• Aucun résultat trouvé

Répartition spatiale de la rainette faux-grillon boréale (Pseudacris maculata) en milieu urbain évaluée à l’aide de l’ADN environnemental

N/A
N/A
Protected

Academic year: 2021

Partager "Répartition spatiale de la rainette faux-grillon boréale (Pseudacris maculata) en milieu urbain évaluée à l’aide de l’ADN environnemental"

Copied!
90
0
0

Texte intégral

(1)

Répartition spatiale de la rainette faux-grillon boréale

(Pseudacris maculata) en milieu urbain évaluée à l’aide

de l’ADN environnemental

Mémoire

Marie-Pier Dubois-Gagnon

Maîtrise en sciences forestières - avec mémoire

Maître ès sciences (M. Sc.)

(2)

Répartition spatiale de la rainette faux-grillon boréale

(Pseudacris maculata) en milieu urbain évaluée à l’aide

de l’ADN environnemental

Mémoire

Marie-Pier Dubois-Gagnon

Sous la direction de :

Marc J. Mazerolle, directeur de recherche

(3)

Résumé

Les taux d’extinction actuels des vertébrés sont de 100 à 1000 fois plus élevés que les taux antérieurs. Les amphibiens constituent le groupe de vertébrés le plus menacé avec environ 41% des espèces en péril. La rainette faux-grillon boréale (Pseudacris maculata) est particulièrement à risque d’extinction dans les provinces du Québec et de l’Ontario, au Canada. Afin de mieux comprendre la répartition de l’espèce, nous avons quantifié l’influence de plusieurs caractéristiques locales et du paysage sur l’occurrence de l’espèce dans les milieux humides des basses-terres du Saint-Laurent dans le sud du Québec. Nous avons émis l’hypothèse que l’occupation de site dépend des caractéristiques locales et est favorisée par les caractéristiques du paysage qui contribuent à la connectivité du site. Nous avons aussi émis l’hypothèse que la quantité et la proximité des perturbations anthropiques affectent négativement l’occurrence de l’espèce. Nous avons utilisé l’ADN environnemental (ADNe) ainsi que des relevés auditifs traditionnels pour déterminer l’occupation de site et pour tester si la première approche mène à une probabilité de détection plus élevée que la seconde. Nous avons collecté des échantillons d’eau à 180 sites en 2017 et 2018, tandis que nous avons inventorié un sous-échantillon de 63 sites en utilisant l’ADNe et les relevés auditifs en 2018. Nos analyses indiquent que l’occupation de site par l’espèce était plus élevée en 2018 qu’en 2017 et également plus élevée dans les sites où l’espèce avait été détectée par d'autres études durant les 12 dernières années. L’occupation de site ne varie pas avec les autres caractéristiques locales et du paysage, en partie en raison d’une diminution du nombre de sites occupés par l’espèce et de sa rareté dans notre aire d’étude. De plus, la probabilité de détection via l’ADNe (0.81; IC 95%: [0.31; 0.98]) était similaire à celle des relevés auditifs (0.62; IC 95%: [0.25; 0.89]).

Mots clés : ADN environnemental; amphibien; modèle d’occupation; paysage; probabilité de

(4)

Abstract

Current extinction rates of vertebrates are 100–1000 times greater than background rates. Amphibians comprise the most threatened vertebrate group with approximately 41% of the species at risk. The boreal chorus frog (Pseudacris maculata) is particularly at risk of extinction in the provinces of Québec and Ontario, Canada. In order to have a better understanding of the species distribution, we quantified the influence of several local and landscape characteristics on the occurrence of the species in wetlands of the St. Lawrence Lowlands in southern Québec. We hypothesized that site occupancy depends on local characteristics and is favored by landscape characteristics that contribute to site connectivity. We also hypothesized that the amount and proximity of anthropic disturbances negatively affect the occurrence of the species. We used environmental DNA (eDNA) as well as traditional call surveys to determine site occupancy and to test whether the former approach led to a higher detection probability than the latter. We collected water samples at 180 sites in 2017 and 2018, whereas we surveyed a subset of 63 sites using both eDNA and call surveys in 2018. Our analyses indicate that site occupancy was higher in 2018 than in 2017 and higher in sites where the species had been previously detected during the last 12 years by other studies. Site occupancy did not vary with other local and landscape characteristics, in part due to a decrease in the number of sites occupied by the species and its rarity in our study area. Additionally, detection probability via eDNA (0.81; 95% CI: [0.31; 0.98]) was similar to that of call surveys (0.62; 95% CI: [0.25; 0.89]).

Key words: Amphibian; detection probability; environmental DNA; landscape; occupancy model; Pseudacris maculata; urbanization

(5)

Table des matières

Résumé... ii

Abstract ... iii

Table des matières... iv

Liste des figures ... vi

Liste des tableaux ... vii

Liste des annexes ... viii

Remerciements ... ix

Avant-propos ... xi

Introduction ... 1

Distribution spatiale des organismes ... 2

Écologie et déclin des amphibiens ... 3

Effet des caractéristiques locales ... 3

Effet des caractéristiques du paysage ... 5

Espèce à l’étude : la rainette faux-grillon boréale ... 6

Méthodes d’échantillonnage ... 7

Détection imparfaite ... 8

Objectifs et hypothèses... 9

Chapitre 1 Spatial distribution of the boreal chorus frog (Pseudacris maculata) in an urban environment using environmental DNA ... 11

Résumé ... 12

Abstract ... 13

Introduction ... 14

Methods ... 17

Study area and site selection ... 17

Environmental DNA sampling ... 19

Call surveys ... 24

Local characteristics ... 25

Landscape characteristics ... 26

Statistical analyses ... 26

Historical presence vs unknown historical presence ... 26

Single-season occupancy models ... 27

Effect of local and landscape characteristics ... 28

Sampling with environmental DNA vs call surveys ... 31

(6)

Historical presence vs unknown historical presence ... 34

Effect of local and landscape characteristics ... 37

Sampling with environmental DNA vs call surveys ... 40

Discussion ... 42

Local characteristics ... 43

Landscape characteristics ... 43

Sampling with environmental DNA vs call surveys ... 44

Conclusion ... 45 Acknowledgements ... 46 Conflict of interest ... 46 Author contributions ... 46 References ... 47 Appendix ... 58 Conclusion ... 65 Bibliographie ... 68

(7)

Liste des figures

Figure1. The 180 sites sampled to study the distribution of the boreal chorus frog (Pseudacris

maculata) in southeastern Québec, Canada. Triangles and pentagons denote the 90 sites with and

without historical information on the species presence, respectively. Sites sampled in 2017 are shown in black, whereas those sampled in 2018 are in grey. Grey lines show the six rectangular sections of 15 km x 25 km used to stratify the site selection. ... 19

Figure 2. Variability of environmental characteristics at 90 sites with information on historical

presence of the boreal chorus frog (Pseudacris maculata) and 90 sites without such information in southeastern Québec, Canada. Means of all variables presented differed significantly between sites with information on historical presence of the species and sites without such information (t178 > -3.72

, P < 0.0003). ... 35

Figure 3. Variability of landscape characteristics at 90 sites with information on historical presence of

the boreal chorus frog (Pseudacris maculata) and 90 sites without such information in southeastern Québec, Canada. Means differed significantly between sites with information on historical presence of the species and sites without such information (t178 > 3.42, P < 0.0008). ... 36

Figure 4. Model-averaged estimates of the probability of occupancy of the boreal chorus frog

(Pseudacris maculata) varying with year. Error bars denote 95 % unconditional confidence intervals. ... 39

Figure 5. Model-averaged estimates of the probability of occupancy of the boreal chorus frog

(Pseudacris maculata) for sites with historical presence of the species 2004–2016 and sites without such information on the species. Error bars denote 95 % unconditional confidence intervals. ... 39

(8)

Liste des tableaux

Table1. Primers and probe sequences designed to amplify the boreal chorus frog (Pseudacris

maculata) DNA and their mismatches (i.e. in bold) with the DNA sequences of other amphibian

species in Québec. ... 22

Table 2. Scenarios on occupancy of single-season occupancy models determining the influence of local and landscape characteristics on the probability of occupancy of the boreal chorus frog (Pseudacris maculata) at 180 sites sampled using eDNA in 2017 or 2018 in southeastern Québec, Canada. ... 29

Table 3. Scenarios on detection probability of single-season occupancy models determining the

influence of local and landscape characteristics on the probability of occupancy of the boreal chorus frog (Pseudacris maculata) at 180 sites sampled using eDNA in 2017 or 2018 in southeastern Québec, Canada. ... 30

