• Aucun résultat trouvé

Transcriptional Analysis of the dd-Peptidase/Penicillin-Binding Protein-Encoding dac Gene of Streptomyces R61: Use of the Promoter and Signal Sequences in a Secretion Vector

N/A
N/A
Protected

Academic year: 2021

Partager "Transcriptional Analysis of the dd-Peptidase/Penicillin-Binding Protein-Encoding dac Gene of Streptomyces R61: Use of the Promoter and Signal Sequences in a Secretion Vector"

Copied!
7
0
0

Texte intégral

(1)

© Springer-Verlag 1990

Transcriptional analysis of the DD-peptidase/penicillin-binding

protein-encoding dac gene of

Streptomyces

R61:

Use of the promoter and signal sequences in a secretion vector

Claudine Piron-Fraipont, Mauro V. Lenzini, Jean Dusart, and Jean-Marie Ghuysen

D~partement de Microbiologie, Universit~ de Li6ge, Institut de Chimie, B6, B-4000 Sart Tilman (Liege 1), Belgium Received February 1, 1990

Summary. The promoter region of the gene encoding the extracellular DD-peptidase/penicillin-binding protein of Streptomyces R61 has been identified by in vivo pro- moter probing and SI mapping. A secretion vector, pDML116, was constructed by inserting into the multi- copy Streptomyces plasmid pIJ702, a 247 bp D N A se- quence that contained the transcriptional, translational and secretory signals and the 12 amino acid N-terminal region-encoding sequence of the mature Streptomyces DD-peptidase/penicillin-binding protein. Insertion, down- stream of this 247 bp segment, of the Streptomyces R61 DD-peptidase-encoding gene or the Escherichia coli R- TEM /%lactamase-encoding gene yielded plasmids pDML120 and pDML128, respectively, which allowed expression and secretion of the relevant enzymes by Streptomyces lividans. The maximal secretion levels ob- tained were 42 mg protein/ml for the autologous Strepto- myces DD-peptidase and 0.9 mg protein/ml for the heter- ologous E. coli /%lactamase.

Key words: In vivo promoter probing - $1 mapping

Protein secretion - R-TEM/%lactamase - Streptomyces R61 DD-peptidase/PBP

Introduction

The use of gram-positive bacteria harbouring appro- priate secretion vectors as a means to produce proteins of procaryotic and eucaryotic origin is well documented (Chang 1987). Streptornyces lividans is a very useful or- ganism for this purpose (Gray et al. 1984; Munoz et al. 1985; Kieser et al. 1986; Pulido et al. 1986; Lichenstein et al. 1988; Noack et al. 1988; Chang and Chang 1988; Piron-Fraipont et al. 1989). Indeed, its R N A polymerase Offprint requests to: J. Dusart

recognizes promoters of other bacterial species (Bibb and Cohen 1982), its D N A restriction capability is lim- ited and its proteolytic activities are low. Moreover, Streptomyces are generally regarded as safe organisms which are able to grow to high densities and produce large amounts of extracellular proteins on an industrial scale. However, when genes encoding extracellular pro- teins of foreign origin are cloned into Streptomyces with their own signal sequences, complete secretion of synthe- sized proteins is rare (Dubus 1986; All and Dale 1986). In contrast, expression of genes encoding chimaeric pro- teins consisting of a Streptomyces signal peptide located upstream of the desired mature protein generally results in complete secretion of the gene product (Lichtenstein et al. 1988; Chang and Chang 1988; Nagashima et al. 1989).

Streptomyces and Actinomadura spp. produce extra- cellular/~-lactamases and ~)D-peptidases/penicillin-bind- ing proteins (PBPs) and several genes encoding these proteins, which all interact with penicillin, have been cloned (Dehottay et al. 1986; Duez et al. 1987; Lenzini et al. 1987; Piron-Fraipont et al. 1989) and sequenced (Duez et al. 1987; Dehottay et al. 1987; Lenzini et al. 1988; Houba et al. 1989). The nucleotide sequence con- taining the transcriptional, translational and secretory signals of the dac gene that encodes the DD-peptidase/ PBP of Streptomyces R61 has been used to construct a Streptomyces expression-secretion vector. The efficacy of the vector has been tested using the autologous Strep- tomyces R61 enzyme itself and the heterologous R-TEM /%lactamase of Escherichia coli as models.

Materials and methods

Bacterial strains and growth conditions. Streptomyces R61 was from this laboratory. S. lividans TK24 (Hop- wood et al. 1983) was from the John Innes Institute,

(2)

Norwich, UK. Both were grown at 28 ° C with vigorous orbital shaking in YEME (Hopwood etal. 1985), mYEME (Erpicum et al. 1990) or glycerol-casein (Leyh- Bouille et al. 1971) liquid media. R2YE (Hopwood et al. 1985) and MMT (Katz et al. 1983) agar plates were also used. Promoter-probing experiments were carried out on kanamycin-gradient MMT agar plates (Ward et al. 1986).

