Update of the spectrum of GJB2 gene mutations in 152 Moroccan families with autosomal recessive nonsyndromic hearing loss
Amina Bakhchane a
,1 , Amale Bous fi ha a
,1 , Hicham Charoute a , Sara Salime a ,
Mustapha Detsouli a , Khalid Snoussi a , Sellama Nadi fi b , Mostafa Kabine d , Hassan Rouba a , Hind Dehbi b , Rachida Roky c , Majida Charif a , Abdelhamid Barakat a
,*aInstitut Pasteur, laboratoire de genetique moleculaire humaine, 20360 Casablanca, Morocco
bGenetics and Molecular Pathology Laboratory, Medical School of Casablanca, Casablanca, Morocco
cUniversite Hassan II Ain Chock, Laboratoire de Physiologie et genetique moleculaire, Km 8 Route d’El Jadida, B.P 5366 Maarif, Casablanca, 20100, Morocco
dLaboratoire de Biochimie et Biologie Moleculaire, Universite Hassan II, Faculte des Sciences Aïn Chock, Casablanca, Morocco
a r t i c l e i n f o
Article history:
Received 15 December 2015 Received in revised form 26 April 2016
Accepted 4 May 2016 Available online 8 May 2016
Keywords:
GJB2 Mutation Hearing loss Morocco
a b s t r a c t
Deafness is one of the most common genetic diseases in humans and is subject to important genetic heterogeneity. The most common cause of non syndromic hearing loss (NSHL) is mutations in theGJB2 gene. This study aims to update and evaluate the spectrum ofGJB2 allele variants in 152 Moroccan multiplex families with non syndromic hearing loss. Seven different mutations were detected: c.35delG, p.V37I, p.E47X, p.G200R, p.Del120E, p.R75Q, the last three mutations were described for thefirst time in Moroccan deaf patients, in addition to a novel nonsense mutation, the c.385G>T which is not referenced in any database. Sixty six families (43.42%) have mutations in the coding region ofGJB2, while the ho- mozygous c.35delG mutation still to date the most represented 51/152 (33.55%). The analysis of the geographical distribution of mutations located inGJB2gene showed more allelic heterogeneity in the north and center compared to the south of Morocco. Our results showed that theGJB2gene is a major contributor to non syndromic hearing loss in Morocco. Thus, this report of theGJB2mutations spectrum all over Morocco has an important implication for establishing a suitable molecular diagnosis.
©2016 Elsevier Masson SAS. All rights reserved.
1. Introduction
Hearing loss is the most common sensory disorder occurring in approximately 0.2% of newborns (Hilgert et al., 2009a). It has a severe impact on speech and language development in children and cause social and vocational problems for adults (Lasak et al., 2014). The early detection of hearing impairment in
fluences the educational outcome of affected infants and rapid intervention maximizes the development of speech, thus facilitating the acqui- sition of normal cognitive, social and motor skills (Hilgert et al., 2009b).
Deafness is very heterogeneous and can occur from external auditory canal, sound conduction mechanism, cochlea, cochlear nerve or central auditory pathways (Lasak et al., 2014). Over half of all cases of congenital hearing loss have a genetic cause (Brown and
Rehm, 2012). It is believed that more than one hundred genes could be involved in non syndromic hearing impairment including 90 various genes previously reported (http://hereditaryhearingloss.
org). Nevertheless a single locus, DFNB1, accounts for about 50%
of cases (Smith et al., 1993). The most concerned gene in this type of deafness is
GJB2, which encodes the gap junction protein connexin26 expressed in the inner ear and is thought to be important in maintaining endocochlear potential (Hilgert et al., 2009b). The degree of deafness varies from moderate-to-profound (Najmabadi and Kahrizi, 2014). Mutations in
GJB2gene are extremely preva- lent in the world, attesting to its importance for normal cochlear function (Chan and Chang, 2014). The most frequent
GJB2mutation in Morocco is c.35delG, it was detected in 29 out of 81 families (35.80%) (Abidi et al., 2007). In this study, we presented the fre- quency of
GJB2gene mutations in 152 families with nonsyndromic hearing loss (NSHL) and have also extended the mutational spec- trum of
GJB2gene in Morocco. Genetic analysis will be helpful to evaluate the impact of the
GJB2mutations as the principal cause of congenital NSHL in our population, which facilitates the diagnosis
*Corresponding author.