Table 4. Scenarios of single-season occupancy models determining the detection probability of the

boreal chorus frog (Pseudacris maculata) at 63 sites sampled in 2018 in southeastern Québec, Canada, using both eDNA and call surveys. All models used the best supported scenario of

occupancy based on the analysis of the entire data set from Table 2. ... 32

Table 5. Model selection among 27 single-season occupancy models assessing the probability of

occurrence of boreal chorus frogs (Pseudacris maculata) based on eDNA at 180 sites sampled in 2017 or 2018 in southeastern Québec, Canada. Models were ranked based on quasi-likelihood Akaike information criteria for small samples (QAICc) because there was moderate overdispersion in

the data (c-hat = 1.80). Only the first five models are shown for clarity. ... 38

Table 6. Model selection of five single-season occupancy models assessing the probability of occurrence of boreal chorus frogs (Pseudacris maculata) via eDNA and call surveys at 63 sites sampled in 2018 in southeastern Québec, Canada. Models were ranked based on quasi-likelihood Akaike information criteria for small samples (QAICc) because data showed moderate overdispersion

(9)

Liste des annexes

Appendix 1. Mean values ( ±SD) of local, landscape and sampling variables from eDNA surveys of

the boreal chorus frog (Pseudacris maculata) at 180 sites in southeastern Québec, Canada... 58

Appendix 2. Number of samples for each volume of water collected and filtered. ... 60 Appendix 3. Loadings, eigenvalues, and variance explained by each axis of the principal component analysis (PCA) used to summarize vegetation cover at 180 sites in southeastern Québec, Canada. The number of axes retained in subsequent analyses was determined with the broken stick method (Peres-Neto et al., 2005). ... 61

Appendix 4. Twenty-five single-season occupancy models considered to determine the influence of local and landscape variables on the probability of site-occupancy by the boreal chorus frog

(Pseudacris maculata) at 180 sites sampled in 2017-2018 in southeastern Québec, Canada. ... 63

Appendix 5. Five single-season occupancy models considered to determine the influence of

sampling method on the probability of detection of the boreal chorus frog (Pseudacris maculata) at 63 sites sampled using eDNA and call surveys in 2018 in southeastern Québec, Canada. ... 64

(10)

Remerciements

La réalisation de ce projet de maîtrise a été possible grâce aux conseils, au travail et au soutien de plusieurs personnes. Tout d’abord, je remercie Marc J. Mazerolle, le directeur de ce projet de maîtrise, pour m’avoir donné l’opportunité de travailler sur ce projet qui m’a permis d’apprendre énormément de choses, notamment sur les amphibiens. Merci également pour ton encadrement, tes conseils, tes commentaires et ta confiance. C’est également grâce à toi que j’ai appris à apprivoiser les analyses statistiques et à les apprécier davantage!

Je tiens également à remercier Louis Bernatchez, mon codirecteur de maîtrise, d’avoir accepté de t’embarquer dans cette aventure et de m’avoir permis d’explorer le volet de l’ADN environnemental. Merci aussi de tes conseils et commentaires concernant ce domaine qui était tout nouveau pour moi. Je remercie aussi l’équipe de Louis Bernatchez : Éric Normandeau pour le volet de bio-informatique, Charles Babin, Alysse Perrault-Payette, Bérénice Bougas et Cécilia Hernandez de m’avoir donné un énorme coup de main lors des manipulations de laboratoire. Je remercie tout particulièrement Alysse Perrault-Payette, Bérénice Bougas et Cécilia Hernandez qui grâce à nos échanges m’ont permis d’apprendre, à partir de rien, tout ce qu’il y avait à savoir sur le monde de l’ADN environnemental et qui m’ont permis de trouver des solutions à tous les problèmes rencontrés lors des manipulations de laboratoire.

Merci à Yohann Dubois, du Ministère des Forêts, de la Faune et des Parcs (MFFP), et à Marc Bélisle, de l’Université de Sherbrooke (UdeS), d’avoir accepté de réviser ma proposition de recherche ainsi que d’être coauteurs de l’article scientifique découlant de ce mémoire. Merci également à vous deux pour vos idées et vos conseils. Ensuite, je remercie Lyne Bouthillier et Simon Bellefleur, du MFFP, ainsi que Tommy Montpetit et Isabelle Picard, de Ciel et Terre, pour avoir partagé les données des précédents inventaires. Merci au Royal Museum of Ontario de m’avoir fourni du tissu de différentes espèces d’amphibiens et à Nathalie Tessier, du MFFP, pour m’avoir fourni du tissu de la rainette faux-grillon boréale nécessaire aux manipulations de laboratoire. Merci également à Philippe Bournival, du CERFO, de m’avoir fourni les images satellitaires et les données de LiDAR nécessaires à la sélection des sites. De plus, ce projet a été possible grâce à la contribution financière de la Fondation de la faune

(11)

Je tiens également à remercier Morgane Labadie pour la sélection des sites en 2017. Un énorme merci à toute l’équipe qui a participé à l’échantillonnage sur le terrain : Mathilde Lapointe St-Pierre, Ariane Messier et Nicolas Guillaumin. Merci de votre patience, votre méticulosité et votre rigueur lors de l’échantillonnage par ADN environnemental. Je vous remercie également pour votre bonne humeur, votre enthousiasme et votre curiosité. C’est grâce à vous que mes étés de terrain m’ont paru passer tellement vite!

Je remercie aussi François-Joseph Lapointe, de l’Université de Montréal et Geneviève Parent, de Pêches et Océans Canada, d’avoir accepté d’évaluer la version initiale de ce mémoire. Votre point de vue extérieur et vos commentaires ont grandement été apprécié.

Finalement, un merci tout particulier à mes amies, Sarah Beauséjour, Raphaëlle Dubois et Sara Gervais, et à ma famille d’avoir été à l’écoute et d’un énorme soutien dans les hauts, mais surtout dans les bas de ce projet de maîtrise. Merci à mes parents pour votre curiosité par rapport à ce projet et de me pousser dans la réalisation de tous mes projets.

« Le succès vient de la curiosité, de la concentration, de la persévérance et de l'autocritique. » -Albert Einstein

(12)

Avant-propos

Ce mémoire comporte trois sections principales : une introduction, un chapitre principal et une conclusion. Le chapitre principal est rédigé en anglais sous forme d’article scientifique. Cet article sera soumis au journal scientifique Environmental DNA après le dépôt de ce mémoire. Je serai l’auteure principale de cet article, Louis Bernatchez, le codirecteur de ce projet de maîtrise, sera le premier coauteur, Yohann Dubois (MFFP) sera le deuxième coauteur, Marc Bélisle (UdeS) sera le troisième coauteur et Marc J. Mazerolle, le directeur de ce projet de maîtrise, sera le dernier coauteur.

(13)

Introduction

Les populations humaines connaissent une croissance exponentielle et on prévoit une augmentation de 2,14 milliards de personnes entre 2018 et 2050 (Bongaarts, 2009; United Nations, 2019). Cette croissance de population humaine est associée au développement urbain et agricole (Clay, 2013; James, 2018). En effet, afin de répondre à la croissance des populations humaines, les zones urbaines ont connu une augmentation d’approximativement 60 000 km2 en 30 ans (James, 2018). Les zones

agricoles se sont également répandues rapidement (c.-à-d. 13 millions d’hectares par année) afin de répondre aux besoins alimentaires des populations croissantes (Clay, 2013). Toutefois, les pratiques agricoles se sont surtout intensifiées avec la croissance de la population (Keck, Sharma, & Feder, 1994). Cette intensification de l’agriculture a mené à l’utilisation de machinerie, de fertilisant et de pesticide ainsi qu’à des cultures annuelles, causant plus de dommages sur l’environnement que l’agriculture extensive (Clay, 2013; Foley et al., 2005; Keck et al., 1994; Naylor, 1996). Le développement agricole et urbain mène à la fragmentation et la destruction des habitats naturels (Clay, 2013; Foley et al., 2005; James, 2018; Lee et al., 2006).