Plasmids. The high copy-number plasmid pIJ702 (Katz et al. 1983) and the promoter probe pIJ424 (Ward et al. 1986) were from the John Innes Institute, Norwich, UK. pIJ424 contains the aminoglycoside phosphotransferase- encoding gene of Tn5, conferring kanamycin resistance.

p D M L I I I and pDML112, derivatives of pBR322, and pDML110, a derivative of pJI702, were from this laboratory (Duez et al. 1987). They all contained the Streptomyces R61 DD-peptidase/PBP-encoding dac gene. pJBS633, a derivative of pBR322, containing the signal peptide-free R-TEM /Mactamase Ap gene (Broome- Smith and Spratt 1986), was from the University of Sus- sex, Brighton, UK.

Estimation of the expressed DD-peptidase and ~-lacta- mase. DI>carboxypeptidase activity in culture fluids was assayed by measuring the amount of D-Ala released from the diacetyl tripeptide (Ac2)-L-Lys-I>Ala-D-Ala (Fr6re etal. 1976). Do-carboxypeptidase-producing Strepto- myces colonies were detected using the immunological test described in Duez et al. (1987) except that the

[125I]-

labelled protein A was replaced with alkaline phospha- tase coupled to goat antibodies directed against rabbit IgG (Bio-Rad immunoblot assay kit). /LLactamase ac- tivity in culture fluids was estimated with nitrocefin as substrate (O'Callaghan et al. 1972) and/Llactamase-pro- ducing Streptomyces colonies were detected as described in Dehottay et al. (1986).

Cellfractionation. Cells from 10 ml culture samples were washed twice with 10 ml of 100 mM potasmium phos- phate, pH 7.0, suspended in 2.5 ml of the same buffer containing 1 x 10 - 4 M phenylmethylsulfonyl fluoride and 1 x 10 -4 M EDTA and the cell suspension was soni- cated for 150 s (MSE ultra-disintegrator MR2; power 12). Centrifugation for 30rain at 18000rpm (SS34 Sorvall rotor) yielded a supernatant and a pellet, i.e. cytoplasmic and membrane fractions. The pellet was washed once and suspended in 0.2 ml phosphate buffer.

Enzymes and antibiotics. The enzymes used for recom- binant DNA experiments were from Boehringer, Mann- heim, FRG, Bethesda Research Laboratory (Gaithes- burg, MD, USA), Amersham International (Amersham, UK), Sigma Chemical Co. (St Louis, MO, USA) and New England Biolabs (Beverly, MA, USA). Nitrocefin was purchased from BBL Microbiology Systems (Cock- eysville, MD, USA), and kanamycin was from Sigma Chemcial Co. (St Louis, MO, USA). Thiostrepton was a gift from S.J. Lucania (Squibb and Sons, New Bruns- wick, N J, USA).

DNA recombinant techniques. The procedures used were essentially those described in Maniatis et al. (1982) and Hopwood et al. (1985). $1 mapping was carried out ac- cording to Bibb et al. (1986) at a hybridization tempera- ture of 45 ° C. RNA was isolated as described in Hop- wood et al. (1985) from cultures of S. lividans TK24 harbouring pDMLl10, grown in YEME containing 34% sucrose, 5 mM M g C 1 2 and 0.5% glycine, for 96 h, after which time the production of DD-peptidase was maximal. Nucleotide sequencing was carried out using the M13 dideoxynucleotide (Sanger et al. 1977, 1980) and the Maxam and Gilbert (1980) procedures.

SalI G T c ~ A c A c c c ~ c T c A c c A c c ~ c ~ c ~ c A 6 ~ c A c A ~ c ; A c ~ A c A T ~ G T c G c c c ~ c G c ~ T T c T ~ T c c b A c A c ~ T c c c ~ SO CGACGOCAObCaGrOCCOO~OaCCGGOCC6CCOCCOCOO6TCCOaGCOC&CACCaTCO;OOaO~CATSOCCTOCOOCb 16e ~ c G ~ T c c c b ~ G c ~ G ~ G ~ T ~ G T c ~ c ~ T c G ~ m ~ x ~ A 6 c c ~ c ~ c ~ c ~ c c n - ~ c i ¢ c c T c ; , ~ c ~ c ~ A ~ c ~ c b ~4o . . . . SauSA ~ T A G G ~ A T ~ G ~ T T ~ G ~ G G G ~ G ~ G ~ T ~ G G ~ G ~ G T ~ c T G G ~ A G ~ T T T T ~ G ~ G c T G A A G G ~ T ~ T 320 -35 . . . . -10 ~ . ~ . T T T C C G C ~ I T C C T T C ~ C G T G A C A T G C A A C C C A T C T G C C C C T C C T G C G C G T A G ~ G A T G G T G C C G G C G T T C G ~ A T C C G C G G C 400 SO GCGGTACACiGAGGGAACTCGGGAGAAGAATCAG -20 L e u G l y A l a Val L e u L e u A I a L e u L e u C T G G G C G C G G T G C T G T T G G C C C T C C T C 1 SauBA A l a A s p L e u P r o A l a P r o A s p A s p ~ n r G C G G A T C T G C C G G C A C C C G A C G A C A C C G i n G l y A l a P r o G l y A l a M e t V a l A r g C A G G G A G C C C C C G G T G C G A T G G T G C G G G l u G l y V a l A l a A s p A r g A l a T h r G l y G A G G G A G T C G C C G A C C G G G C C A C C G G G - 3 1 M e t A T G V a l S e t G l y T h r V a l G l y A r g G l y ~ r A l a