E-mail address:[email protected](A. Barakat).
1 Equal level contributors.
Contents lists available atScienceDirect
European Journal of Medical Genetics
j o u r n a l h o me p a g e :h t t p : / / w w w . e l s e v i e r . c o m/ l o ca t e / e j m g
http://dx.doi.org/10.1016/j.ejmg.2016.05.002
1769-7212/©2016 Elsevier Masson SAS. All rights reserved.
of congenital hearing loss and allows early care of patients.
2. Patients and methods 2.1. Patients
A large cohort of 152 Moroccan families, with at least two sib- lings with hearing loss from all over the country took part of this study. Written informed consent was obtained from all patients, and the genetic study was approved by the committee on research ethics of Pasteur Institute of Morocco. Audiological evaluation disclosed moderate to severe hearing loss. The degree of hearing loss was assessing by the World Health Organization
’s standard:
“
slight/mild (26
e40 dB), moderate (41
e70 dB), severe (71
e90 dB), and profound impairment (
>90 dB)
”. Further clinical examination of subjects disquali
fied any symptom or malformation that could be suggestive of a syndromic form of hearing loss.
2.2. Genetic analysis
DNA was extracted from whole peripheral blood by using standard phenol/chloroform protocols. The
GJB2coding exon was ampli
fied by PCR using the forward primer 5
0AGAG TGGTGTTTGCTCAGGA3
0and the reverse primer 5
0GACTGAGCCTT GACAGCTGA3
0amplifying a 900 bp region. Exon 1 (362 pb) was ampli
fied with forward primer 5
0GCCGCCCC CTCCGTAACTTTC3
0and reverse primer 5
0CGTGTGTTGGTCCAGCCCCCC3
’. PCR were carried out in a 15 m l
final reaction volume containing 25 ng of genomic DNA, 7 pmol for each primer, 200 m M of dNTP, 1.5 mM of MgCl
2, 1 PCR buffer and 0.75U m l of Taq DNA polymerase. PCR conditions were denaturation of genomic DNA at 95
C for 5 min and at 94
C for 30 s, annealing at 64
C for 35 s (Exon 1, 60
C for 35 s) and 72
C for 40 s for 35 cycles followed by a 7 min
final extension at 72
C. All PCR products were directly sequenced using the ABI Big-Dye Terminator v 1.1 sequencing standard Kit and run on an ABI 3130 Genetic Analyzer. Sequencing data was analyzed by SeqScape v2.5 Software. Impacts of novel variants on protein structure were predicted by SIFT (Sorting Intolerant From Tolerant), PolyPhen-2 (Polymorphism Phenotyping) and Proven prediction software packages.
3. Results
Among a large cohort of 152 NSHL families, 66 (43.42%) had mutations in the coding region of
GJB2: homozygosity wasobserved in 53 families (34.87%), compound heterozygosity in 4 families (2.63%), and heterozygosity with mono-allelic mutation in 9 families (5.92%). Six different mutations were detected: c.35delG, p.V37I, p.E47X, p.G200R, p. Del120E, p.R75Q, the last three muta- tions were described for the
first time in Moroccan deaf patients. In addition, we identi
fied a novel rare variant: the c.385G
>T (p.E129X), and was submitted to ClinVar database (accession number SCV000267101) (Table 1). All these mutations have an autosomal recessive mode of inheritance, except the p.R75Q mu- tation which is transmitted in an autosomal dominant manner. The genotype of all
GJB2mutations in Moroccan patients, are summa- rized in Table 2. Testing for the IVS1
þ1G
>A splice site mutation in the 86 families with no
GJB2mutation in the coding region, and in the heterozygous
GJB2mutants showed that this mutation is not involved in the occurrence of Hearing loss in Morocco. The 152 families recruited in this study were originated from different re- gions of Morocco. The analysis of the geographical distribution of
GJB2gene mutations shows homogeneous distribution for the c.35delG mutation through Moroccan regions. All four newly described mutations (p.G200R, p. Del120E, R75Q and c.385G
>T) in
Morocco were found in the North and the center, demonstrating a gradual decrease in the frequency of
GJB2mutations from the north-center to the south of Morocco (Fig. 1).
4. Discussion
Genetic testing to con
firm a conclusive diagnosis of
GJB2gene, must be the
first step of molecular analysis of deafness. In the connexin homepage (http://davinci.crg.es/deafness/), over 200 different mutations have been described in the
GJB2gene, hence the necessity to sequence the entire coding region of this gene.
