Tetracycline in Liquid Manure Selects for Co-occurrence of the Resistance Genes (M) and (L) in

HAL Id: hal-00526933

https://hal.archives-ouvertes.fr/hal-00526933

Submitted on 17 Oct 2010

HAL

is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire

destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.

of the Resistance Genes (M) and (L) in

Karin Schwaiger, Katrin Harms, Christina Hölzel, Karsten Meyer, Marianne Karl, Johann Bauer

To cite this version:

Karin Schwaiger, Katrin Harms, Christina Hölzel, Karsten Meyer, Marianne Karl, et al.. Tetracycline

in Liquid Manure Selects for Co-occurrence of the Resistance Genes (M) and (L) in. Veterinary

Microbiology, Elsevier, 2009, 139 (3-4), pp.386. �10.1016/j.vetmic.2009.06.005�. �hal-00526933�

Title: Tetracycline in Liquid Manure Selects for

Co-occurrence of the Resistance Genes tet(M) and tet(L) in Enterococcus faecalis

Authors: Karin Schwaiger, Katrin Harms, Christina H¨olzel, Karsten Meyer, Marianne Karl, Johann Bauer

PII: S0378-1135(09)00289-2

DOI: doi:10.1016/j.vetmic.2009.06.005

Reference: VETMIC 4459

To appear in: VETMIC Received date: 8-1-2009 Revised date: 11-5-2009 Accepted date: 3-6-2009

Please cite this article as: Schwaiger, K., Harms, K., H¨olzel, C., Meyer, K., Karl, M., Bauer, J., Tetracycline in Liquid Manure Selects for Co-occurrence of the Resistance Genes tet(M) and tet(L) in Enterococcus faecalis, Veterinary Microbiology (2008), doi:10.1016/j.vetmic.2009.06.005

This is a PDF file of an unedited manuscript that has been accepted for publication.

As a service to our customers we are providing this early version of the manuscript.

The manuscript will undergo copyediting, typesetting, and review of the resulting proof

before it is published in its final form. Please note that during the production process

errors may be discovered which could affect the content, and all legal disclaimers that

apply to the journal pertain.

Accepted Manuscript

1

Title:

1

Tetracycline in Liquid Manure Selects for Co-occurrence of the Resistance Genes tet(M) 2

and tet(L) in Enterococcus faecalis 3

4 5

Names and address of affiliation:

6

Karin Schwaiger

; Katrin Harms; Christina Hölzel; Karsten Meyer; Marianne Karl; Johann 7

Bauer 8

Chair of Animal Hygiene 9

Technische Universität München 10

Weihenstephaner Berg 3 11

85354 Freising-Weihenstephan, Germany.

12

*

Phone: +49 81 61/71-33 14; Fax: +49 81 61/71-45 16;

13

*

e-mail: [email protected] 14

15

*

Corresponding Author 16

17

Accepted Manuscript

Abstract:

1

Causal relations between antibiotic use and selection of antibiotic resistance have been widely 2

discussed. However, appropriate examinations have been mainly performed on phenotypic 3

level, whereas genetic investigations, as well as researches under realistic conditions, are 4

scarce. Therefore, the present field study aimed to accomplish a particular description of how 5

an antibiotic contaminated environment influences microorganisms on both a phenotypic and 6

a genetic level, using analytical, phenotypical and molecular biological methods. For this 7

purpose, concentrations of tetracycline, chlortetracycline, oxytetracycline and doxycycline 8

were analysed in liquid manure samples (n = 179) from Bavarian (Germany) pig farms. All 9

detected tetracyclines found in each manure sample were summed up and referred to as total 10

tetracycline concentrations (TET). Phenotypic doxycycline resistance of E. faecalis isolated 11

from these manure samples was determined by means of the microdilution method. After that, 12

doxycycline resistant (n = 147) and susceptible (n = 32) E. faecalis were screened for tet(L), 13

tet(M), tet(S) and tet(O) by using PCR. If despite doxycycline resistance no respective gene 14

was detected, tet(A/B/C/D/K/L/M/W/Z) were additionally tested. The most frequent 15

resistance determinant was tet(M) (n = 128), followed by tet(L) (n = 95). Tet(S) and tet(O) 16

were present in 12 and 7 isolates; the remaining tet-genes were not detected. A correlation 17

between the TET concentration in manure and the occurrence of tet(M) and tet(L) could be 18

shown. In particular, strains that contained neither tet(M) nor tet(L) (n = 44) were isolated 19

from manure samples with mean TET of 0.35 mg/kg. If tet(M) was the only tetracycline 20

resistance gene (n = 40), mean concentrations were 0.51 mg/kg, and, if tet(L) was the only tet- 21

gene (n = 7), 1.18 mg/kg, respectively. On the other hand, if co-occurrence of tet(M) and 22

tet(L) was detected (n = 88, including 1 susceptible isolate), mean TET in the referring 23

manure samples was 4.08 mg/kg. The present study demonstrates that high tetracycline 24

concentrations in manure lead to higher doxycycline minimum inhibitory concentrations 25

(MICs) in E. faecalis, genetically based on co-occurrence of tet(M) and tet(L).