La fragmentation et la destruction d’habitat causent l’extinction locale des populations en les isolant et en réduisant leur taille, les rendant ainsi vulnérables aux évènements stochastiques (Bennett & Saunders, 2010; Fahrig, 2003; Fischer & Lindenmayer, 2007; Verboom & Lankester, 1991). Ces évènements stochastiques sont responsables des variations aléatoires ou environnementales des paramètres démographiques ainsi que de la perte de la diversité génétique et mènent donc à l’extinction locale des populations (Bennett & Saunders, 2010; Ebenhard, 1991; Harrison, 1991). En plus des évènements stochastiques, l’extinction locale des populations peut être causée par l’isolement puisque les probabilités qu’un effet de sauvetage se produise via l’immigration sont très faibles pour les populations isolées (Brown & Kodric-Brown, 1977; Harrison, 1991). La fragmentation et la destruction d’habitat sont donc considérées comme des menaces majeures pour la biodiversité mondiale, impactant 86% des mammifères menacés, 88% des amphibiens menacés et 86% des oiseaux menacés (Baillie et al., 2004; Foley et al., 2005; Sala et al., 2000). Conséquemment, de nombreux scientifiques suggèrent que les activités humaines sont maintenant responsables de la sixième grande extinction de masse, d’autant plus que le taux d’extinction actuel des vertébrés est 100 à 1000 fois plus élevé que les taux naturels antérieurs (Baillie et al., 2004; Barnosky et al., 2011; Ceballos et al., 2015; Wake & Vredenburg, 2008). Il est prévu que les activités humaines telles que

(14)

l’agriculture intensive et l’urbanisation vont augmenter considérablement dans le futur en réponse à la croissance des populations humaines (Clay, 2013; Ray, Mueller, West, & Foley, 2013; Seto, Güneralp, & Hutyra, 2012). Pour réduire les impacts des humains sur les écosystèmes, il devient impératif d’identifier des stratégies de conservation efficaces.

Distribution spatiale des organismes

Les stratégies de conservation reposent sur des informations précises sur la distribution spatiale des espèces (Bank, Sarno, & Franklin, 2003; De Wan et al., 2009; Filipe et al., 2004). Comprendre quels facteurs et comment ils affectent la distribution et l’abondance des espèces permet aux gestionnaires de conservation de prédire l’effet des changements environnementaux sur la présence des espèces, d’identifier les zones clés de conservation et les sites potentiels de réintroduction (De Wan et al., 2009; Eikaas, Kliskey, & Mcintosh, 2005; Filipe et al., 2004; Klar et al., 2008). Cependant, la distribution des espèces est déterminée par des facteurs opérant à plusieurs échelles spatiales (Bauerfeind, Theisen, & Fischer, 2009; Blevins & With, 2011; Montague-Drake, Lindenmayer, & Cunningham, 2009; Reidy, Thompson, Amundson, & O’Donnell, 2016). À l’échelle locale, l’occurrence des espèces est influencée par les facteurs abiotiques et biotiques typiquement associés à la survie des individus et au succès reproducteur, incluant la disponibilité des ressources, la compétition pour ces ressources, les charges parasitaires et le risque de prédation (Bauerfeind et al., 2009; Blevins & With, 2011; Montague-Drake et al., 2009). À l’échelle du paysage, l’occupation de site est souvent affectée par des facteurs reliés au mouvement entre les parcelles de ressources ou les populations locales (Bauerfeind et al., 2009; Boscolo & Metzger, 2011; Dullinger et al., 2011; Pavlacky et al., 2012). Le degré auquel le paysage facilite ou entrave le mouvement entre les parcelles de ressources est défini comme la connectivité fonctionnelle du paysage (Taylor, Fahrig, Henein, & Merriam, 1993). Elle est déterminée, entre autres, par la réponse comportementale des individus à la quantité et à la disposition des habitats dans le paysage (Baguette & Van Dyck, 2007; Bélisle, 2005; Tischendorf & Fahrig, 2000). Cette caractéristique du paysage est jugée importante puisqu’elle devrait affecter la connectivité des populations locales et ainsi le taux d’échange des individus entre ces populations (Acevedo, Fletcher, Tremblay, & Meléndez-Ackerman, 2015; Hanski, 1998, 1999).

(15)

Écologie et déclin des amphibiens

La connectivité du paysage ainsi que les conditions de l’habitat peuvent affecter les organismes ayant des cycles biologiques complexes tels que les amphibiens se reproduisant dans des étangs (Cassel, Vanek, Glowacki, Preuss, & Nielsen, 2019; Knapp, Matthews, Preisler, & Jellison, 2003; Mazerolle, Desrochers, & Rochefort, 2005; Scherer, Muths, & Noon, 2012). Les amphibiens se reproduisant dans des étangs nécessitent à la fois des habitats terrestres et aquatiques, ainsi que la possibilité de se déplacer entre ces habitats : ils ont besoin d’habitats terrestres pour se nourrir, se disperser et hiberner, ainsi que d’habitats aquatiques pour se reproduire et se développer à partir d’embryons (Semlitsch, 2008; Vitt & Caldwell, 2014; Wilbur, 1980). Ces besoins doubles en habitat les rendent particulièrement vulnérables et contribuent indirectement à leur déclin de population à l’échelle mondiale (Alford & Richards, 1999; Stuart et al., 2004). Plusieurs facteurs contribuent au déclin des amphibiens, tels que les changements climatiques, les maladies, les espèces exotiques envahissantes, mais la perte et la fragmentation d’habitat sont probablement les plus importantes (Alford & Richards, 1999; Blaustein & Kiesecker, 2002; Collins, 2010; Cushman, 2006). Les amphibiens sont davantage menacés d’extinction que les oiseaux ou les mammifères, avec 41% des espèces en péril comparé à 14% et 25% des espèces d’oiseaux et de mammifères, respectivement (International Union for Conservation of Nature, 2019; Stuart et al., 2004). La persistance des espèces d’amphibiens est primordiale étant donné qu’ils ont des rôles très importants au sein des écosystèmes. En effet, ils occupent différentes niches écologiques (Duellman & Trueb, 1986; Stebbins & Cohen, 1995), peuvent transférer des nutriments et de l’énergie entre leurs différents habitats (Earl, Luhring, Williams, & Semlitsch, 2011; Gibbons et al., 2006; Regester, Lips, & Whiles, 2006) et sont de très bons bioindicateurs de la santé et de la qualité de l’environnement (Dunson, Wyman, & Corbett, 1992; Guzy et al., 2012). Identifier les caractéristiques d’habitat et du paysage affectant la distribution des amphibiens est donc de la plus haute importance pour assurer leur persistance.

Effet des caractéristiques locales

Étant donné que les premiers stades de vie de la plupart des amphibiens sont exclusivement aquatiques, les conditions environnementales dans les étangs doivent être favorables à leur survie et à leur développement pour qu’un étang puisse être occupé au fil des ans (Werner, Relyea, Yurewicz, Skelly, & Davis, 2009). L’occupation des étangs et le développement larvaire dépendent des conditions

(16)

environnementales telles que le couvert de végétation aquatique et riveraine (Hartel et al., 2007; Mazerolle et al., 2005; Vos & Stumpel, 1995; Welch & MacMahon, 2005), la couverture de la canopée (Schiesari, 2006; Skelly, Freidenburg, & Kiesecker, 2002; Werner & Glennemeier, 1999; Werner et al., 2009) et l’hydropériode de l’étang (Amburgey, Funk, Murphy, & Muths, 2012; Rowe & Dunson, 1995; Snodgrass, Ackerman, Bryan, & Burger, 1999; Zipkin, Grant, & Fagan, 2012). Le couvert de végétation aquatique peut être bénéfique aux premiers stades de vie des amphibiens puisqu’elle peut servir de site de reproduction, de support pour les masses d’œufs et de refuge aux têtards (Baber & Babbitt, 2004; Hartel et al., 2007; Vitt & Caldwell, 2014; Wells, 2007). De plus, la végétation riveraine peut être favorable aux individus métamorphosés puisqu’elle sert de site d’hibernation, de source de nourriture et de refuge (Hamer & McDonnell, 2008). Cependant, certaines plantes, comme le roseau commun (Phragmites australis), s’avèrent nuisibles aux amphibiens. Le roseau commun peut être nuisible aux têtards puisqu’il ralentit leur développement et diminue l’abondance de phytoplancton consommé par ceux-ci (Perez, Mazerolle, & Brisson, 2013). Pour sa part, la couverture de la canopée peut avoir un effet négatif sur l’occupation par les amphibiens puisque les sites ayant une canopée fermée contiennent moins d’oxygène dissous, moins de nutriments de qualité et sont plus froids que les sites ayant une canopée ouverte (Schiesari, 2006; Skelly et al., 2002; Werner & Glennemeier, 1999). Par conséquent, les têtards croissent plus rapidement et ont une survie plus élevée dans les sites ayant une canopée ouverte (Labadie, 2017; Schiesari, 2006; Skelly et al., 2002; Werner & Glennemeier, 1999).