In this study, we reported the spectrum
GJB2gene mutations and evaluated their prevalence in the Moroccan population, 152 families with autosomal recessive hearing loss were included. Our results con
firmed that autosomal recessive deafness in the Moroccan population is mainly due to mutations in
GJB2gene with a frequency of 44.33% (65/152 families). The contribution of the
GJB2gene on NSHL in Morocco is relatively similar to that reported in the neighboring country of Tunisia (39%) (Riahi et al., 2013), but too high compared to Algeria (18.97%) (Ammar-Khodja et al., 2007).
This may be due of the higher number of recruited families in our study (152 families) as well as in the Tunisia study (131 families) compared to Algeria (50 families). The c.35delG is the most frequent pathogenic mutation causing hearing loss in our cohort with a frequency of 33.55% (52/152 families), in accordance with other EuroMediterranean countries like Lebanon (31.25%) (Mustapha et al., 2001), Italy (30.18%) (Murgia et al., 1999), Greece (28, 9%) (Iliades et al., 2002) and Tunisia (35%) (Riahi et al., 2013). In this work, the proportion of the c.35delG mutation of all
GJB2mutant alleles accounts for about 87%, similarly to the most other population, 88% in Italy (Rabionet et al., 2000), 76.9% in Austria (Janecke et al., 2002), and 64% in Portugal (Nogueira et al., 2011).
Some studies have raised the possibility of a founder effect of an ancestral mutation expanded throughout the Mediterranean shore.
In the Moroccan population, the estimated age of the c.35delG
Table 1Allele frequencies ofGJB2mutation in Moroccan ARNSHL families.
Mutation State Number of families
Alleles frequencies %
Proportion of allele frequencies in families withGJB2mutation % c.35delG Homozygous 51 107/304 (35.20%) 107/123 86.99%
c.35delG Heterozygous 5
p.V37I Homozygous 1 10/304 (3.29%) 10/123 8.13%
p.V37I Heterozygous 8
p.E47X Heterozygous 1 1/304 (0.33%) 1/123 0.81%
c.385G>T Heterozygous 1 1/304 (0.33%) 1/123 0.81%
p.G200R Homozygous 1 2/304 (0.66%) 2/123 1.63%
p.Del120E Heterozygous 1 1/304 (0.33%) 1/123 0.81%
p.R75Q Heterozygous 1 1/304 (0.33%) 1/123 0.81%
Table 2
Genotypes ofGJB2gene occurring in 152 Moroccan ARNSHL families.
Genotype Frequency (%)
35delG/35delG 33.55
35delG/p.E47X 0.658
35delG/c.385G>T 0.658
35delG/p.R75Q 0.658
35delG/Wt 1.316
p.V37I/p.V37I 0.658
p.V37I/Wt 4.605
p.DeL120E/p.V37I 0.658
p.G200R/p.G200R 0.658
Wt/Wt 56.58
mutation was 2700 years ago (135 generations) (Abidi et al., 2008a).
Conversely, the c.35delG mutation is absent in Japanese patients (Fuse et al., 1999; Abe et al., 2000). However, the two nucleotide deletions c.235delC and c.167delT are the most common
GJB2mutations in Asian populations (Dai et al., 2007; Han et al., 2008) and Ashkenazi Jews (Morell et al., 1998), respectively. Among the 5 patients found heterozygotes for c.35delG in this study, 3 in- dividuals are carriers of a second mutation in
GJB2gene, while for the 2 other patients, deafness may be not related to c.35delG mu- tation, suggesting that they might be simple carriers since in the control Moroccan population, the carrier frequency of c.35delG was estimated to be 2.65% (Abidi et al., 2007).
The missense variant p.V37I was recently more studied for its high prevalence in East Asians (Li et al., 2012; Kim et al., 2013). It was initially described as a polymorphism because of its high prevalence in normal hearing individuals (Kelley et al., 1998). But over the time, The p.V37I was reported in homozygous and com- pound heterozygous patients and lead to mild or moderate hearing loss (Kim et al., 2013), revealing the pathogenic effect of this mu- tation. In this work, the p.V37I was the second most prevalent variant in
GJB2gene with an allele frequency of 3.29%, this mutation was found at homozygous and compound heterozygous state in two families respectively with moderate hearing loss, while 7 pa- tients were observed at the heterozygous state. In the normal hearing Moroccan population, this variant was found at the het- erozygous state with a frequency of 1.43% (2/140) (Abidi et al., 2008b).