26

Accepted Manuscript

1

Keywords:

2

Tetracycline, antimicrobial resistance, minimum inhibitory concentration, tet(M), tet(L), 3

tet(S), tet(O), liquid manure, selection 4

5

Introduction:

6

Therapeutic or prophylactic antibiotic applications lead to massive increase of antibiotic 7

resistant bacteria in humans and animals (Schwaiger et al., 2008). Above all, growth 8

promotors, used in subtherapeutical dosages, were discussed frequently in this context. Feed 9

additives of this type are no longer permitted in the EU since 01.01.2006 (EG 1831/2003), but 10

it has to be considered that even antibiotics properly used for therapeutic purposes will also be 11

excreted and may lead to subtherapeutic, intermediate or even inhibitory concentrations in 12

liquid manure (Sukul et al., 2009). This, in turn, carries the risk of a selection of antibiotic 13

resistant bacteria. In this study, we decided to examine tetracyclines and some of their 14

respective resistance genes, as they are the most frequently applied antibiotics in veterinary 15

medicine (FEDESA, 1998; GERMAP, 2008). Up till now, causal relations between antibiotic 16

use and selection of antibiotic resistance have been mainly described on phenotypic level 17

(Phillips et al., 2004), whereas genetic investigations are scarce, and if at all, predominantly 18

confined to E. coli (Blake et al., 2003). Enterococci rank as indicator- and reservoir- 19

organisms and should, by recommendation of the Office International des Epizooties (OIE, 20

2001), as well as by the World Health Organisation (WHO, 1997), be consistently included in 21

resistance tests. In E. faecalis, tet(M) is the most frequent tetracycline resistance determinant, 22

followed by tet(L) (Aarestrup et al., 2000; Huys et al., 2004). Therefore, the present field 23

study aimed to clarify the influence of different tetracycline concentrations in liquid pig 24

manure on the occurrence of tet(M) and tet(L) and, consequently, the expression of 25

tetracycline resistance in E. faecalis. Because enterococci may harbour further tetracycline

26

Accepted Manuscript

resistance genes (Chopra and Roberts, 2001), some other tet-genes were additionally tested.

1

This represents the first investigation that combines analytical, phenotypical and molecular 2

biological methods in order to accomplish a particular description of how an antibiotic 3

contaminated environment influences microorganisms on both a phenotypic and a genetic 4

level.

5

Materials and methods:

6

Sampling 7

Liquid pig manure samples (n = 179) originated from a representative monitoring in Bavaria 8

(Germany) as described elsewhere (Hölzel and Bauer, 2008). Farms were chosen by a random 9

generator from an agricultural database (InVeKoS). One manure sample per farm was taken 10

in autumn 2002, or in spring 2003, at the time of its application to the fields, which means – 11

depending on storing facilities – a maximum storage time of six up to twelve months.

12

Contents of the manure pits were mixed in advance of the sampling. Samples with a quantity 13

of 2 l were taken by the farmers, collected at the district agriculture offices and sent to the 14

laboratory anonymously.

15

Determination of tetracycline concentrations in liquid pig manure:

16

For determination of accuracy and precision of the method for the determination of antibiotic 17

residuals, antibiotic free produced pig manure was artificially contaminated with known 18

concentrations of tetracylines (tetracycline, chlortetracycline, oxytetracycline and 19

doxycycline) (Sigma, Deisenhofen, Germany). A detailed description of the sample 20

preparation and analysis is given by Harms, 2006, and Sczesny et al., 2003. For identification 21

and quantification a HPLC-system (WATERS, 2690 Separations Module, Milford, MA, 22

USA) using a C8 column (acetonitril/water gradient) was used in combination with a 23

quadrupole mass-spectrometer (VG Platform 2) with an electrospray (ESP+)-ionisation- 24

source and the software of MassLynxTM Datasystem (Micromass, Altrichamn, UK).

25

Identification was based on the retention time and relative peak area of selected ions. For

26

Accepted Manuscript

quantification, the area of the quasimolecular ion peak was compared with that of an external 1

standard. All detected tetracyclines found in each manure sample were summed up and 2

referred to as total tetracycline (TET) concentrations. The limit of detection (LOD) was 0.1 3

mg/kg; recovery rates of 60.5 % to 75.3 % were achieved.