L’hydropériode est une autre caractéristique des étangs affectant la présence des amphibiens via la survie et le développement des têtards. Les têtards doivent atteindre un stade critique de développement et de taille corporelle minimale pour atteindre la métamorphose avant que l’étang ne s’assèche (Semlitsch, 1987; Wilbur & Collins, 1973). Par conséquent, aucune larve n'atteint la métamorphose dans des étangs avec de très courtes hydropériodes (Rowe & Dunson, 1995). D’autre part, les étangs avec des hydropériodes plus longues augmentent les probabilités que les larves atteignent la métamorphose et, conséquemment, le nombre de métamorphes (Cole, Hartman, & North, 2016; Ryan & Winne, 2001; Semlitsch, 1987; Smith, 1983). De plus, l’occupation des étangs peut également être influencée par la structure du paysage parce que les juvéniles après la métamorphose

(17)

ressources saisonnières dans différents habitats (Pilliod, Peterson, & Ritson, 2002; Vitt & Caldwell, 2014). Par conséquent, un étang isolé par la distance ou par une structure paysagère entravant le mouvement peut rester inoccupé malgré des conditions locales favorables à la survie et au développement des larves (Johnson, Johnson, Richards, & Beasley, 2002).

Effet des caractéristiques du paysage

La composition d’habitat et la configuration du paysage déterminent sa perméabilité aux mouvements des amphibiens (Cline & Hunter, 2014, 2016; Cosentino, Schooley, & Phillips, 2011; Knutson, Herner-Thogmartin, Herner-Thogmartin, Kapfer, & Nelson, 2018). Par exemple, les parcelles d’habitat peuvent être favorables aux mouvements parce qu’elles agissent comme des habitats tremplins, qu’elles réduisent la distance de déplacement ou contiennent des ressources (Gibbs, 1993; Saura & Rubio, 2010; Semlitsch & Bodie, 1998). À l’inverse, les surfaces anthropiques, telles que les routes, les zones bâties et les zones de cultures intensives, peuvent être imperméables ou agir comme barrières aux mouvements (Knutson et al., 2018; Rothermel & Semlitsch, 2002; Van Buskirk, 2012). Ces surfaces ouvertes et perturbées peuvent être nuisibles aux mouvements et à la dispersion des amphibiens puisqu’elles entraînent une perte d’eau élevée chez les individus (Mazerolle & Desrochers, 2005; Rothermel & Semlitsch, 2002). Les amphibiens tolèrent mal la déshydratation puisqu’ils doivent maintenir leur épiderme constamment humide pour respirer et ont une tolérance maximale de perte en eau via l’évaporation de 30 à 40% (Stebbins & Cohen, 1995; Thorson, 1955). De plus, dans un environnement sec, les individus peuvent manquer les signaux chimiques des prédateurs, augmentant ainsi les risques de mortalité via la prédation (Rohr & Madison, 2003). Les routes peuvent également entraver les mouvements des amphibiens en causant une mortalité directe par des collisions avec les véhicules, particulièrement sur les routes avec un trafic élevé (Bouchard, Ford, Eigenbrod, & Fahrig, 2009; Fahrig, Pedlar, Pope, Taylor, & Wegner, 1995; Hels & Buchwald, 2001).

Les surfaces anthropiques entourant les étangs peuvent aussi réduire la survie et la présence des amphibiens parce qu’ils augmentent l’exposition à divers polluants dans les habitats aquatiques comme des sels de déglaçage, des métaux et des pesticides (Karraker, Gibbs, & Vonesh, 2008; Lee et al., 2006; Marzluff et al., 2008; Sanzo & Hecnar, 2006). Les amphibiens sont particulièrement sensibles aux polluants puisqu’ils ont une peau vascularisée et très perméable (Stebbins & Cohen, 1995; Vitt & Caldwell, 2014). Les polluants sont nuisibles pour les amphibiens parce qu’ils peuvent

(18)

mener à l’immunosuppression, ralentir le développement des larves, modifier la réponse face aux signaux des prédateurs et réduire la survie (Groner & Relyea, 2011; Karraker et al., 2008; Sievers, Parris, Swearer, & Hale, 2018; Wagner, Reichenbecher, Teichmann, Tappeser, & Lötters, 2013). Les milieux humides à proximité des zones anthropiques peuvent aussi agir comme des trappes écologiques en augmentant la mortalité (Sievers et al., 2018). Les impacts négatifs des zones anthropiques sur la survie, la reproduction et le mouvement des individus sont très préoccupants, en particulier pour les espèces à risque d’extinction.

Espèce à l’étude : la rainette faux-grillon boréale

Un amphibien particulièrement à risque d’extinction au Canada est la rainette faux-grillon boréale (Pseudacris maculata) (Committee on the Status of Endangered Wildlife in Canada [COSEWIC], 2008). En l’espace de 10 ans, le nombre de populations locales a décliné de 37% et 30% au Québec et en Ontario, respectivement (COSEWIC, 2008). Les populations de rainette faux-grillon boréale des régions des Grands Lacs, du fleuve Saint-Laurent et du bouclier canadien sont actuellement considérées comme menacées (COSEWIC, 2008). L’espèce a également subi un déclin dans le nord de l’État de New-York et dans le Parc National de Yellowstone (Gibbs, Whiteleather, & Schueler, 2005; Lemmon, Lemmon, Collins, Lee-Yaw, & Cannatella, 2007; McMenamin, Hadly, & Wright, 2008). L’aire de répartition canadienne de la rainette faux-grillon boréale se situe de la Colombie-Britannique jusqu’au Québec, en passant par les Territoires du Nord-Ouest (Dodd, 2013; Harding & Mifsud, 2017; Lemmon et al., 2007). Au Québec, P. maculata se retrouve majoritairement dans l’extrême sud, en Outaouais et en Montérégie, mais on la retrouve également dans le nord du Québec, à la Baie-James (COSEWIC, 2008; Ouellet, Fortin, & Grimard, 2009). La plus grande menace à la persistance de la rainette faux-grillon au Canada est la destruction ou la modification de ses habitats causés par l’urbanisation et l’intensification des activités agricoles (COSEWIC, 2008).

La rainette faux-grillon boréale est associée à une grande variété d’habitats terrestres, y compris des terres cultivées, des friches, des forêts ainsi que des prairies arbustives et herbeuses (Dodd, 2013; Mushet, Euliss, & Stockwell, 2012; Whiting, 2004). De plus, l’espèce se reproduit généralement dans des petits étangs temporaires peu profonds, mais parfois dans des marais, des tourbières ainsi que

(19)

de l’Ouest (Pseudacris triseriata) physiquement et au niveau de son chant (Dodd, 2013). Par le passé,

P. maculata a d’ailleurs été communément confondue avec P. triseriata au Canada (Lemmon et al.,

2007; Rogic et al., 2015). La rainette faux-grillon boréale aurait une capacité de mouvement limitée étant donné que la plupart des mouvements de l’espèce sont à moins de 200 m du site de reproduction (Dodd, 2013; Whitaker, 1971). Cependant, Spencer (1964) a enregistré une distance de dispersion maximale jusqu’à 685 m. La durée de vie de la rainette faux-grillon boréale au Québec serait majoritairement d’un an, mais certains individus vivraient 2 à 3 ans et l’espèce aurait la capacité de se reproduire l’année suivant sa métamorphose (Dodd, 2013; Smith, 1987; Whiting, 2004). Toutefois, l’étude de Muths et al. (2016), au Colorado, a déterminé que les individus nécessitent 3 ans pour atteindre leur taille de reproduction et survivent entre 5 et 7 ans. La saison de reproduction de P.

maculata dure 2 à 3 semaines, du mois d’avril à la mi-mai, dans le sud du Québec (Desroches &

Rodrigue, 2004; Whiting, 2004). Les têtards se métamorphosent après 55 à 83 jours et ils émergent des étangs à la fin juin ou au début juillet dans le sud du Québec (Smith, 1983; Whiting, 2004). Les adultes mesurent entre 1,9 et 3,8 cm et sont généralement gris, bruns ou beiges (COSEWIC, 2008; Dodd, 2013).