As regards the less common mutation, the p.E47X was found at compound heterozygous state with c.35delG in one patient with a frequency of 0.658% (1/152). This mutation is deleterious and responsible for hearing loss in patients, it was also found in China
and Turkey with an allele frequency of 1% and 1.40% respectively (Snoeckx et al., 2005; Dai et al., 2009).
Besides, three pathogenic mutations have been identi
fied for the
first time in Morocco: p.G200R, p.Del120E, p.R75Q. The missense p.G200R was described in two previous studies: in Iran (Hashemzadeh et al., 2007) and recently in Pakistan (Sha
fique et al., 2014), this pathogenic mutation is located in the fourth trans- membrane domain (TM4) of Cx26, affecting a residue involved in the formation of intramolecular disulphide bonds. The c.358- 360delGAG, known as p.delE120, is a deletion of codon 120, encoding glutamic acid. This pathogenic mutation has a negative effect on formation of gap junctions leading to a complete loss of channel activity. Deafness, due to homozygous mutation have been previously reported all over the world (Hashemzadeh et al., 2007;
Tekin et al., 2005; Oliveira et al., 2002). In this work, the p.delE120 was found at compound heterozygous state with the p.V37I with a frequency of 0.658%. Compound heterozygosity for p.delE120 mutation especially with the c.35delG, was previously described (Gualandi et al., 2002; Marlin et al., 2005).
A few
GJB2mutations have been reported to cause dominant hearing loss hearing loss or with skin diseases, one of them is the p.R75Q. This missense mutation was described for the
first time in a Turkish family (Uyguner et al., 2002) with HL and PPK, and recently in a Chinese family (Jiang et al., 2014). The p.R75Q was reported also to cause dominant HL without cutaneous manifestations in a south Indian family (Pavithra et al., 2015). In this work, the p.R75Q mu- tation was related to HL and PPK, and found at compound hetero- zygous state with the c.35delG with a frequency of 0.658%.
One novel variant was identi
fied in this work: the c.385G
>T,
p.E129X. This nonsense mutation is located within the intracellular
domain 2 (IC2), it converts a glutamic acid residue (GAA) at codon
Fig. 1.The distribution ofGJB2mutant alleles according to the origin of families in Morocco.129 to a stop codon (TAA) of the connexin26 gene, leading to the deletion of the last 97 amino acids of the protein. This mutation is not referenced in any database. The p.E129X was found at com- pound heterozygous state with the c.35delG with a frequency of 0.658%.
5. Conclusions
To sum up,
GJB2mutations consider being involved in 43.42% of the Moroccan patients with ARNSHL. The c.35delG is the most frequent pathogenic mutation causing hearing loss in Morocco, This report of the
GJB2mutation spectrum across all Morocco has an important implications for the establishing a suitable molecular diagnosis.
Conflict of interest
The authors declare that they have no con
flict of interest.
Acknowledgments
We thank all the families for their participation in this study, and clinicians for their help with this research. This work was funded by the Pasteur Institute of Morocco.
References
Abe, S., Usami, S., Shinkawa, H., Kelley, P.M., Kimberling, W.J., 2000. Prevalent connexin 26 gene (GJB2) mutations in Japanese. J. Med. Genet. 37 (1), 41e43.
Abidi, O., Boulouiz, R., Nahili, H., Ridal, M., Alami, M.N., Tlili, A., Rouba, H., Masmoudi, S., Chafik, A., Hassar, M., Barakat, A., 2007.GJB2(connexin 26) gene mutations in Moroccan patients with autosomal recessive non-syndromic hearing loss and carrier frequency of the commonGJB2-35delG mutation. Int.
J. Pediatr. Otorhinolaryngol. 71 (8), 1239e1245.
Abidi, O., Boulouiz, R., Nahili, H., Imken, L., Rouba, H., Chafik, A., Barakat, A., 2008.
The analysis of three markersflankingGJB2gene suggests a single origin of the most common 35delG mutation in the Moroccan population. Biochem. Biophys.
Res. Commun. 377 (3), 971e974.