4

Isolation of bacterial strains and doxycycline minimum inhibitory concentration (MIC) 5

determination:

6

From each liquid manure sample, 1 g was suspended in 9 ml NaCl 0.9 %. (Note: liquid 7

manure was difficult to pipet due to particles constipating the pipette tips. As the dry mass of 8

all liquid manure samples was very low (mean: 3.75; median: 3.1), the difference between 9

millilitres and grams is negligible. Therefore, 1 g was weighed out instead of pipetting 1 ml.) 10

Of the dilution series 10

to 10

, 0.1 ml was plated on Enterococcus selective CATC- 11

(Citrate Azide Tween

Carbonate) Agar (VWR, Darmstadt, Germany) and incubated at 37 °C 12

for 24 h. Up to 4 typical red colonies from the highest dilution were subcultivated on Standard 13

I Nutrient Agar (Merck, Darmstadt, Germany), containing 7 % defibrinated sheep blood 14

(Fiebig, Idstein-Niederauroff, Germany), at 37 °C for 24 h. Pure cultures were Gram-stained 15

and biochemically differentiated. Gram-positive, xylose- and arabinose-negative, mannitol- 16

and sodium-pyruvate-positive cocci were identified as E. faecalis (Bejuk et al., 2000) and 17

confirmed by a commercial biochemical test system (BBL™ Crystal™ GP ID, Becton 18

Dickinson, Heidelberg, Germany). If there were more E. faecalis isolated from one sample, 19

only one isolate was randomly selected for further investigations.

20

MICs of doxycycline for these strains were examined by a standardized microdilution 21

procedure using the automated Micronaut

test system according to DIN 58940-81 (2002) 22

and manufacturer’s data (range of concentrations: 0.125 – 16 mg/l), predominantly as 23

previously described (Hölzel and Bauer, 2008). The MICs were read off photometrically via 24

Micronaut

-scan-system (MERLIN, Bornheim-Hersel, Germany). Depending on the MIC, 25

isolates can be divided, agreeing to DIN 58940-4/1 (2004), into doxycycline resistant (MIC >

26

Accepted Manuscript

4 mg/l), intermediate resistant (1 > MIC ≤ 4 mg/l), or susceptible (MIC ≤ 1 mg/l). For 1

statistical analysis, MICs below the control range were equated with the value of the lowest 2

tested concentration; MICs on the upper end were replaced by the next higher concentration 3

grade.

4

Detection of tet(M) and tet(L) using Polymerase chain reaction (PCR):

5

Phenotypically doxycycline resistant E. faecalis (n = 147) and phenotypically doxycycline 6

susceptible E. faecalis (n = 32), each belonging to a different manure sample (n = 179), were 7

subcultured on Standard I Nutrient Agar (Merck) containing 7 % defibrinated sheep blood 8

and incubated for 24 h at 37 °C. Susceptible isolates were included into the investigation, as 9

resistance genes can be present in these strains as well, even if the resistance is not expressed 10

(Lanz et al., 2003). DNA was extracted using a commercial purification kit following 11

manufacturer’s instructions (DNEasy Tissue Kit, Qiagen, Hilden, Germany). PCR was carried 12

out for tet(L), tet(M), tet(O) and tet(S) for all 179 isolates. If in phenotypically doxycyline 13

resistant isolates none of these four genes was detectable, the search was extended to tet(A), 14

tet(B), tet(C), tet(D), tet(K), tet(W), and tet(Z). Primer sequences and references for PCR- 15

conditions are listed in Table 1. Reaction products were visualised in UV light after gel 16

electrophoresis through a 1.5 % agarose gel (BioRad, Munich, Germany) containing 0.25 17

µl/ml ethidium bromide (Sigma, Munich, Germany). Reference strains known to contain 18

according tet-genes (Table 1) were used as positive controls. Each PCR was also run with a 19

negative control (reaction mixture without template DNA) in order to exclude contamination.

20

To verify the bands of the expected size, one of each presumable positive PCR-product was 21

sent for sequencing (Sequiserve, Vaterstetten, Germany). Sequence similarity was compared 22

using NCBI BLAST database (Basic Local Alignment Search Tool;

23

http://www.ncbi.nlm.nih.gov/).

24

Statistical Analysis:

25

Accepted Manuscript

Statistics were compiled using SPSS 14.0 for Windows, SigmaPlot 9.0 and Microsoft Excel 1

software. Mean MIC, subject to different gene patterns, and gene patterns, subject to 2

antibiotic concentrations in manure, respectively, were analysed by oneway ANOVA.

3 4

Results:

5

Resistance testing and PCR results:

6

A total of 179 E. faecalis, isolated from 179 different manure samples, were taken for genetic 7

analysis. Of these, 147 E. faecalis were phenotypically resistant (MIC > 4 mg/l), and 32 were 8

susceptible to doxycycline (MIC ≤ 1). Of 147 examined doxycycline resistant E. faecalis, 127 9

(86 %) carried the tet(M) gene, 94 strains (64 %) tet(L), 11 strains (7 %) tet(S), and 7 strains 10

(5 %) tet(O), respectively. Hereof, an intersection of 87 strains contained both tet(M) and 11

tet(L); 40 carried only tet(M), and 7 carried just tet(L), some of them in combination with 12

tet(S) or tet(O). Of 7 doxycycline resistant isolates 5 had tet(S), and 2 had tet(O) as a single 13

gene. In the remaining 6 resistant strains, no tet-gene was detectable, even if the search was 14

extended to tet(A), tet(B), tet(C), tet(D), tet(K), tet(W), and tet(Z). The different gene patterns 15

are shown in Table 2. When investigating the 32 doxycycline susceptible strains, only two 16

isolates were carriers of the investigated tet-genes. One strain carried both tet(M) and tet(L), 17

and one strain carried tet(S). The relevant TET concentrations in the manure sample were 18

below detectable limits and 0.51 mg/kg, respectively.