oTc TCA GGA ACG CTG CGC AGh GGT ACG SCG

-Z0 Not I $ A l a V a l P r o A l a G i n A l a G l y T h r A l a A l a A l a G C A G T C C C C G C A C A G G C C G G C A C C G C C G C G G C C 527 lo PstI 2o G l y L e u O l n A I a V & I L e u H i s T h r A l a L e u S e t C T G C A G G C G G T G C T G C A C A C G G C C C T T T C C S a [ I 40 A s p A s p A s n O l y ~ I r Ile H i s G l n L e u S e t G A C G A C A A C G G C A C G A T C C A C C A G 2 ~ G T C G 60 A r g V a l C G C G T C G G T 30 V a l G T C 50 A r g C G T 140 . . . [,eu . . . C T G A I & Ile Z~]r T h r T h r A s p A r g P h e G C G A T C A C C A C G A C C G A C C G G T T C BclI I l e T h r A T C A C C 467

5s7 Fig. 1, Sequence of the

434 nucleotides located upstream of the Streptomyces R61 DD-peptidase/ 647 PBP-encoding dac gene and position

of the main restriction sites. The --10, --35 and Shine-Dalgarno 707 sequences (SD), the transcriptional

starts (asterisks) and the site of cleavage of the signal peptide

(3)

Results

The dac gene nucleotide sequence

Figure 1 shows the revised sequence of the 434 nucleo- tides located upstream of the A T G initiation codon of the dac gene. Compared with the sequence published previously (Duez et al. 1987), G338, G340 and the triad G396 C397 G398 have been added; a dyad G G (between T330 and C331) and a G (between C360 and T361) were eliminated; G391 and C392 were inverted.

B g t g ~

. ~ . S ! ~

...

i l-Kpnl l pDNL112

.~>~ i i s_.R61

IIIIIlllllll da~ ~elGe

I pBR322

i qlF1

A i

1565bp IS_.R61

<

da~ gene

i>

m

B ~' ¢~ 631

bp

~'

Fig. 2. Promoter-probing constructs, tsr, thiostrepton resistance

gene; Tc, tetracycline resistance gene; reel, tyrosinase gene; Ap, ampicillin resistance gene. The dac gene in pDMLll2 lacks the carboxy terminal-encoding region. A The 1565 bp DNA segment. The 1565-bp BgllI-BclI fragment was prepared from pDML110 and inserted into pIJ424, which had been cleaved with BgIII and dephosphorylated. Streptomyces lividans TK24 cells transformed with the ligation mixture and selected on kanamycin (100 gg/ml)- MMT agar were found to contain a plasmid of the expected size (7865 bp). The orientation of the cloned fragment was deduced from the sizes of the fragments produced by PstI. B The 631 bp DNA segment. The 631 bp Sau3A-BclI fragment was inserted in pIJ424 by means of a triple ligation procedure. The ligation mixture included: (i) The 300 bp Sau3A-SalI fragment obtained from pDML112 by SalI digestion, isolation and partial Sau3A digestion of the 615 bp SalI fragment. (ii) The 331 bp SalI-BcIl fragment obtained by SalI and BclI digestion of the 2630 bp BgIII-EeoRV fragment of pDMLII0. (iii) pIJ424 cleaved with BglII and de- phosphorylated. After transformation of S. lividans TK24, kana- mycin-resistant (100 gg/ml) colonies were isolated. Given that the 331 bp stretch had no PstI site while the 300 bp stretch and pIJ424 had one and three PstI sites, respectively, one recombinant plasmid possessing the expected 6900 bp size and four PstI sites was se- lected. The orientation of the 631 bp insert was deduced from the sizes of the fragments produced by PstI

The transcriptional and translational signals o f the Streptomyces dac gene

The transcriptional and translational signals of the dac gene were identified by in vivo promoter probing and S1 mapping experiments. As shown below, the transcrip- tional and translational signals were inclued in a 122 nu- cleotide stretch, from nucleotide 316 to nucleotide 437 (Fig. 1). These experiments made use of three plasmids: pDML110, pDML112 and the promoter-probe pIJ424 (Fig. 2).