Abidi, O., Boulouiz, R., Nahili, H., Bakhouch, K., Wakrim, L., Rouba, H., Chafik, A., Hassar, M., Barakat, A., 2008. Carrier frequencies of mutations/polymorphisms in the connexin 26 gene (GJB2) in the Moroccan population. Genet. Test. 12 (4), 569e574.
Ammar-Khodja, F., Makrelouf, M., Malek, R., Ibrahim, H., Zenati, A., 2007. Frequency of the 35delG allele causing nonsyndromic recessive deafness in the Algerian patients. Genet. Couns. 18 (4), 383e391.
Brown, K.K., Rehm, H.L., 2012. Molecular diagnosis of hearing loss. Curr. Protoc.
Hum. Genet. 16 vol. Chapter 9, pp. Unit 9.
Chan, D.K., Chang, K.W., 2014.GJB2-associated hearing loss: systematic review of worldwide prevalence, genotype, and auditory phenotype. Laryngoscope 124 (2), E34eE53.
Dai, P., Yu, F., Han, B., Yuan, Y., Li, Q., Wang, G., Liu, X., He, J., Huang, D., Kang, D., Zhang, X., Yuan, H., Schmitt, E., Han, D., Wong, L.J., 2007. The prevalence of the 235delC GJB2 mutation in a Chinese deaf population. Genet. Med. 9 (5), 283e289.
Dai, P., Yu, F., Han, B., Liu, X., Wang, G., Li, Q., Yuan, Y., Liu, X., Huang, D., Kang, D., Zhang, X., Yuan, H., Yao, K., Hao, J., He, J., He, Y., Wang, Y., Ye, Q., Yu, Y., Lin, H., Liu, L., Deng, W., Zhu, X., You, Y., Cui, J., Hou, N., Xu, X., Zhang, J., Tang, L., Song, R., Lin, Y., Sun, S., Zhang, R., Wu, H., Ma, Y., Zhu, S., Wu, B.L., Han, D., Wong, L.J., 2009.GJB2 mutation spectrum in 2,063 Chinese patients with nonsyndromic hearing impairment. J. Transl. Med. 7, 26.
Fuse, Y., Doi, K., Hasegawa, T., Sugii, A., Hibino, H., Kubo, T., 1999. Three novel connexin26 gene mutations in autosomal recessive non-syndromic deafness.
Neuroreport 10 (9), 1853e1857.
Gualandi, F., Ravani, A., Berto, A., Sensi, A., Trabanelli, C., Falciano, F., Trevisi, P., Mazzoli, M., Tibiletti, M.G., Cristofari, E., Burdo, S., Ferlini, A., Martini, A., Calzolari, E., 2002. Exploring the clinical and epidemiological complexity of GJB2-linked deafness. Am. J. Med. Genet. 112 (1), 38e45.
Han, S.H., Park, H.J., Kang, E.J., Ryu, J.S., Lee, A., Yang, Y.H., Lee, K.R., 2008. Carrier frequency ofGJB2(connexin-26) mutations causing inherited deafness in the Korean population. J. Hum. Genet. 53 (11e12), 1022e1028.
Hashemzadeh, M., Farhud, D., Patton, M., 2007. Familial and sporadicGJB2-related deafness in Iran: review of gene mutations. Iran. J. Publ. Health 36 (1), 1e14.
Hilgert, N., Smith, R.J., Van Camp, G., 2009. Function and expression pattern of nonsyndromic deafness genes. Curr. Mol. Med. 9 (5), 546e564.
Hilgert, N., Smith, R.J., Van Camp, G., 2009. Forty-six genes causing nonsyndromic hearing impairment: which ones should be analyzed in DNA diagnostics?
Mutat. Res. 681 (2e3), 189e196.
Iliades, T., Eleftheriades, N., Iliadou, V., Pampanos, A., Voyiatzis, N., Economides, J., Leotsakos, P., Neou, P., Tsakanikos, M., Antoniadi, T., Konstantopoulou, I., Yannoukakos, D., Grigoriadou, M., Skevas, A., Petersen, M.B., 2002. Prelingual nonsyndromic hearing loss in Greece. Molecular and clinicalfindings. ORL J.
Otorhinolaryngol. Relat. Spec. 64 (5), 321e323.
Janecke, A.R., Hirst-Stadlmann, A., Gunther, B., Utermann, B., Muller, T., Loffler, J., Utermann, G., Nekahm-Heis, D., 2002. Progressive hearing loss, and recurrent sudden sensorineural hearing loss associated withGJB2mutationsephenotypic spectrum and frequencies ofGJB2mutations in Austria. Hum. Genet. 111 (2), 145e153.