19

Sequence analysis of one of each detected tet-gene confirmed the PCR results.

20

Relationship between TET concentrations in manure and resistance properties of E. faecalis:

21

TET concentrations of manure samples where doxycycline susceptible E. faecalis were 22

isolated ranged from < 0.1 mg/kg up to 6.3 mg/kg (mean value: 1.94 mg/kg; median: <

23

0.1 mg/kg). When resistant E. faecalis were isolated, TET concentrations ranged from < 0.1 24

mg/kg up to 46.1 mg/kg (mean value: 2.7 mg/kg; median: 0.5 mg/kg). A Spearman Rank

25

Accepted Manuscript

Order Correlation showed a statistically significant positive correlation between TET 1

concentrations and MIC values (r

= 0.397; P < 0.001).

2

Findings of E. faecalis that carried both tet(M) and tet(L) were statistically significant more 3

frequent if the manure was highly contaminated with tetracycline (mean TET value: 4.08 4

mg/kg). From manure samples with lower antibiotic concentrations or concentrations < LOD 5

(< 0.1 mg/kg), in most isolated strains neither tet(M) nor tet(L), or only one tet-gene was 6

detected (Figure 1 and Table 3). To be precise, TET concentrations averaged 0.35 mg/kg if no 7

tet-gene was detected; if tet(M) was the only resistance determinant, mean TET 8

concentrations of 0.51 mg/kg were observed, and if only tet(L) was detected, the mean TET 9

concentration in the respective manure samples was 1.18 mg/kg. No correlation between TET 10

concentrations and other detected tet-genes [tet(O), tet(S)] could be ascertained.

11

Most of the E. faecalis carrying any tet-gene were isolated from antibiotic containing 12

environment (n = 103 out of 143; 72 %). In contrast, most of the strains without any detected 13

tet-gene were from manure samples where no TET residues could be measured (n = 24 out of 14

44; 61 %). Dividing the TET findings into low (< 0.1 mg/kg – 1.0 mg/kg), intermediate (> 1.0 15

– 4.0 mg/kg) and high (> 4.0 mg/kg) concentrations (according to the DIN tetracycline 16

breakpoint concentrations in medium), it became evident that 32 % of the strains carrying 17

both tet(M) and tet(L) were isolated from manure samples containing high tetracycline 18

concentrations (n = 28 out of 88). Only one E. faecalis that carried none of the investigated 19

tet-genes was isolated from manure with high TET concentrations (6.26 mg/kg; Table 3).

20

Except for one strain, all isolates showed MICs > 8 mg/l when tet(M) and tet(L) co-occurred.

21

By contrast, mean MIC values were 3.7 mg/l when tet(M) and tet(L) were not detected. Mean 22

MICs of isolates containing tet(M) and tet(L) together were significantly higher than those of 23

isolates carrying only tet(M). In particular, tet(M) alone led to mean MIC of 13.4 mg/l, and 24

tet(M) and tet(L) together resulted in mean values of 16.6 mg/l (Table 4).

25

26

Accepted Manuscript

Discussion:

1

From Figure 1, as well as from Table 3, it becomes clearly evident that antibiotic exposure in 2

manure selects for the carriage of resistance genes. The objection might be made that the 3

selective process occurs already in the animal’s intestine. In fact, after the application of 4

tetracyclines, these substances (and their metabolites), as well as tetracycline resistant 5

bacteria, are shed by the pigs. However, the resistant bacteria, which are in competition with 6

the present sensitive bacterial community, proliferate in manure. Therefore, the actual TET 7

concentration in the manure selects for the maintenance of resistant bacteria. Several studies 8

have shown that resistant genotypes are less fit than their sensitive counterparts in the absence 9

of antibiotics (Lenski, 1997). As a consequence, acquisition of resistance genes in an 10

antibiotic-free environment might be not only unnecessary, but also detrimental to a 11

bacterium - accordingly, the loss of a resistance gene could be beneficial. Thus, tetracycline 12

containing manure helps to select and maintain a tetracycline resistant population of E.

13

faecalis, as the possession of a resistance gene undoubtedly benefits a bacterium when the 14

corresponding antibiotic is present.