Méthodes d’échantillonnage

La rainette faux-grillon boréale est une espèce cryptique qui peut être très difficile à détecter (COSEWIC, 2008; Dodd, 2013). Plusieurs méthodes d’échantillonnage ont été utilisées afin d’inventorier la rainette faux-grillon. Parmi ces méthodes, on compte les relevés visuels (Gould et al., 2012; Ouellet et al., 2009; Smith, Jones, Randall, & Prescott, 2014) et la capture (Muths et al., 2016; Muths, Scherer, Amburgey, & Corn, 2018; Whiting, 2004). Au Canada, l’espèce a surtout été inventoriée à l’aide de relevés auditifs des mâles chantants (COSEWIC, 2008; Ouellet et al., 2009; Seburn & Gunson, 2011; Smith et al., 2014). Cependant, les relevés auditifs sont associés à plusieurs contraintes. Premièrement, les conditions environnementales doivent être favorables aux chants des mâles et à l’écoute de ceux-ci pour que la probabilité de détection soit élevée (Pellet & Schmidt, 2005; Schmidt, 2005; Smith et al., 2014; Weir, Royle, Nanjappa, & Jung, 2005). Ensuite, la détection de P.

maculata avec les relevés auditifs peut être difficile puisque la rainette devient silencieuse lorsque les

auditeurs approchent (Boal & Andersen, 2003; Dodd, 2013). Finalement, la courte saison de reproduction de la rainette faux-grillon boréale dans le sud du Québec restreint la fenêtre de temps afin de réaliser des relevés auditifs des mâles chantants (Desroches & Rodrigue, 2004; Whiting, 2004).

(20)

Pour surmonter ces différentes contraintes, nous avons réalisé de l’échantillonnage par ADN environnemental (ADNe), en plus des relevés auditifs traditionnels, afin d’évaluer l’occupation des sites. L’échantillonnage basé sur l’ADNe peut détecter l’ADN d’une espèce libéré dans l’environnement par la peau, les gamètes, l’urine, le mucus et les fèces (Ficetola, Manenti, & Taberlet, 2019; Ficetola, Miaud, Pompanon, & Taberlet, 2008; Taberlet, Coissac, Hajibabaei, & Rieseberg, 2012). Diverses espèces d’amphibiens ont déjà été échantillonnées avec l’ADNe (Dejean et al., 2012; Franklin et al., 2019; Goldberg, Strickler, & Fremier, 2018; Pilliod, Goldberg, Arkle, & Waits, 2013), mais pas l’espèce à l’étude. Par ailleurs, la détection des espèces peut être grandement améliorée avec l’ADNe par rapport aux relevés auditifs traditionnels parce que cette dernière méthode cible les mâles chantants, tandis que l’ADNe détecte les individus de n’importe quel sexe ou stade de vie présents dans l’environnement (Dejean et al., 2012; Eiler, Löfgren, Hjerne, Nordén, & Saetre, 2018; Ficetola et al., 2019; Valentini et al., 2016).

Détection imparfaite

Très peu d’animaux sont assez perceptibles pour être détectés à chaque échantillonnage et avec 100% de certitude (Bailey, Simons, & Pollock, 2004; MacKenzie et al., 2002). Plusieurs espèces ne sont souvent pas détectées, même lorsqu’elles sont présentes à un site (MacKenzie, Nichols, Hines, Knutson, & Franklin, 2003; MacKenzie et al., 2002; Mackenzie & Royle, 2005). Cette détection imparfaite est particulièrement problématique lors de l’échantillonnage des amphibiens (Kroll et al., 2008; Muths et al., 2005; Schmidt, 2005). En effet, les amphibiens sont difficiles à détecter parce qu’ils sont souvent cryptiques, actifs à des moments où ils ne sont pas facilement observables et visibles seulement à certains moments de l’année (Mazerolle et al., 2007; Stebbins & Cohen, 1995; Vitt & Caldwell, 2014; Wells, 2007). Il est donc primordial de prendre en considération la détection imparfaite lors d’études sur les amphibiens. Autrement, en considérant la détection comme étant parfaite, les estimations obtenues ainsi que les conclusions qui en découlent sont souvent erronées (MacKenzie et al., 2003; Mackenzie & Royle, 2005; Mazerolle et al., 2005; Schmidt, 2005). Plusieurs méthodes, nécessitant au moins deux occasions d’échantillonnage, ont été développées afin de prendre en compte la détection imparfaite, incluant des méthodes de capture-marquage-recapture, des analyses

(21)

2016), le temps (Bailey et al., 2004; Cassel et al., 2019; Lapointe St-Pierre, 2018; Weir et al., 2005), les conditions environnementales (Cayuela, Lambrey, Vacher, & Miaud, 2015; Schmidt, 2005; Smith et al., 2014; Weir et al., 2005), ainsi que l’effort d’échantillonnage, comme le volume d’eau filtrée à partir duquel extraire l’ADNe (Goldberg et al., 2018; Mächler, Deiner, Spahn, & Altermatt, 2016).

Objectifs et hypothèses

Malgré les sérieuses préoccupations de conservation concernant la rainette faux-grillon boréale, les informations sur la distribution spatiale de l’espèce sont limitées, ce qui rend difficile la mise en œuvre de stratégies de conservation efficaces. Pour combler cette lacune, l’objectif principal de ce projet de maîtrise était de quantifier l’influence de caractéristiques locales et du paysage sur la présence de la rainette faux-grillon boréale dans les milieux humides des basses-terres du Saint-Laurent dans le sud du Québec, tout en prenant en compte de la détection imparfaite. Comme c’est la première fois que l’ADNe est utilisé afin de détecter les rainettes faux-grillon boréale, notre deuxième objectif était de comparer la probabilité de détection de l’ADNe à celle des relevés auditifs traditionnels.

Les hypothèses associées à la présence de la rainette faux-grillon boréale sont les suivantes : • L’occupation est favorisée par certaines caractéristiques locales, telles qu’une hydropériode

longue ainsi qu’une couverture de la canopée faible.

• L’occupation augmente avec les caractéristiques du paysage contribuant à la connectivité du site.

• L’occupation diminue avec la quantité de perturbations anthropiques.

• L’occupation par P. maculata augmente avec la distance aux perturbations anthropiques. Les hypothèses reliées à la détection de la rainette faux-grillon boréale sont les suivantes :

• La détection est plus élevée pour l’ADN environnemental qu’avec les relevés auditifs. • L’effet de la date sur la détection varie selon la méthode d’échantillonnage utilisée. • La détection varie avec l’année d’échantillonnage.

(22)

• La détection varie avec le volume d’eau filtrée lors de l’échantillonnage par ADN environnemental.

(23)

Chapitre 1 Spatial distribution of the boreal chorus

frog (Pseudacris maculata) in an urban

environment using environmental DNA

Marie-Pier Dubois-Gagnon1, Louis Bernatchez2, Marc Bélisle3, Yohann Dubois4, and Marc J.

Mazerolle1

1 Centre d’étude de la forêt, Département des sciences du bois et de la forêt, Université Laval, 2405, rue de la Terasse, Québec, QC, Canada, G1V 0A6.

2 Institut de Biologie Intégrative et des Systèmes, Pavillon Charles-Eugène-Marchand, Université Laval, 1030, avenue de la Médecine, Québec, QC, Canada, G1V 0A6.

3 Centre d’étude de la forêt, Faculté des sciences, Université de Sherbrooke, 2500, boulevard de l’Université, Sherbrooke, QC, Canada, J1K 2R1.

4 Ministère des Forêts, de la Faune et des Parcs, Service de la conservation de la biodiversité et des milieux humides, 880, chemin Sainte-Foy, Québec, QC, Canada, G1S 4X4.

(24)

Résumé

La rainette faux-grillon boréale (Pseudacris maculata) est particulièrement à risque d’extinction au Canada. Dans cette étude, nous avons quantifié l’influence de caractéristiques locales et du paysage sur l’occurrence de cette espèce dans les milieux humides du sud du Québec. Nous avons émis l’hypothèse que l’occupation de site dépend des caractéristiques locales et est favorisée par les caractéristiques du paysage contribuant à la connectivité du site. Nous avons aussi émis l’hypothèse que les perturbations anthropiques affectent négativement l’occurrence de l’espèce. Nous avons utilisé l’ADN environnemental (ADNe) ainsi que les relevés auditifs pour déterminer l’occupation de site et pour tester si la première approche mène à une probabilité de détection plus élevée que la seconde. Nos résultats indiquent que l’occupation de site était plus élevée en 2018 qu’en 2017 et plus élevée dans les sites où l’espèce avait été détectée par d'autres études durant les 12 dernières années. De plus, la probabilité de détection via l’ADNe (0.81; IC 95%: [0.31; 0.98]) ne différait pas de celle des relevés auditifs (0.62; IC 95%: [0.25; 0.89]).