Jiang, S.J., Di, Z.H., Huang, D., Zhang, J.B., Zhang, Y.Y., Li, S.Q., He, R., 2014. R75Q de novo dominant mutation ofGJB2in a Chinese family with hearing loss and palmoplantar keratoderma. Int. J. Pediatr. Otorhinolaryngol. 78 (9), 1461e1466.
Kelley, P.M., Harris, D.J., Comer, B.C., Askew, J.W., Fowler, T., Smith, S.D., Kimberling, W.J., 1998. Novel mutations in the connexin 26 gene (GJB2) that cause autosomal recessive (DFNB1) hearing loss. Am. J. Hum. Genet. 62 (4), 792e799.
Kim, S.Y., Park, G., Han, K.H., Kim, A., Koo, J.W., Chang, S.O., Oh, S.H., Park, W.Y., Choi, B.Y., 2013. Prevalence of p.V37I variant ofGJB2in mild or moderate hearing loss in a pediatric population and the interpretation of its pathoge- nicity. PLoS One 8 (4), e61592.
Lasak, J.M., Allen, P., McVay, T., Lewis, D., 2014. Hearing loss: diagnosis and man- agement. Prim. Care 41 (1), 19e31.
Li, L., Lu, J., Tao, Z., Huang, Q., Chai, Y., Li, X., Huang, Z., Li, Y., Xiang, M., Yang, J., Yao, G., Wang, Y., Yang, T., Wu, H., 2012. The p.V37I exclusive genotype ofGJB2: a genetic risk-indicator of postnatal permanent childhood hearing impairment.
PLoS One 7 (5), e36621.
Marlin, S., Feldmann, D., Blons, H., Loundon, N., Rouillon, I., Albert, S., Chauvin, P., Garabedian, E.N., Couderc, R., Odent, S., Joannard, A., Schmerber, S., Delobel, B., Leman, J., Journel, H., Catros, H., Lemarechal, C., Dollfus, H., Eliot, M.M., Delaunoy, J.L., David, A., Calais, C., Drouin-Garraud, V., Obstoy, M.F., Goizet, C., Duriez, F., Fellmann, F., Helias, J., Vigneron, J., Montaut, B., Matin-Coignard, D., Faivre, L., Baumann, C., Lewin, P., Petit, C., Denoyelle, F., 2005.GJB2and GJB6 mutations: genotypic and phenotypic correlations in a large cohort of hearing- impaired patients. Arch. Otolaryngol. Head. Neck Surg. 131 (6), 481e487.
Morell, R.J., Kim, H.J., Hood, L.J., Goforth, L., Friderici, K., Fisher, R., Van Camp, G., Berlin, C.I., Oddoux, C., Ostrer, H., Keats, B., Friedman, T.B., 1998. Mutations in the connexin 26 gene (GJB2) among Ashkenazi Jews with nonsyndromic recessive deafness. N. Engl. J. Med. 339 (21), 1500e1505.
Murgia, A., Orzan, E., Polli, R., Martella, M., Vinanzi, C., Leonardi, E., Arslan, E., Zacchello, F., 1999. Cx26 deafness: mutation analysis and clinical variability.
J. Med. Genet. 36 (11), 829e832.
Mustapha, M., Salem, N., Delague, V., Chouery, E., Ghassibeh, M., Rai, M., Loiselet, J., Petit, C., Megarbane, A., 2001. Autosomal recessive non-syndromic hearing loss in the Lebanese population: prevalence of the 30delG mutation and report of two novel mutations in the connexin 26 (GJB2) gene. J. Med. Genet. 38 (10), E36.
Najmabadi, H., Kahrizi, K., 2014. Genetics of non-syndromic hearing loss in the Middle East. Int. J. Pediatr. Otorhinolaryngol. 78 (12), 2026e2036.
Nogueira, C., Coutinho, M., Pereira, C., Tessa, A., Santorelli, F.M., Vilarinho, L., 2011.
Molecular investigation of pediatric portuguese patients with sensorineural hearing loss. Genet. Res. Int. 2011, 587602.
Oliveira, C.A., Maciel-Guerra, A.T., Sartorato, E.L., 2002. Deafness resulting from mutations in theGJB2(connexin 26) gene in Brazilian patients. Clin. Genet. 61 (5), 354e358.