15

As anticipated, most of the strains had higher MICs than the TET concentration in the 16

respective manure. However, one E. faecalis with MIC 16 mg/l was isolated from a manure 17

sample with a determined TET concentration of 46.1 mg/kg. This may be explained by the 18

fact that tetracyclines only have a bacteriostatic effect (Rosin, 1992). Consequently, inhibited, 19

but surviving microorganisms can proliferate again, if transformed into antibiotic-free 20

medium. Above that, it should be considered that doxycycline has a higher in vitro activity 21

than tetracycline (Bousquet et al., 1997). Additionally, it must not be ignored that matrix 22

effects that are consistently present in manure samples could weaken the antibiotic activity.

23

The fact that - with one exception - all E. faecalis isolated from high contaminated manure 24

samples carried both tet(M) and tet(L) (Table 3) confirm that tetracycline exposure selects for 25

the preservation of resistance genes. So, phenotypic resistance effects, as also shown by

26

Accepted Manuscript

Phillips et al. (2004), are presumptively not only based on up and down regulation 1

mechanisms, but also – at least in some cases – due to the loss or acquisition of resistance 2

genes.

3

Huys et al. (2004) already assumed that co-occurrence of both efflux (encoded by tet(L)) and 4

ribosomal protection protein mechanisms (encoded by tet(M)) in one microorganism leads to 5

higher resistance levels. This assumption was based only on six isolates, but it is in 6

concurrence with our findings, considering the gene patterns related to the respective MIC:

7

mean MIC values were low if tet(M) and tet(L) were not detected, medium high if the strains 8

contained only tet(M), but significantly higher if tet(M) and tet(L) co-occurred (Table 4). One 9

could argue that this is not surprising, because of course the susceptible isolates have no 10

resistance genes and therefore reduce the average. However, this trend remained constant by 11

the exclusive analysis of the phenotypically doxycycline resistant isolates (n = 147): absence 12

of tet(M) and tet(L) led to mean MIC of 11.7 mg/l, tet(M) to 13.4 mg/l, and tet(M) together 13

with tet(L) to 16.7 mg/l, which is also significantly higher (data not shown).

14

Above that, it should not be forgotten that E. faecalis may also be carrier of additional tet- 15

genes, for example tet(S) and tet(O), as shown in the present study. However, there was no 16

correlation demonstrated between the occurrence of these genes and the respective MIC 17

values.

18

One strain contained tet(S), and one strain carried tet(M) and tet(L), but both were susceptible 19

to doxycycline (MIC = 0.25 and 0.5 mg/l; Table 4). Up till now, such cases are rarely reported 20

(Lanz et al., 2003), but probably only because scientific studies mainly focus on resistant 21

phenotypes if the corresponding genotype is determined. A possible reason for the 22

discrepancy between phenotype and genotype could be that mutations led to a loss of gene 23

functionality.

24

Conclusion:

25

Accepted Manuscript

This study reveals the coherences between tetracycline exposure in different concentrations, 1

and the resulting resistance on phenotypic and genetic level: It could be demonstrated that 2

tetracycline exposure leads to microorganisms with higher MIC. Resistance levels depend on 3

genetic determinants; the highest MIC is present if E. faecalis strains carry both tet(M) 4

(ribosomal protection determinant) and tet(L) (encodes for efflux proteins). Higher antibiotic 5

concentrations often lead to populations with two resistance determinants, but also 6

concentrations below the breakpoint select for persistence of tetracycline resistance genes 7

within the manure microflora population.

8 9

Acknowledgements:

10

This work was supported by the Bavarian State Ministry of the Environment, Public Health 11

and Consumer Protection and by the Bavarian State Ministry of Agriculture and Forestry. We 12

are grateful to V. Perreten, Institute of Veterinary Bacteriology, University of Berne, and to 13

Y. Agersø, Danish Veterinary Institute, for kindly providing the reference strains.

14 15

References:

16

Aminov, R. I., Chee-Sandford, J., Garrigues, C., Teferedegne, N. B., Krapac, I. J., White, B.

17

A., Macki, R. I., 2002. Development, validation, and application of PCR primers for detection 18

of tetracycline efflux genes of gramnegative bacteria. Appl and Environ Microbiol. 68, 1786- 19

93.

20

Aarestrup, F.M., Agerso, Y., Gerner-Smidt, P., Madsen, M., Jensen, L.B., 2000. Comparison 21

of antimicrobial resistance phenotypes and resistance genes in Enterococcus faecalis and 22

Enterococcus faecium from humans in the community, broilers, and pigs in Denmark. Diagn 23

Microbiol Infect Dis. 37, 127-37.

24

Accepted Manuscript

Agerso, Y., Sengelov, G., Jensen, L.B., 2004. Development of a rapid method for direct 1

detection of tet(M) genes in soil from Danish farmland. Environ Int. 30, 117-22.

2

Bejuk, D., Begovac, J., Gamberger, D., Kucisec-Tepes, N., 2000. Evaluation of phenotypic 3

characteristics for differentiation of enterococcal species using an example based algorithm.

4

Diagn Microbiol Infect Dis. 38, 201-5.

5

Bousquet, E., Morvan H., Aitken, I., Morgan, J.H., 1997. Comparative in vitro activity of 6

doxycycline and oxytetracycline against porcine respiratory pathogens. Vet Rec. 141, 37-40.