Promoter probing. The recombinant plasmid obtained by inserting the 1565bp BgIII-BclI sequence of p D M L I I 0 into the promoter-probe pIJ424 (Fig. 2) al- lowed S. lividans TK24 to grow in the presence of kana- mycin up to a concentration of 500 gg/ml (as observed by streaking spores on kanamycin-gradient agar plates). As also shown in Fig. 2, another plasmid was obtained by inserting into plJ424 the 631 bp D N A fragment that contained the same amino terminal-encoding region of the dac gene as that present in the 1565 bp D N A frag- ment described above, but had a much shorter nucleo- tide sequence upstream of the A T G initiation codon (nu- cleotides 316-946 in Fig. 1). This plasmid allowed S.

lividans to grow in the presence of kanamycin up to a concentration of 750 gg/ml.

S1 mapping, pDML112 containing the 631 bp D N A seg- ment mentioned above was cut at the NotI site. After dephosphorylation, the linearized plasmid was 32p-la- belled at the 5'-OH end and digested with SalI. A m o n g the four D N A fragments thus produced, the 523 bp SalI-

NotI fragment (nucleotides 1-523 in Fig. 1) bearing the 32p-label on the 5'-OH end of the NotI site, was hybrid- ized with the total R N A fraction prepared from a culture of S. lividans harbouring pDML110 (and thus contain- ing the complete dac gene). Non-hybridized strands were eliminated by treatment with S1 nuclease and the re- maining double-stranded fragments were analysed by polyacrylamide gel electrophoresis and aligned with a Maxam-Gilbert sequence of the probe. Four major hy- brids were localized (see Fig. 3), allowing identification of the transcription starts at nucleotides 378, 379, 381 and 382 (Fig. 1), i.e. at positions - 5 3 , - 5 4 , - 5 6 and

- 57 upstream of the A T G initiation codon.

Construction o f a Streptomyces expression-secretion

vector

(i) P l a s m i d p D M L i 1 6 . The D N A stretch extending from nucleotide 316 to nucleotide 562 (Fig. 1) contained the transcriptional, translational and secretory signals of the

dac gene and, in addition, that portion of the dac gene

encoding the 12 amino acid N-terminal region of the mature protein. Hence, the site of cleavage by the leader peptidase is included. On this basis, insertion of the cor- responding Sau3A-PstI, 247 bp D N A fragment (nucleo- tides 316-562 in Fig. 1) into the high-copy number plas- mid pIJ702 should give rise to a plasmid that can serve as an expression-secretion vector in Streptomyces.

(4)

1

2 3 4 5 6

I comp[emenfaFy sfrand - G C -C G --6 C -C G T

/ / - c

G

/ / - T

A

/----C G A G ~ C ~ 0 ----'-A * T - - C O - - G ~ C "---G ~ C ~ C O ~ C O T

Fig. 3. S] nuclease mapping of the promoter of the dae gene. Aster- isks indicate the four major start-points. Hybridizations contained RNA from: lane 1, S. lividans TK24+pDMLl10 (bearing dac

gene); lane4, S. lividans TK24+pIJ702; lane 5, self-hybridized DNA probe; lane 6, untreated DNA probe. Maxam and Gilbert sequence ladders for DNA probe are in lanes 2 (G+A) and 3

( T + O

pDML112 (Fig. 2) was doubly digested with SalI and

PstI (nucleotides 2-562 in Fig. 1) and the isolated 562 bp D N A fragment was partially digested with Sau3A. The 247 bp D N A fragment was isolated by 5% acrylamide

247 bp . ~ , o , / Z ~

-I- B

_5

Ps~'g /

pDML120 II B g l H " p IJ 702 tsr

promoter + signa[ pepfide * 12 first triplets

coding for mature Dac profein ,~ processing sire

Fig. 4 A-E. Construction of pDMLI 16 (upper part) and pDML120 (lower part)

gel electrophoresis and ligated to pIJ702, from which the 510 bp BglII-PstI, D N A fragment had previously been eliminated (Fig. 4, upper part). The resulting plas- mid was designated pDML116 (Fig. 4, upper part). S.

lividans TK24 transformants harbouring p D M L l l 6 were thiostrepton-resistant. Note that the BglII-Sau3A

fusion reconstituted the BglII site. Upon digestion with

BglII and PstI, pDML116 regenerated the 247 bp D N A fragment.

(ii) Plasmid p D M L 1 2 0 . In order to test the ability of p D M L l l 6 to encode secretory information, the entire

dac gene was reconstituted in this plasmid, yielding pDML120 (Fig. 4, lower part). When grown in the gly- cerol-casein medium containing 25 gg thiostrepton per ml, S. lividans TK24/pDML120 produced twice as much extracellular DD-peptidase/PBP as S. lividans TK24/ p D M L l l 0 (42mg versus 20.6rag/i), showing the in- creased efficiency of p D M L ] 20 compared to the original p D M L l l 0 . Note that the growth conditions (120 h at 28 ° C) were optimal and identical for both strains and that S. lividans TK24/pIJ702 did not produce any detect- able extracellular DD-peptidase or #-lactamase (Duez et al. 1987; Lenzini et al. 1987).

