit, J., 1998. Infection of continuous 270
subcutaneous insulin infusion site with Mycobacterium peregrinum. Diabetes 271
Care 21, 191-192.
272
Accepted Manuscript
Pate, M., Jenčič, V., Žolnir-Dovč, M., Ocepek, M., 2005. Detection of mycobacteria in 273
aquarium fish in Slovenia by culture and molecular methods. Dis. Aquat. Org.
274
64, 29-35.
275
Poort, M.J., Whipps, C.M., Watral, V.G., Font, W.F., Kent, M.L. 2006. Molecular 276
characterization of a Mycobacterium species in non-native poeciliids in Hawai 277
using DNA sequences. J. Fish Dis. 29, 181-185.
278
Primm, T.P., Lucero, C.A., and Falkinham, J.O., 2004. Health impacts of environmental 279
mycobacteria. Clin Microbiol Rev. 17, 98-106 280
Rhodes, M.W., Kator, H., Kotob, S., Berkum, P., Kaatari, I., Vogelbein, W., Quinn, F., 281
Floyd, M.M., Butler, W.R., Ottinger, C.A., 2003. Mycobacterium shottsii sp. a 282
slowly growing species isolated from Chesapeake Bay striped bass (Morone 283
saxatilis). Int. J. Syst. Evol. Microbiol. 53, 421-424.
284
Ringuet, H., Akoua-Koffi, C., Honore, S., Varnerot, A., Vincent, V., Berche, P., 285
Gaillard, J. L., Pierre-Audigier C., 1999.hsp65 Sequencing for identification of 286
rapidly growing myconabacteria. J. Clin. Microbiol. 37, 852-857.
287
Rodriguez-Gancedo, M.B., Rodriguez-Gonzalez, T., Yague, G., Valero-Guillen, P.L., 288
Segovia-Hernandez, M., 2001. Mycobacterium peregrinum bacteremia in an 289
immunocompromised patient with a Hickman catheter. Eur. J. Clin. Microbiol.
290
Infect. Dis. 20, 589-590.
291
Sakai, T., Kobayashi, C., Shinohara, M., 2005. Mycobacterium peregrinum infection in 292
a patient with AIDS. Intern. Med. 44, 266-269.
293
Short, W.R., Emery, C., Bhandary, M., O'Donnell, J.A., 2005. Misidentification of 294
Mycobacterium peregrinum, the causal organism of a case of bacteremia and 295
Accepted Manuscript
automatic implantable cardioverter defibrillator-associated infection, due to its 296
unusual acid-fast staining characteristics. J. Clin. Microbiol. 43, 2015-2017.
297
Smithwick, R.W., 1976. Laboratory manual for acid-fast microscopy. Second edition.
298
Georgia, US Department of Health, Education and Welfare, Centers for Disease 299
Control.
300
Telenti, A., Marchesi, F., Balz, M., Bally, F., Böttger, E.C., Bodmer, T., 1993. Rapid 301
identification of Mycobacteria to the species level by polymerase chain reaction 302
and restriction enzyme analysis. J. Clin. Microbiol. 31, 175-178.
303
Vitali, S.D., Eden, P.A., Payne, K.L., Vaughan, R.J. 2006. An outbreak of 304
mycobacteriosis in Gouldian Finches caused by Mycobacterium peregrinum.
305
Vet. Clin. Exot. Anim. 9, 519-522.
306
Watral, V and Kent, M.L. 2007. Pathogenesis of Mycobacterium spp. in zebrafish 307
(Danio rerio) from research facilities. Comp. Biochem. Physiol. C. Toxicol.
308
Pharmacol. 145, 55-60.
309
Whipps, C. M., Watral, V. G., Kent, M. L., 2003. Characterization of a Mycobacterium 310
sp. in rockfish, Sebastes alutus (Gilbert) and Sebastes reedi (Westrheim &
311
Tsuyuki), using rDNA sequences. J. Fish Dis. 26, 241-245.
312
Whipps, C. M., Dougan, S.C., Kent, M. L., 2007. Mycobacterium haemophilum 313
infections of zebrafish (Danio rerio) in research facilities. FEMS Microbiol.
314
Lett. 270, 21-26.
315
Accepted Manuscript
316
Table 1. Primers used in this study.
Primer Sequence (5’3’) Gene Size (bp) Target
Mycgen-F AGAGTTTGATCCTGGCTCAG
Mycgen-R TGCACACAGGCCACAAGGGA 16S rRNA 1030 Mycobacterium spp identification
M-5 GGAGCGGATGACCACCCAGGACGTC
RM-3 CAGCGGGTTGTTCTGTCCATGAAC rpo 136 Non-tuberculous mycobacteria identification
ARI GAGAGTTTGATCCTGGCTCAGGA
PH AAGGAGGTGATCCAGCCGCA 16S rRNA 1500 Identification at species level
Tb11 ACCAACGATGGTGTGTCCAT
Tb12 CTTGTCGAACCGCATACCCT
hsp65 441 Identification at species level
317
Accepted Manuscript
Legends to Figures
Fig. 1. Gross lesions: (A) Multiple whitish nodules in the hepatopancreas.
Histopathological findings: (B) Initial granuloma composed of numerous macrophages in the central area. Kidney. H&E 10x; (C) Late granuloma characterized by necrotic centre around with multinucleated cells, great number of macrophages and lymphocytes. Hepatopancreas. H&E 4x. (D) Initial granuloma with numerous intracytoplasmatic acid-fast bacilli within macrophages and multinucleated cells (arrows). Kidney. Ziehl-Neelsen 20 x.
Fig. 2. Ethydium bromide-stained agarose gel electrophoresis of the PCR
products generated from mycobacterial clinical culture isolates and granulomatous lesions from tench using the PCR assay against the 16S rRNA (panel A; amplicon size of 1030 bp) and the rpoB (panel B; amplicon size of 136 bp) genes. (A) line 1, molecular size marker (100-bp ladder); line 2, Mycobacterium positive control, M. marinum CECT 3024T; line 3, negative control; lines 4-6, clinical isolate TCI and TC2 from different media. (B): line 1, molecular size marker (100-bp ladder); line 2, Mycobacterium positive control, M. marinumCECT 3024T; line 3, negative control; lines 4-7, tissue homogenates of affected tenches.
Accepted Manuscript
A B
C D
Figure 1
Accepted Manuscript
136 bp
1 2 3 4 5 6 7
1030 bp
B A
136 bp
1 2 3 4 5 6 7 1 2 3 4 5 6 7
1030 bp
B A
Figure 2