7

Blake, D..P, Humphry, R.W., Scott, K.P., Hillman, K., Fenlon, D.R., Low, J.C., 2003.

8

Influence of tetracycline exposure on tetracycline resistance and the carriage of tetracycline 9

resistance genes within commensal Escherichia coli populations. J Appl Microbiol. 94, 1087- 10

97.

11

Chopra, I., Roberts, M., 2001. Tetracycline antibiotics: mode of action, applications, 12

molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 65, 13

232-60.

14

DIN-58940-81, 2002. Medical microbiology - Susceptibility testing of microbial pathogens to 15

antimicrobial agents - Part 81: Microdilution; Special requirements for testing of non- 16

fastidious bacteria. Beuth-Verlag (publisher), Berlin.

17

DIN 58940-4 Supplement 1, 2004. Medical microbiology - Susceptibility testing of pathogens 18

to antimicrobial agents - Part 4: Evaluation classes of the minimum inhibitory concentration - 19

MIC-breakpoints of antibacterial agents. Beuth-Verlag (publisher), Berlin.

20

FEDESA, 1998. Verbrauch von Antibiotika. Deutsches Tierärzteblatt 11, 1093.

21

EG 1831/2003: Verordnung (EG) Nr. 1831/2003 des Europäischen Parlaments und des Rates 22

vom 22. September 2003 über Zusatzstoffe zur Verwendung in der Tierernährung. Amtsblatt 23

der Europäischen Union, L268/29.

24

Accepted Manuscript

GERMAP, 2008. Antibiotika-Resistenz und –Verbrauch. Bericht über den 1

Antibiotikaverbrauch und die Verbreitung von Antibiotikaresitenzen in der Human- und 2

Veterinärmedizin in Deutschland. Bundesamt für Verbraucherschutz und 3

Lebensmittelsicherheit; Paul-Ehrlich-Gesellschaft für Chemotherapie e.V.; Infektiologie 4

Freiburg, 1- 149.

5

Harms, K., 2006. Untersuchungen zum Nachweis und Vorkommen von Antibiotika und deren 6

Metaboliten in Schweinegülle. Dissertation; Fakultät Wissenschaftszentrum Weihenstephan 7

für Ernährung, Landnutzung und Umwelt, Technische Universität München.

8

Hölzel, C.S., Bauer, J., 2008. Salmonella spp. in Bavarian Liquid Pig Manure: Occurrence 9

and Relevance for the Distribution of Antibiotic Resistance. Zoonoses Public Health. 55, 133- 10

138.

11

Huys, G., D'Haene, K., Collard., J.M., Swings, J., 2004. Prevalence and molecular 12

characterization of tetracycline resistance in Enterococcus isolates from food. Appl Environ 13

Microbiol. 70, 1555-62.

14

Lanz, R., Kuhnert, P., Boerlin, P., 2003. Antimicrobial resistance and resistance gene 15

determinants in clinical Escherichia coli from different animal species in Switzerland. Vet 16

Microbiol. 2. 91, 73-84.

17

Lenski, R. E., 1997. The cost of antibiotic resistance--from the perspective of a bacterium.

18

Ciba Found Symp 207, 131-40; discussion 141-51.

19

Macovei, L., Zurek, L., 2006. Ecology of antibiotic resistance genes:

20

characterization of enterococci from houseflies collected in food settings. Appl Environ 21

Microbiol. 72, 4688-94.

22

Maynard, C., Bekal, S., Sanschagrin, F., Levesque, R. C., Brousseau, R., Masson, L., 23

Larivière, S., Harel, J., 2004. Heterogeneity among virulence and antimicrobial resistance

24

Accepted Manuscript

gene profiles of extraintestinal Escherichia coli isolates of animal and human origin. J Clin 1

Microbiol. 42, 5444-52.

2

Ng, L. K., Martin, I., Alfa, M., Mulvey, M., 2001. Multiplex PCR for the detection of 3

tetracycline resistant genes. Mol Cell Probes. 15, 209-15.

4

OIE, 2001: Office International des Épizooties. OIE guidelines. 2nd OIE International 5

Conference on Antimicrobial Resistance. Use of antimicrobials and protection of public 6

health. 2001. http://www.anmv.afssa.fr/oiecc/conference/guidelines.htm.

7

Phillips, I., Casewell, M., Cox, T., De Groot, B., Friis, C., Jones, R., Nightingale, C., Preston, 8

R., Waddell, J., 2004. Does the use of antibiotics in food animals pose a risk to human health?

9

A critical review of published data. J Antimicrob Chemother. 53, 28-52.

10

Rosin, H., 1992. Antibiotika und Chemotherapeutika Antiinfektiöse Therapie. In: Allgemeine 11

und spezielle Pharmakologie und Toxikologie, 6th ed. Forth, W.; Henschler, D.; Rummel, W.;

12

Starke, K. (ed.). B. I. Wissenschaftsverlag Mannheim/Leipzig/Wien/Zürich.