(5)

cI2rn ~o?gz so ~z >."I- -___~

"Q

BS Ba[l-~

@~k(hol

A R L-h I ] 4" RTEPI bela-Laclamase keu Arg HIs Pro G[u Thr .... C A 6 C T 5 C G T C A E CC A G A A A C G .... Pvull BglII , plJ 702 ~,\\\\"~ R T E M gene I pBR322 (via pJBS633)

Fig. 5. Construction of pDML128, pDMLII6 was linearized with

PstI. PstI ends were blunted by ligation with the synthetic oligonuc- leotide 5'-CTGCA followed by addition of dGTP with Klenow enzyme to add the missing base. Blunt-end ligation was carried out between this modified plasmid and the bla-containing 2430 bp

PvuII-NruI fragment of pJBS633. One S. lividans TK24 ~-lacta-

+7 +8 +9 +10 *M +1 +2 +3 +4 +5

I r

GAC GAC ACC GGT

i

OO-pepfidase S. R61 R T E M E.coti

mase-producing clone was found. The recombinant plasmid (pDML128) was isolated and the junction sequenced (lower part of figure), revealing that two codons were missing. The reading frame was thus preserved, but the expected PstI and PvuII sites were lacking

2

~

s~ ~- cn o3 & , , plJ702 ~" p B R 3 2 2 m I I I Fig. 6. Construction of pDML129

(iv) Plasmid p D M L 1 2 9 . The hybrid pIJ702-pBR322 plasmid pDML129 (Fig. 6) was constructed in which the fl-lactamase Ap gene was left under the control of its own transcriptional, translational and secretory sig- nals. S. lividans TK24/pDML129, grown in Y E M E me- dium, produced maximally about 30 gg fi-lactamase/1, about one-third of which remained inside the cells, indi- cating that the E. coli secretory signals failed to operate correctly in Streptomyces spp. That there are differences between E. coli and the Streptomyces spp. at the level of the secretory machinery is known (Chang 1987), how- ever, no easy generalizations can be made. All and Dale (1986), for example, reported that the small amounts of Salmonella typhimurium Oxa-2 fl-lactamase expressed by S. lividans harbouring the oxa-2 gene and its own signal peptide-encoding sequence, is almost completely exported in the culture medium.

(iii) Plasmid p D M L 1 2 8 : a Streptomyces expresston-se-

cretion vector o f the heterologous E. coli R - T E M fl-laeta-

mase. The R-TEM fl-lactamase gene was excised from pJBS633, where it occurs without its own signal peptide- encoding nucleotide sequence (Broome-Smith and Spratt 1986), and inserted into pDML116. The resulting plas- mid p D M L I 2 8 (Fig. 5) thus contained the region of the

dac gene encoding the 11 N-terminal amino acids, fused

to the mature R - T E M fl-lactamase-encoding gene via the triplet CGT (Fig. 5). S. lividans TK24/pDML128 grown in m Y E M E medium for 96 h produced maximal- ly 0.9 mg of extracellular fl-lactamase/1. Fractionation of the cells showed that at least 96% of the expressed protein was secreted.

Discussion

The transcriptional signals of the Streptomyces R61 DD- peptidase/PBP dae gene are located on a D N A stretch that extends 119 bp upstream of the A T G initiation co- don. Extension of this segment up to 934 bp results in a lower promoter efficiency as shown by promoter probe experiments and by the fact that S. lividans TK24 har- bouring pDML120 is a better producer of the DD-pepti- dase/PBP than S. lividans TK24 harbouring pDML110. The reason for this effect remains obscure. An upstream open reading frame might, somehow, interfere with the activity of the dae promoter.

(6)

F o u r nucleotides, G378, T379, G381 and C382, have been identified as m a j o r transcription start points, a b o u t 55 bp u p s t r e a m o f the A T G initiation codon. Multiple

start points have been observed in other Streptomyces

genes (Long et al. 1987; E c k h a r d t et al. 1987; Buttner et al. 1987; V6gtli and Hiitter 1987). The - 1 0 b o x (TA- G A G A T at p o s i t i o n s 3 7 0 - 3 7 6 ) and the - 3 5 b o x ( G T G A C A at positions 338-343) have been tentatively identified as the p r o m o t e r region. The - 10 b o x is very similar to the consensus sequence t A G g a T p r o p o s e d by H o p w o o d et al. (1986). The - 3 5 box also resembles the consensus sequence T T G a c a . Yet, the 27 bp spanning distance between the - 1 0 and - 3 5 boxes exceeds the m a x i m u m length reported by H o p w o o d et al. (1986). A n o t h e r possible candidate for the - 35 b o x m a y be the