Mots clés : ADN environnemental; amphibien; modèle d’occupation; paysage; probabilité de

(25)

Abstract

The boreal chorus frog (Pseudacris maculata) is particularly at risk of extinction in Canada. In this study, we quantified the influence of local and landscape characteristics on the occurrence of the species in wetlands in southern Québec. We hypothesized that site occupancy depends on local characteristics and is promoted by landscape characteristics contributing to site connectivity. We also hypothesized that anthropic disturbances negatively affect the occurrence of the species. We used environmental DNA (eDNA) as well as traditional call surveys to estimate site occupancy and to test whether the former approach led to a higher detection probability than the latter. We conclude that site occupancy was higher in 2018 than in 2017 and higher in sites where the species had been previously detected during the last 12 years by other studies. Additionally, detection probability via eDNA (0.81; 95% CI: [0.31; 0.98]) did not differ from that of call surveys (0.62; 95% CI: [0.25; 0.89]).

Key words: Amphibian; detection probability; environmental DNA; landscape; occupancy model; Pseudacris maculata; urbanization

(26)

Introduction

Human populations are experiencing exponential growth and are predicted to increase by 2.14 billion people between 2018 and 2050 (Bongaarts, 2009; United Nations, 2019). Human population growth and the associated agricultural and urban development lead to habitat loss and fragmentation (Clay, 2013; Foley et al., 2005; James, 2018; Lee et al., 2006). Habitat loss and fragmentation are considered major threats to global biodiversity, impacting 86% of threatened mammals, 88% of threatened amphibians, and 86% of threatened birds (Baillie et al., 2004; Foley et al., 2005; Sala et al., 2000). Consequently, many scientists suggest that human activities are now responsible for the sixth great mass extinction, especially since current extinction rates of vertebrates are estimated to be 100–1000 times greater than their natural background extinction rates (Baillie et al., 2004; Barnosky et al., 2011; Ceballos et al., 2015; Wake & Vredenburg, 2008). Human activities such as intensive agriculture and urbanization are predicted to increase dramatically in the future in response to human population growth (Clay, 2013; Ray et al., 2013; Seto et al., 2012). To reduce human impacts on ecosystems, it becomes imperative to identify effective conservation strategies.

Conservation strategies rely on accurate information of species spatial distribution (Bank et al., 2003; De Wan et al., 2009; Filipe et al., 2004). Understanding which and how factors affect species distribution allows conservation managers to predict the effect of environmental changes on species presence and abundance, to identify key areas of conservation, and potential reintroduction sites (De Wan et al., 2009; Eikaas et al., 2005; Filipe et al., 2004; Klar et al., 2008). However, species distribution are determined by factors operating at multiple spatial scales (Bauerfeind et al., 2009; Blevins & With, 2011; Montague-Drake et al., 2009; Reidy et al., 2016). At the local scale, species occurrence is influenced by abiotic and biotic factors typically associated with individual survival and reproductive success, including resource availability, competition for such resources, parasite loads, and predation risk (Bauerfeind et al., 2009; Blevins & With, 2011; Montague-Drake et al., 2009). At the landscape scale, site occupancy is often affected by factors related to movement among resource patches or local populations (Bauerfeind et al., 2009; Boscolo & Metzger, 2011; Dullinger et al., 2011; Pavlacky et al., 2012). The degree to which the landscape facilitates or impedes movement among resource patches

(27)

& Fahrig, 2000). This landscape characteristic is deemed important as it should affect the connectivity of local populations and therefore the exchange rates of individuals among them (Acevedo et al., 2015; Hanski, 1998, 1999).

Landscape characteristics as well as local habitat conditions can affect organisms with complex life cycles such as pond-breeding amphibians (Cassel et al., 2019; Knapp et al., 2003; Mazerolle et al., 2005; Scherer et al., 2012). Pond-breeding amphibians require both terrestrial and aquatic habitats, as well as the ability to move between them: they need terrestrial habitats to forage, disperse, and hibernate, as well as aquatic habitats to breed and develop from embryos (Semlitsch, 2008; Vitt & Caldwell, 2014; Wilbur, 1980). Such dual habitat requirement make them particularly vulnerable and contributes indirectly to their population decline worldwide (Alford & Richards, 1999; Stuart et al., 2004). Many factors contribute to amphibian declines, such as climate change, diseases, invasive species, but habitat loss and fragmentation are likely the most important (Alford & Richards, 1999; Blaustein & Kiesecker, 2002; Collins, 2010; Cushman, 2006). Amphibians are more threatened of extinction than either birds or mammals, with 41% of species at risk compared to 14% and 25% of bird and mammal species, respectively (International Union for Conservation of Nature, 2019; Stuart et al., 2004). Identifying local and landscape characteristics affecting the distribution of amphibians is thus of utmost importance to ensure their persistence.

Because early life stages of most amphibians are exclusively aquatic, environmental conditions within ponds must be favorable to their survival and development for a pond to be occupied across years (Werner et al., 2009). Pond occupancy and larval development depend on environmental conditions such as aquatic and riparian vegetation cover (Hartel et al., 2007; Mazerolle et al., 2005; Vos & Stumpel, 1995; Welch & MacMahon, 2005), canopy cover (Schiesari, 2006; Skelly et al., 2002; Werner & Glennemeier, 1999; Werner et al., 2009), and wetland hydroperiod (Amburgey, Funk, Murphy, & Muths, 2012; Rowe & Dunson, 1995; Snodgrass, Ackerman, Bryan, & Burger, 1999; Zipkin, Grant, & Fagan, 2012). Furthermore, pond occupancy may also be influenced by landscape structure because juveniles disperse following metamorphosis from their natal pond to terrestrial habitats before ultimately breeding in their natal pond or another pond in the landscape (Gill, 1978; Semlitsch, 2008). Pond-breeding amphibians also migrate regularly through the landscape to access seasonal resources in different habitats (Pilliod et al., 2002; Vitt & Caldwell, 2014). Therefore, a pond either isolated by

(28)

distance or by a landscape structure hindering movements may remain unoccupied despite having favorable local conditions for larval survival and development (Johnson et al., 2002).

The habitat composition and configuration of the landscape determine its permeability to amphibian movements (Cline & Hunter, 2014, 2016; Cosentino, Schooley, & Phillips, 2011; Knutson, Herner-Thogmartin, Herner-Thogmartin, Kapfer, & Nelson, 2018). For instance, habitat patches can be favorable to movements because they act as stepping-stones, reduce the travelling distance, or contain resources (Gibbs, 1993; Saura & Rubio, 2010; Semlitsch & Bodie, 1998). Conversely, anthropic disturbances, such as roads, built-up and intensive row crop areas, can be impermeable or act as barriers to movements (Knutson et al., 2018; Rothermel & Semlitsch, 2002; Van Buskirk, 2012). These open and disturbed surfaces can be harmful to amphibian movements as they lead individuals to experience high water loss (Mazerolle & Desrochers, 2005; Rothermel & Semlitsch, 2002). Roads can also impede amphibian movements by causing direct mortality through collisions with vehicles, particularly on high-traffic roads (Bouchard et al., 2009; Fahrig et al., 1995; Hels & Buchwald, 2001). Anthropic disturbances surrounding wetlands can also affect negatively amphibian survival, development, and presence because they increase exposure to various contaminants in aquatic habitats, such as de-icing salt, pesticides, and metals (Karraker et al., 2008; Lee et al., 2006; Marzluff et al., 2008; Wagner et al., 2013). Wetlands near anthropic areas can also act as ecological traps by increasing mortality (Sievers, Parris, Swearer, & Hale, 2018). The negative impacts of anthropic areas on individual survival, reproduction and movement are very concerning, especially for species at risk of extinction.