13

Schwaiger, K., Schmied, E.M., Bauer, J., 2008. Comparative analysis of antibiotic resistance 14

characteristics of Gram-negative bacteria isolated from laying hens and eggs in conventional 15

and organic keeping systems in Bavaria, Germany. Zoonoses Public Health. 55, 331-41.

16

Sczesny, S., Nau, H., Hamscher, G., 2003. Residue analysis of tetracyclines and their 17

metabolites in eggs and in the environment by HPLC coupled with a microbiological assay 18

and tandem mass spectrometry. J Agric Food Chem. 51, 697-703.

19

Sukul, P., Lamshöft, M., Kusari, S., Zühlke, S., Spiteller, M., 2009. Metabolism and excretion 20

kinetics of 14C-labeled and non-labeled difloxacin in pigs after oral administration, and 21

antimicrobial activity of manure containing difloxacin and its metabolites. Environ Res. 109, 22

225-31.

23

Accepted Manuscript

Trzcinski, K., Cooper, B.S., Hryniewicz, W., Dowson, C.G., 2000. Expression of resistance to 1

tetracyclines in strains of methicillin-resistant Staphylococcus aureus. J Antimicrob 2

Chemother. 45, 763-70.

3

Villedieu, A., Diaz-Torres, M. L., Hunt, N., McNab, R., Spratt, D. A., Wilson, M., Mullany, 4

P., 2003. Prevalence of tetracycline resistance genes in oral bacteria. Antimicrob Agents 5

Chemother. 47, 878-82.

6

WHO, 1997. The Medical Impact of Antimicrobial Use in Food Animals. Report of a WHO 7

Meeting, Berlin, Germany, 13 – 17 October 1997. WHO/EMC/ZOO/97.4. WHO, Geneva.

8 9

Tables:

10

Table 1: Primers used for PCR 11

Table 2: Detected tet-gene patterns in phenotypically tetracycline resistant

E. faecalis 12

(n = 147) 13

Table 3: Occurrence of tet(M) and tet(L) in E. faecalis depending on the TET concentration in 14

manure 15

Table 4: Influence of the occurrence of the tetracycline resistance genes tet(M) and tet(L) to 16

minimum inhibitory concentrations (MICs) in E. faecalis 17

Figure Caption:

18

Figure 1: Influence of tetracycline concentrations in manure on the occurrence of the 19

resistance genes tet(M) and tet(L) in E. faecalis

20

Accepted Manuscript

1

Tables

Table 1: Primers used for PCR

Resistance

gene Primer Sequence (5’ – 3’) Primer

Volume (µl) Amplicon

size (bp) Annealing

temp. (°C) Reference Reference strains:

Species and source tet(M) FW

tet(M) RV AGTTTTAGCTCATGTTGATG

TCCGACTATTTAGACGACGG 0,5 1862 55 Trzcinski et

al., 2000 Bacillus cereusR89 ; Y. Agersø, Denmark tet(L) FW

tet(L) RV CCTGCGAGTACAAACTGG

TCAAGGTAACCAGCCAAC 0,2 1209 52 Perreten,

pers. comm. Bacillussp. VPC1214; V. Perreten, Institute of Veterinary Bacteriology, University of Berne

tet(O) FW

tet(O) RV AACTTAGGCATTCTGGCTCAC

TCCCACTGTTCCATATCGTCA 0,5 515 52 Ng et al.,

2001 Enterococcus3952; Y. Agersø, Denmark tet(S) FW

tet(S) RV

ATGTTTTTGGAACGCCAGAG

CATAGACAAGCGTTGACC 0,5 667 54 Villedieu et

al., 2003 E. coliJM 83/pAT451; C. Courvalin, Institut Pasteur tet(A) FW

tet(A) RV GTGAAACCCAACATACCCC

GAAGGCAAGCAGGATGTAG 0,3 888 55 Maynard et

al., 2003 Salmonella[4,5,12:i:-]; B. Marlorny; Bundesinstitut für Risikobewertung (BfR)

tet(B) FW

tet(B) RV CCTTATCATGCCAGTCTTGC

ACTGCCGTTTTTTCGCC 0,3 774 52 Maynard et

al., 2003 E. coli 2628; German Collection of Microorganisms and Cell Cultures (DSMZ)

tet(C) FW

tet(C) RV CTTGAGAGCCTTCAACCCAG

ATGGTCGTCATCTACCTGCC 0,8 418 52 Ng et al.,

2001 SalmonellaTyphimurium DT 12; Marlorny; BfR tet(D) FW

tet(D) RV

TGGGCAGATGGTCAGATAAG

CAGCACACCCTGTAGTTTTC 0,25 827 55 Maynard et

al., 2003 E. coliEC227; Marlorny; BfR tet(K) FW

tet(K) RV TCGATAGGAACAGCAGTA

CAGCAGATCCTACTCCTT 0,5 169 54 Macovei et

al., 2006 Staphylococcus lentus CW29; C. Werckenthin, LMU München, Lehrstuhl für Hygiene und Technologie der Milch tet(W) FW