Pavithra, A., Selvakumari, M., Nityaa, V., Sharanya, N., Ramakrishnan, R., Narasimhan, M., Srisailapathy, C.R., 2015. Autosomal dominant hearing loss resulting from p.R75Q mutation in theGJB2gene: nonsyndromic presentation in a South Indian family. Ann. Hum. Genet. 79 (1), 76e82.
Rabionet, R., Zelante, L., Lopez-Bigas, N., D’Agruma, L., Melchionda, S., Restagno, G., Arbones, M.L., Gasparini, P., Estivill, X., 2000. Molecular basis of childhood deafness resulting from mutations in theGJB2(connexin 26) gene. Hum. Genet.
106 (1), 40e44.
Riahi, Z., Hammami, H., Ouragini, H., Messai, H., Zainine, R., Bouyacoub, Y., Romdhane, L., Essaid, D., Kefi, R., Rhimi, M., Bedoui, M., Dhaouadi, A., Feldmann, D., Jonard, L., Besbes, G., Abdelhak, S., 2013. Update of the spectrum ofGJB2gene mutations in Tunisian families with autosomal recessive non- syndromic hearing loss. Gene 525 (1), 1e4.
Shafique, S., Siddiqi, S., Schraders, M., Oostrik, J., Ayub, H., Bilal, A., Ajmal, M., Seco, C.Z., Strom, T.M., Mansoor, A., Mazhar, K., Shah, S.T., Hussain, A., Azam, M., Kremer, H., Qamar, R., 2014. Genetic spectrum of autosomal recessive non- syndromic hearing loss in Pakistani families. PLoS One 9 (6), e100146.
Smith, R.J.H., Shearer, A.E., Hildebrand, M.S., Van Camp, G., 1993. Deafness and hereditary hearing loss overview. In: Pagon, R.A., Adam, M.P., Ardinger, H.H., Wallace, S.E., Amemiya, A., Bean, L.J.H., Bird, T.D., Dolan, C.R., Fong, C.T., Smith, R.J.H., Stephens, K. (Eds.), GeneReviews(R). Seattle (WA).
Snoeckx, R.L., Huygen, P.L., Feldmann, D., Marlin, S., Denoyelle, F., Waligora, J., Mueller-Malesinska, M., Pollak, A., Ploski, R., Murgia, A., Orzan, E., Castorina, P., Ambrosetti, U., Nowakowska-Szyrwinska, E., Bal, J., Wiszniewski, W., Janecke, A.R., Nekahm-Heis, D., Seeman, P., Bendova, O., Kenna, M.A., Frangulov, A., Rehm, H.L., Tekin, M., Incesulu, A., Dahl, H.H., du Sart, D., Jenkins, L., Lucas, D., Bitner-Glindzicz, M., Avraham, K.B., Brownstein, Z., del Castillo, I., Moreno, F., Blin, N., Pfister, M., Sziklai, I., Toth, T., Kelley, P.M., Cohn, E.S., Van Maldergem, L., Hilbert, P., Roux, A.F., Mondain, M., Hoefsloot, L.H., Cremers, C.W., Lopponen, T., Lopponen, H., Parving, A.,
Gronskov, K., Schrijver, I., Roberson, J., Gualandi, F., Martini, A., Lina-Granade, G., Pallares-Ruiz, N., Correia, C., Fialho, G., Cryns, K., Hilgert, N., Van de Heyning, P., Nishimura, C.J., Smith, R.J., Van Camp, G., 2005.GJB2mutations and degree of hearing loss: a multicenter study. Am. J. Hum. Genet. 77 (6), 945e957. Tekin, M., Bogoclu, G., Arican, S.T., Orman, M.N., Tastan, H., Elsobky, E., Elsayed, S.,
Akar, N., 2005. Evidence for single origins of 35delG and delE120 mutations in
theGJB2gene in Anatolia. Clin. Genet. 67 (1), 31e37.
Uyguner, O., Tukel, T., Baykal, C., Eris, H., Emiroglu, M., Hafiz, G., Ghanbari, A., Baserer, N., Yuksel-Apak, M., Wollnik, B., 2002. The novel R75Q mutation in the GJB2gene causes autosomal dominant hearing loss and palmoplantar kerato- derma in a Turkish family. Clin. Genet. 62 (4), 306e309.