An amphibian particularly at risk of extinction in Canada is the boreal chorus frog (Pseudacris maculata) (Committee on the Status of Endangered Wildlife in Canada [COSEWIC], 2008). Within a period of 10 years, the number of its local populations declined by 37% and 30% in southern Québec and Ontario, respectively (COSEWIC, 2008). Populations of the boreal chorus frog from the Great Lakes, St. Lawrence River, and Canadian Shield areas are currently considered threatened (COSEWIC, 2008). Despite serious conservation concerns about this species, there is limited information on the spatial distribution of the species, making it difficult to implement effective conservation strategies. To fill this gap, the main objective of this study was to quantify the influence of several local and landscape characteristics on the occurrence of boreal chorus frogs in wetlands of the St. Lawrence Lowlands in

(29)

connectivity. We also hypothesized that site occupancy by the boreal chorus frog decreases with the amount and proximity of anthropic disturbances. The boreal chorus frog is a cryptic species (COSEWIC, 2008; Dodd, 2013). In Canada, the species is mainly inventoried using call surveys (COSEWIC, 2008; Ouellet et al., 2009; Seburn & Gunson, 2011; Smith et al., 2014). The breeding season of the boreal chorus frog lasts 2–3 weeks in our study area (Desroches & Rodrigue, 2004; Whiting, 2004), which constrains the time window to conduct call surveys of chorusing males. To overcome this limiting factor, we performed environmental DNA (eDNA) sampling to assess site occupancy. Because it was the first time this method was used to detect boreal chorus frogs, our second objective was to compare the detection probability of eDNA to that of traditional call surveys. Species detection can be greatly improved with eDNA compared to traditional call surveys because the latter method targets calling males, whereas eDNA detect individuals of any sex or life stage in the water (Dejean et al., 2012; Ficetola et al., 2019; Valentini et al., 2016). We therefore tested the hypothesis that the detection probability of the boreal chorus frog using eDNA is higher than with call surveys.

Methods

Study area and site selection

The study area was located in the administrative region of Montérégie, in southeastern Québec, Canada (Figure 1). Our study area covered 2,250 km2 in the form of a 90 km x 25 km corridor along

the St. Lawrence River, from Candiac (45°23’00’’ N, 73°31’00’’ W) to Contrecoeur (45°51’00’’ N, 73°14’00’’ W) (Figure 1). The built-up areas of Montérégie, consisting of residential, commercial, and industrial areas, have been experiencing a rapid growth and harbor a population of > 1,550,000 people (~140 persons/km2; Ministère de l’Économie et de l’Innovation, 2019). These built-up areas cover 10%

of the territory of the Montérégie and are connected by 2,222 km of roads (Environment and Climate Change Canada [ECCC] & Ministère de l’Environnement et de la Lutte contre les changements climatiques [MELCC], 2018a; Transports Québec, 2020). More than half (i.e. 54%) of Montérégie is covered by agriculture, 45% of which consists of intensive row crops dominated by maize, soybean, and wheat cultures (ECCC & MELCC, 2018a). As a consequence, the surface waters of Montérégie are contaminated by many pesticides, notably by glyphosate, atrazine, and S-metolachlor herbicides as well as by thiamethoxam, clothianidin, and imidacloprid (neonicotinoid) insecticides (Giroux, 2019;

(30)

Montiel-León et al., 2019). With such high anthropic pressure, only 6% and 17% of the territory remains covered by wetlands and forests, respectively (ECCC & MELCC, 2018a). The study area has an annual mean temperature of 6.2°C and total precipitation of 1010.6 mm (Government of Canada, 2019). We randomly selected a total of 180 sites in the study area (Figure 1). Sites consisted of ditches and various types of wetlands, such as marshes, ponds, and wet meadows. We stratified site selection in two steps. First, we divided the corridor of 90 km x 25 km into six rectangular sections of 15 km x 25 km. Second, within each of these sections, we stratified our selection based on the historical presence of the boreal chorus frog as determined from inventories conducted between 2004 and 2016 by the Ministère des Forêts, de la Faune et des Parcs du Québec and Ciel et Terre, a local conservation organization. Specifically, we selected 90 sites known to have been occupied by the boreal chorus frog during at least one year between 2004 and 2016 and 90 sites without historical information on the species. We selected the 90 sites without historical information on the species presence based on the Québec topographical database (Ministère de l’Energie et des Ressources Naturelles [MERN], 2008), the wetland classification of Ducks Unlimited Canada (DUC, 2009), as well as satellite imagery and LiDAR. To ensure some level of independence between sites sampled in the same year, we also maintained at least 400 m between selected sites. We considered this distance appropriate as most P.

maculata dispersal occurs within 200 m of breeding sites (Dodd, 2013; Whitaker, 1971). During a given

year, we thereby sampled between 11 and 17 sites in each of the 15 km x 25 km sections given the availability of sites meeting the above distance criterion.

(31)

Figure1.The 180 sites sampled to study the distribution of the boreal chorus frog (Pseudacris maculata) in southeastern Québec, Canada. Triangles and pentagons denote the 90 sites with and without historical information on the species presence, respectively. Sites sampled in 2017 are shown in black, whereas those sampled in 2018 are in grey. Grey lines show the six rectangular sections of 15 km x 25 km used to stratify the site selection.

Environmental DNA sampling

We collected water samples for eDNA analyses at 90 sites in 2017 (16 May–19 June) and at 110 sites in 2018 (20 April–8 June). Among the 110 sites sampled in 2018, 20 were also sampled in 2017. Sites were generally visited twice during a given year. However, water samples could not be collected during the second visit at five sites in 2017 and 16 sites in 2018 because they had completely dried up. Furthermore, the 20 sites sampled in both years were sampled only once in 2018 because we focused our sampling effort on sites that had not been sampled in 2017. During each visit at a site, we collected 8 to 10 replicates of 0.125 L of water from different sections of the site (Appendix 2). To avoid contamination, bottles used to collect water were washed beforehand with a 10% bleach solution,

(32)

rinsed three times with tap water, and rinsed once with site water before collecting the sample. We stored water samples in the dark at 4°C immediately upon collection. Sampling date was transformed into the number of days elapsed since snowmelt to synchronize dates of each year on a common baseline (Appendix 1). Dates of snowmelt were obtained from the Environment and Climate Change Canada climate archives for one weather station in our study area (Government of Canada, 2019). Following water collection, water was filtered within 12 hours using a 1.2 μm glass microfiber filter (Whatman GF/C 47 mm, GE Healthcare Life Sciences®) and a peristaltic pump (Masterflex L/S Modular Drive, Cole-Parmer®) in order to recuperate eDNA on the filter. We pooled water sample replicates and unless the filter clogged, we generally could filter up to 0.75 L of the clearest water obtained after a 30-min decantation period (between 0.125 and 1,25 L of water filtered; Appendices 1; 2). We used a negative control consisting of distilled water to measure potential contamination at the start of each filtration session, for a total of 65 negative filtration controls. Between each sample, we sterilized the equipment with a 10% bleach solution and rinsed it with distilled water. After filtration, we folded the filter in half, wrapped it in aluminum foil and placed it at -20°C until further analyses (i.e. less than six months before extraction).

To prevent cross-contamination during laboratory manipulations, we washed all equipment with a 10% bleach solution or DNA Away (Thermo Scientific®), rinsed it with distilled water and finally, exposed it to ultraviolet light during 30 min. In addition, we conducted the extraction, the design of primers and the probe, as well as the amplification in distinct rooms and with different lab coats. We extracted and purified DNA using DNeasy Blood and Tissue Kit (Qiagen®) reagents as described by Goldberg, Pilliod, Arkle, & Waits (2011), and followed the protocol described by Lacoursière-Roussel, Dubois, Normandeau, & Bernatchez (2016). Each set of extractions contained between five and 11 samples and included a negative control containing only the reagents, for a total of 48 negative extraction controls. We stored extracted DNA at -20°C until amplification.

We designed specific quantitative polymerase chain reaction (qPCR) primers and probe to amplify P.

maculata cytochrome B gene using the Primer Express software version 3.0.1 (Life Technologies®)

(33)

9.0.5 (Life Technologies®). We then tested the specificity of primers and probe by amplifying the tissue-extracted DNA of other local amphibian species obtained by the Royal Museum of Ontario with the TaqMan® qPCR method (see Lacoursière-Roussel et al. 2016 for more information regarding tissue origin). The amplification was performed with real-time TaqMan® polymerase chain reaction (qPCR) using Applied Biosystems® 7500 Fast Real Time PCR (Life Technologies®). We performed the amplification according to the following thermal conditions: 2 min at 50°C, 10 min at 95°C, 50 cycles of 15 sec at 95°C, and 1 min at 60°C. The final reaction volume was 20 μl, containing 1.8 μl of each primer (10 μM), 0.5 μl of probe (10 μM), 10 μl of TaqMan® Environmental Master Mix 2.0 (Life Technologies®), 3.9 μl of H2O, and 2 μl of DNA. Our designed primers amplified a DNA fragment of

222 base pairs (bp).