tet(W) RV GAGAGCCTGCTATATGCCAGC

GGGCGTATCCACAATGTTAAC 0,5 168 54 Macovei et

al., 2006 Arcanobacterium pyogenes; C. Werckenthin; LMU München tet(Z) FW

tet(Z) RV

CCTTCTCGACCAGGTCGG

ACCCACAGCGTGTCCGTC 0,5 204 54 Aminov et

al., 2002 E. coli pAGHD1; C. Werckenthin; LMU München

Accepted Manuscript

Table 2: Detected tet-gene patterns in phenotypically tetracycline resistant

E. faecalis (n = 147)

Detected tet-gene Determinant(s) n Isolates

tet(M) 39

tet(L) 6

tet(L), tet(M) 81

tet(L), tet(M), tet(O) 2

tet(L), tet(M), tet(S) 1

tet(L), tet(S) 1

tet(M), tet(S) 1

tet(L), tet(M), tet(O), tet(S) 3

tet(O) 2

tet(S) 5

no tet-gene detectable

6

1)In tetracycline susceptibleE. faecalis(n = 32), 1 isolate was a carrier of bothtet(L) andtet(M), and 1 isolate carried tet(S).

2)tet(A),tet(B), tet(C), tet(D),tet(K), tet(W), tet(Z) were additionally tested, but not detected.

Accepted Manuscript

Table 3: Occurrence of tet(M) and tet(L) in E. faecalis depending on the TET concentration in manure No tet(M),

no tet(L) (n = 44)

tet(M) (n = 40)

tet(L) (n = 7)

tet(M) and tet(L) (n = 88)

TET in manure (mg/kg) n isolates (%) [mean MIC (mg/l)]

< 0.1 27

(42.2) [3.8] 19 (29.7) [13.1] 3 (4.7) [13.3] 15 (23.4) [16.0]

0.1 – 1.0 13

(24.5) [3.9] 13 (24.5) [12.9] - 27

(50.9) [16.0]

> 1.0 – 4.0 3

(9.1) [2.9] 8

(24.2) [15.0] 4

(12.1) [16.0] 18 (54.5) [16.0]

> 4.0 1 (3.4) [0.3] - - 28

(96.6) [17.7]

1) - 7): Additionally detected tet-genes in n isolates: ¹⁾ 3 x tet(S);²⁾2 x tet(O), 2 x tet(S); ³⁾1 xtet(S); ⁴⁾1 xtet(S);⁵⁾1 xtet(S);⁶⁾1 xtet(S), 3 xtet(O)/tet(S); ⁷⁾2 x tet(O)

Accepted Manuscript

Table 4: Influence of the occurrence of the tetracycline resistance genes tet(M) and tet(L) to minimum inhibitory concentrations (MICs) in E. faecalis

No tet(M), no tet(L)

(n = 44)

tet(M) (n = 40)

tet(L) (n = 7)

tet(M) and tet(L) (n = 88)

MIC (mg/l) n isolates (%)

0.25 25 (100.0)

0 0 0

0.5 5 (83.3) 0 0 1 (16.7)

1 1 (100.0) 0 0 0

8 9 (33.3)

17 (63.0)

1 (3.7) 0

16 3 (2.7) 21 (18.6) 6 (5.3)

83 (73.5)

32 1 (14.3) 2 (28.6) 0 4 (57.1)

Average MIC values (mg/l)

Mean 3.68

13.40

14.86

16.55

Median 0.25 16 16 16

Standard deviation 6.43 5.84 3.02 3.77

1) - 6): Additionally detected tet-genes in n isolates: ¹⁾ 1 x tet(S);²⁾5 x tet(S), 2 x tet(O); ³⁾1 xtet(S); ⁴⁾1 xtet(S);

5)1 xtet(S), 3 x tet(O)/tet(S);⁶⁾2 xtet(O)

a,b,c: Differences of mean MICs are significant in oneway ANOVA (p≤0.02)

Accepted Manuscript

Figure 1: Influence of tetracycline (TET) concentrations in manure on the occurrence of the resistance genes tet(M) and tet(L) in E. faecalis

46,12 mg/kg

50 % of the values extreme values (each outlier)

*Groups significantly different by oneway ANOVA (p = 0.02)

Median no tet(M),

no tet(L)

tet(M)* tet(L) tet(M) and tet(L)*

TET-concentrationsin liquid pigmanure(mg/kg)

0 5 10 15 20 25

46,12 mg/kg

50 % of the values extreme values (each outlier)

*Groups significantly different by oneway ANOVA (p = 0.02)

Median no tet(M),

no tet(L)

tet(M)* tet(L) tet(M) and tet(L)*

TET-concentrationsin liquid pigmanure(mg/kg)

0 5 10 15 20 25