A T G C A A sequence, which is 2 2 b p away f r o m

- 1 0 b o x . Different sequences for the - 3 5 b o x have

been reported in the aph and tsr Streptomyces genes

(Janssen et al. 1985). N o t h i n g in our sequence shows h o m o l o g y with these.

p D M L 1 2 0 a n d p D M L 1 2 8 are similar constructs in

which the genes that encode the m a t u r e Streptomyces

R61 DD-peptidase/PBP and the m a t u r e E. coli fl-lacta-

mase, respectively, are placed under the control o f the transcriptional, translational and secretory signals o f the

Streptomyces R61 dac gene. In p D M L 1 2 8 , however, the

secretory signal is extended by a 33 b p stretch that codes for the 11 a m i n o acid N - t e r m i n a l region o f the Strepto- myces protein and this segment is itself linked to the

fl-lactamase gene by an additional ( C G T ) codon. The

yield of the autologous DD-peptidase/PBP f r o m S. livi-

clans h a r b o u r i n g p D M L 1 2 0 ( ~ 42 mg/1) is 40-fold higher

than the yield o f heterologous fi-lactamase f r o m the same strain h a r b o u r i n g p D M L 1 2 8 (0.9 rag/l). In b o t h cases, however, the expressed proteins are very effective- ly exported in the culture medium, suggesting that the relatively low p r o d u c t i o n o f the fl-lactamase is not at- tributable to a defect in the secretory m e c h a n i s m but rather to a lower efficiency o f the transcriptional a n d / o r translational mechanisms. The stability o f the secreted proteins has not been carefully investigated in the pres- ent study; but it has been shown elsewhere (Erpicum et al. 1990) that the extracellular proteases of S. lividans

T K 2 4 are poorly active t o w a r d the enzymes under con- sideration. It has been shown (Palva et al. 1982; O h m u r a et al. 1984) that the p r o d u c t i o n o f the E. coli fl-lactamase

by Bacillus subtilis - using constructs that place fl-lacta-

mase secretion under the control o f the e-amylase signal peptide - varies substantially depending on the origin o f the signal peptide (from B. subtilis or Bacillus amyloli- quefaciens) and the size o f the linker that joins the signal

sequence a n d the fl-lactamase gene. Further study at this level m a y lead to an i m p r o v e d Streptomyces expression-

secretion vector for the E. coli fi-lactamase.

Acknowledgements. We thank Prof. D.A. Hopwood, Dr. M.J.

Buttner, Dr. T. Kieser and Dr. M.J. Bibb from the John Innes Institute for their many useful comments, for introducing us to S1 mapping techniques and for providing the necessary strains and plasmids. This work was supported in part by the Fonds de

la Recherche Scientifique M6dicale (contract no. 3.4537.88), an Ac- tion concert6e with the Belgian Government (convention 86/91-90), the Fonds de Recherche de la Facult6 de M6dicine ULg and a contract with the EEC (BAP-0197-B). JD is Research Associate at the Fonds National de la Recherche Scientifique (Belgium). MVL is indebted to the Royal Society (London) and the Fonds National de la Recherche Scientifique (Belgium) for supporting a short-term visit in Norwich.

References

Ali NA, Dale JW (1986) Secretion by Streptomyces lividans of

a cloned Gram-negative /Mactamase. FEMS Microbiol Lett 33 : 277-280

Bibb MJ, Cohen SN (1982) Gene expression in Streptomyces: con-

struction and application of promoter-probe plasmid vectors in Streptomyces lividans. Mol Gen Genet 187:265-277

Bibb MJ, Janssen GR, Ward JM (1986) Cloning and analysis of the promoter region of the erythromycin resistance gene (ermE)

of Streptomyces erythraeus. Gene 41:E357-E368

Broome-Smith JK, Spratt BG (1986) A vector for the construction of translational fusions to TEM /Mactamase and the analysis of protein export signals and membrane protein topology. Gene 49: 341-349

Buttner M J, Fearnley IM, Bibb MJ (1987) The agarase gene (dagA)

of Streptomyces coelicolor A3(2): nucleotide sequence and tran-

scriptional analysis. Mol Gen Genet 209 : 101-109

Chang S (1987) Engineering for protein secretion in Gram-positive bacteria. Methods Enzymol 153:507-516

Chang SY, Chang S (1988) Secretion of heterologous protein in

Streptomyces lividans. In: Okami Y, Beppu T, Ogawara H (eds)

Biology of Actinomycetes '88. Japan Scientific Societies Press, Tokyo, pp 103-107