A standard curve experiment was performed following the reaction and thermal conditions of the TaqMan® qPCR method as described above. A synthetic DNA template of 500 bp (Integrated DNA Technologies®) including the target amplicon of 222 bp was designed from the cytochrome B sequence. From the stock diluted at 1.0 x 1010 copies/µL, a nine-level dilution series (i.e. 2000, 1000,

500, 100, 20, 8, 4, 2, and 1 copies per reaction) was prepared in a sterile yeast tRNA (10 ng/µL) solution. Ten replicates of each dilution were run to determine the amplification efficiency and the limit of detection defined as the lowest copies per reaction with > 95% amplification success (Bustin et al., 2009). The qPCR primers and probe had an amplification efficiency of 96.9% and a limit of detection of two copies by reaction. The threshold cycle was 38.9 Ct.

(34)

Table1.Primers and probe sequences designed to amplify the boreal chorus frog (Pseudacris maculata) DNA and their mismatches (i.e. in bold) with the DNA sequences of other amphibian species in Québec.

Common

name Latin name

Forward primer and mismatches (5’ → 3’)

Reverse primer and mismatches (5’ → 3’)

Probe and mismatches (5’ → 3’)

Boreal chorus

frog Pseudacris maculata ATATCCTTCTGAGGAGCCACTGTC GAGTCCAATTGGGTTGGATGAC TATTGCCGGGGCATCA

Spring peeper Pseudacris crucifer

ATATCATTCTGAGGAGCCACTGTT ATATCATTCTGAGGGGCCACTGTT ATATCATTTTGGGGAGCCACTGTT ATATCATTCTGGGGCGCCACTGTT AAGCCCAATTGGATTAGATGAT AAGTCCAATTGGATTAGATGAT TATTGCAGGAGCATCA TATCGCAGGAGCATCA CATTGCAGGAGCATCA Western

chorus frog Pseudacris triseriata ATATCATTCTGAGGGGCCACCGTA AAGTCCAATTGGGTTAGATGAT CATTGCAGGAGCATCA

Gray treefrog Hyla versicolor

ATATCCTTCTGAGGAGCCACAGTT ATATCCTTCTGAGGGGCCACAGTT ATATCCTTCTGAGGAGCCACAGTA TAATCCTGTTGGGTTAGACGAT TAACCCTGTTGGGTTAGACGAT TATTGCAGGAGCATCA TATTGCAGGGGCATCA

(35)

Green frog Lithobates clamitans ATGTCATTCTGAGGCGCCACAGTA TAGGCCTGTTGGGTTAGATGAA TAGGCCTGTTGGGTTAGATGAG TAGGCCTGTCGGGTTAGATGAG CATTGCCGCAGCAAGC TATTGCCGCAGCAAGC TATTGCCGCGGCAAGC TATTGCTGCAGCAAGC Pickerel frog Lithobates palustris ATATCTTTTTGAGGCGCCACAGTT TAGTCCAGTGGGGTTGGATGAG TATTGCAGCTGCAAGT

Mink frog Lithobates

septentrionalis ATGTCATTCTGAGGCGCCACAGTA TAGGCCTGTTGGGTTAGATGAG TATTGCTGCAGCAAGT

Wood frog Lithobates sylvaticus ATATCCTTCTGAGGAGCCACAGTA TAGGCCTGTGGGGTTAGATGAT TATCGCAGCTGCAAGT American

bullfrog

Lithobates

catesbeianus ATGTCATTCTGAGGCGCCACAGTA GAGGCCTGTTGGGTTGGATGAG TATCGCAGCAGCAAGT

American toad Anaxyrus americanus ATATCATTTTGAGGTGCAACAGTA TAGACCTGTTGGATTTGAGGAT TATTGCAGGCGCCTCC

* For the leopard frog (Lithobates pipiens), the DNA sequences of the cytochrome B gene were not available in the GenBank database (NCBI, 2019), but we tested the specificity of the primers and probe by amplifying the tissue-extracted DNA of this species.

(36)

We amplified extracted DNA with the TaqMan® qPCR method. A standard curve, as well as SPUD were added to the reaction. The SPUD serves as an internal positive control to identify inhibitor presence in the samples and to estimate the efficiency of the reaction. The final reaction volume was 20 μl, containing 1.8 μl of each primer (10 μM), 0.5 μl of probe (10 μM), 10 μl of TaqMan® Environmental Master Mix 2.0 (Life Technologies®), 3.9 μl of SPUD, and 2 μl of extracted DNA. The amplification was performed according to the following thermal conditions: 2 min at 50°C, 10 min at 95°C, 50 cycles of 15 sec at 95°C, and 1 min at 60°C. We amplified samples in six technical replicates. For each plate, we added three negative amplification controls (i.e. nuclease-free water instead of DNA) and one positive control with the DNA extracted from the boreal chorus frog tissue obtained from Ministère des Forêts, de la Faune et des Parcs du Québec (see Rogic et al. 2015 for details regarding tissue origin). We also added a standard dilution series from 101 to 105 of synthetic DNA, in three

replicates, to each plate to be used as a standard curve. To test for contamination, we treated the negative filtration and extraction controls using the same procedures as for the water samples collected at sites. We inferred species presence with the qPCR assay when at least two of the six replicates showed high levels of fluorescence (i.e. > 0.18 ΔRn) and were under the detection cycle limit (i.e. 38.9 cycles, Harper et al., 2018). We chose this threshold (2/6 positive qPCR replicates) to prevent false positives without drastically reducing detection sensitivity. Samples above this threshold were sequenced on the Genomic Analysis Platform of the Institute of Integrative Biology and Systems of Université Laval to confirm the species identity. The sequences obtained were compared against those of the DNA database of the boreal chorus frog using Blast (NCBI, 2019). We considered the species to be present when sequence homology with those of the reference database was ≥ 97%.

Call surveys

During the 2018 boreal chorus frog breeding season (20 April–10 May), two listeners conducted call surveys between 11:30 and 20:00 at 63 sites that were simultaneously sampled for eDNA. We conducted 5-min surveys at 1 to 5 sampling stations depending on site area after remaining silent and motionless for a 5-min period. When the site area was not available from georeferenced data layers, it was measured in the field using a GPS (Appendix 1). The number of sampling stations was, however, fixed at two for ditches. Sampling stations were established randomly at the water edge on the site

(37)

sampling stations of a given site to determine whether the species was detected at least once (1) or not (0) during a given visit.

Local characteristics

We characterized sites in June and July 2018 during and after tadpole metamorphosis as most individuals emerge from wetlands in late June or early July in our study area (Whiting, 2004). We estimated vegetation cover in the water and on the shoreline with quadrats of 1 m x 3 m. Each quadrat was centered on a call survey sampling station, chosen randomly, so that half of the quadrat was on the shoreline and the other half in the water. The number of sampled quadrats at a given site depended on its area with small (i.e. < 0.68 ha), medium (i.e. > 0.68 ha to < 2.96 ha), and large (i.e. > 2.96 ha) sites having one, two and three quadrats, respectively. In each quadrat, we estimated visually the percentage of canopy closure (i.e. vegetation > 3 m in height) above the site. We estimated cover of five categories of terrestrial vegetation on the shoreline: trees (> 3 m), tall shrubs (0.3–3 m), small shrubs (< 0.3 m), herbaceous vegetation (> 0.05 m), and ground vegetation (< 0.05 m). In the aquatic portion of the quadrat, we estimated cover of three vegetation categories: emerged, submerged, and floating. In another vegetation category, we estimated common reed (Phragmites australis) cover in both the terrestrial and aquatic portion of the quadrat. We also estimated the cover of bare ground and open water on the shoreline and aquatic portions of quadrats, respectively. We quantified vegetation cover with the six following classes: 0%; 1–5%; 5.1–25%; 25.1–50%; 50.1–75%; > 75%. For each site, we calculated the mean cover of each vegetation category using the midpoints of the cover classes recorded at the different sampling quadrats (Appendix 1). During site characterization, we also recorded whether the site was dry (i.e. 1 = dry and 0 = not dry) as a proxy of the site’s hydroperiod. We summarized vegetation data with a principal component analysis based on a covariance matrix. We used the first principal component scores in the site occupancy analyses because it was the only component exceeding the portion of variance explained based on the broken stick distribution (Peres-Neto, Jackson, & Somers, 2005) (Appendix 3). The first axis (VEG1) explained 64.56% of the variation and was positively associated with canopy cover (Appendix 3).

Références

Documents relatifs