Dehottay P, Dusart J, Duez C, Lenzini MV, Martial JA, Fr&e JM, Ghuysen JM, Kieser T (1986) Cloning and amplified ex- pression in Streptomyces lividans of a gene encoding extracellu-

lar fi-lactamase from Streptomyces albus G. Gene 42:31-36

Dehottay P, Dusart J, De Meester F, Joris B, Van Beeumen J,

Erpicum T, Fr6re JM, Ghuysen JM (1987) Nucleotide sequence

of the gene encoding the Streptomyces albus G /%lactamase

precursor. Eur J Biochem 166:345 350

Dubus A (1986) Clonage du g6ne codant pour la fl-lactamase d'En-

terobacter cloacae P99 dans Streptomyces lividans. Thesis, Uni-

versity of Li6ge, Belgium

Duez C, Piron-Fraipont C, Joris B, Dusart J, Urdea MS, Martial JA, Fr&e JM, Ghuysen JM (1987) Primary structure of the

Streptomyces R61 extracellular DD-peptidase. 1. Cloning into Streptomyces lividans and nucleotide sequence of the gene. Eur

J Biochem 162:509-518

Eckhardt T, Strickler J, Gorniak L, Burnett WV, Fare LR (1987) Characterization of the promoter, signal sequence, and amino terminus of a secreted fl-galactosidase from "Streptomyces livi- dans". J Bacteriol 169:42494256

Erpicum T, Granier B, Delcour M, Lenzini MV, Nguyen-Dist6che M, Dusart J, Fr&e JM (1990) Enzyme production by genetical- ly-engineered Streptomyces strains: influence of culture condi-

tions. Biotechnol Bioeng 35: 719-726

Fr6re JM, Leyh-Bouille M, Ghuysen JM, Nieto M, Perkins HR (1976) Exocellular DD-carboxypeptidases-transpeptidases from

Streptomyces. Methods Enzymol 45B: 610-636

Gray G, Selzer G, Buell G, Shaw P, Escanez S, Hofer S, Voegeli P, Thompson CJ (1984) Synthesis of bovine growth hormone by Streptomyces lividans. Gene 32:21-30

Hopwood DA, Kieser T, Wright HM, Bibb MJ (1983) Plasmids,

recombination and chromosome mapping in Streptomyces livi-

dans 66. J Gen Microbiol 129:2257-2269

Hopwood DA, Bibb M J, Chater KF, Kieser T, Bruton C J, Kieser HM, Lydiate DJ, Smith CP, Ward JM, Schrempf H (1985)

(7)

Genetic manipulation of Streptomyces. A laboratory manual.

The John Innes Foundation, Norwich

Hopwood DA, Bibb M J, Chater KF, Janssen GR, Malpartida F, Smith CP (1986) Regulation of gene expression in antibiotic- producing Streptomyces. In: Booth IR, Higgins CF (eds) Regu-

lation of gene expression - 25 years on. Cambridge University Press, Cambridge, pp 251-275

Houba S, WiUem S, Duez C, Molitor C, Dusart J, Fr~re JM, Ghuy- sen JM (1989) Nucleotide sequence of the gene encoding the active-site serine/~-lactamase from Actinomadura R39. FEMS

Microbiol Lett 65:241-246

Janssen GR, Bibb MJ, Smith CP, Ward JM, Kieser T, Bibb MJ (1985) Isolation and analysis of Streptomyces promoters. In:

Leive L (ed) Microbiology - 1985. American Society for Micro- biology, Washington, pp 392-396

Katz E, Thompson CJ, Hopwood DA (1983) Cloning and expres- sion of the tyrosinase gene from Streptomyces antibioticus in Streptomyces lividans. J Gen Microbiol 129:2703-2714

Kieser T, Moss MT, Dale JW, Hopwood DA (1986) Cloning and expression of Mycobacterium boris BCG DNA in "Strepto- myees lividans". J Bacteriol 168:72-80

Lenzini MV, Nojima S, Dusart J, Ogawara H, Dehottay P, Fr6re JM, Ghuysen JM (1987) Cloning and amplified expression in

Streptomyces lividans of the gene encoding the extracellular/3-

lactamase from Streptomyces cacaoi. J Gen Microbiol

133 : 2915-2920

Lenzini MV, Ishihara H, Dusart J, Ogawara H, Joris B, Van Beeu- men J, Fr6re JM, Ghuysen JM (1988) Nucleotide sequence of the gene encoding the active-site serine/~-lactamase from Strep- tomyces cacaoi. FEMS Microbiol Lett 49:371-376

Leyh-Bouille M, Coyette J, Ghuysen JM, Idczak J, Perkins HR, Nieto M (1971) Penicillin-sensitive DD-carboxypeptidase from

Streptomyces strain R61. Biochemistry 10: 2163-2170

Lichenstein H, Brawner E, Miles LH, Meyers CA, Young PR, Simon PL, Eckhardt T (1988) Secretion of interleukin-1/~ and

Escheriehia coli galatokinase by Streptomyces lividans. J Bacter-

iol 170: 3924-3929

Long C, Virolle MJ, Chang SY, Chang S, Bibb MJ (1987) e- Amylase gene of Streptomyces limosus: nucleotide sequence,

expression motifs, and amino acid sequence homology to mam- malian and invertebrate e-amylases. J Bacteriol 169:5745-5754 Maniatis T, Fritsch EF, Sambrook J (1982) Molecular cloning.

A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York

Maxam AM, Gilbert W (1980) Sequencing end-labelled DNA with base-specific chemical cleavages. Methods Enzymo165:499--560 Munoz A, Perez-Aranda A, Barbero JL (1985) Cloning and expres-

sion of human interleukin 2 in Streptomyces lividans using the Escherichia coli consensus promoter. Biochem Biophys Res

Commun 133 : 511-519

Nagashima M, Okumoto Y, Okanishi M (1989) Nucleotide se- quence of the gene of extracellular xylanase in Streptomyces

species no. 36a and construction of secretion vectors using xy- lanase gene. In: Koyama Y (ed) Trends in Actinomycetology in Japan. Society for Actinomycetes. Japan, pp 91-96

Noack D, Geuther R, Tonew M, Breitling R, Behnke D (1988) Expression and secretion of interferon el by Streptomyces liv# dans: use of staphylokinase signals and amplification of a neo

gene. Gene 68: 53-62

O'Callaghan C, Morris A, Kirby M, Singer AH (1972) Novel meth- od for detection of/%lactamase by using a chromogenic cepha- losporin substrate. Antimicrob Agents Chemother 1 : 283-288 Ohmura I, Shiroza T, Nakamura K, Nakayama A, Yamane K,

Yoda K, Yamasaki M, Tamura G (1984) A Bacillus subtilis

secretion vector system derived from the B. subtilis e-amylase

promoter and signal sequence region, and secretion of

Escherichia coli/~-lactamase by the vector system. J Biochem

95: 87-93

Palva I, Sarvas M, Lehtovaara P, Sibakov M, Kaariainen L (1982) Secretion of Escherichia coli /~-lactamase from Bacillus subtilis

by the aid of e-amylase signal sequence. Proc Natl Acad Sci USA 79:5582-5586

Piron-Fraipont C, Duez C, Matagne A, Molitor C, Dusart J, Fr6re JM, Ghuysen JM (1989) Cloning and amplified expression in

Streptomyces lividans of the gene encoding the extracellular/3-

lactamase of Aetinomadura R39. Biochem J 262:849-854

Pulido D, Vara JA, Jimenez A (1986) Cloning and expression in biologically active forms of the gene for human interferon X2 in Streptomyces lividans. Gene 45:167-174

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5468

Sanger F, Coulson AR, Barrell BG, Smith AJH, Roc BA (1980) Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J Mol Biol 143:161-178

V6gtli M, Hiitter R (1987) Characterization of the hydroxystrepto- mycin phosphotransferase gene (sph) of Streptomyces glauces- cens: nucleotide sequence and promoter analysis. Mol Gen

Genet 208 : 195-203

Ward JM, Janssen GR, Kieser T, Bibb M J, Buttner M J, Bibb MJ (1986) Construction and characterization of a series of mul- ticopy promoter-probe plasmids vectors for Streptomyces using

the amino glycoside phosphotransferase gene from Tn5 as indi- cator. Mol Gen Genet 203:468-478

Figure

Figure  1  shows  the  revised  sequence  of  the  434  nucleo-  tides  located  upstream  of  the  A T G   initiation  codon  of  the  dac  gene
Fig. 4  A-E. Construction of pDMLI 16 (upper part) and pDML120  (lower part)
Fig. 5. Construction of pDML128, pDMLII6 was linearized with  PstI. PstI ends were blunted by ligation with the synthetic oligonuc-  leotide  5'-CTGCA followed by  addition  of dGTP  with  Klenow  enzyme to  add  the  missing base

Références

Documents relatifs

In these brain regions across these latter ages, PR-ir in male ArKO mice was significantly lower than in WT males and resembled the values seen in WT females, confirming

L’objectif de notre étude était de comparer les caractéristiques phénotypiques des patients diabétiques hospitalisés versus pris en charge en ambulatoire dans le

The variance explained for some properties (apparent density, real density, air reactivity and LC) for the validation set is slightly higher than what is obtained with

coli Animal (106) Lance t Inf ectious Diseases 2016 [78] Cambodia Colis tin resis tance gene mcr -1 and pHNSHP45 plasmid in human isolat es of Esc heric hia coli and

Le pharmacien permet d’optimiser la prise en charge des patients en les sensibilisant au bon usage de leur anticancéreux oral, de diminuer le risque iatrogène en détectant

Les deux activités que nous allons décrire ci-dessous nous permettent de vérifier la mémorisation, la mobilisation et la restitution par les seize élèves de CE2

Cependant, je me demandais aussi s’il était facile pour un enseignant de cycle 3 de mettre en place des moments de langue au quotidien en sachant que les programmes sont