2C.1. Introduction
As the classical co-immunoprecipitation (Part 2A) as well as the proximity-dependent biotinylation assay (Part 2B) could not provide answers regarding the nature of the unknown catalytic subunit of TbAMPK, we decided to develop a screening tool based on protein-protein interactions. The formation of protein complexes, being them dimeric or of higher order, necessarily consists of at least two proteins that interact with each other, thus a two-hybrid system could be used to identify interacting partners.
To this end, a commercial bacterial adenylate cyclase two-hybrid (BACTH) system was re-designed and adapted to make it suitable for screening alpha subunit candidates.
The BACTH system allows the detection of in vivo protein-protein interactions by restoring the activity of the Bordetella pertussis adenylate cyclase in E. coli reporter strains, thus reconstituting the regulatory cyclic adenosine 3’,5’-monophosphate (cAMP) dependent cascade [1, 2]. The catalytic domain of adenylate cyclase consists of 400 amino acids and can be divided into a subdomain of 25 kDa (T25) and one of 18 kDa (T18). Interestingly and importantly, both fragments remain folded and stable in solution but do not reconstitute cyclase activity. However, when two proteins, one fused at T25 and the other fused at T18 both expressed on a separate plasmid, form a complex through protein-protein interactions, the subdomains T18 and T25 are brought close together. This allows to reconstitute the catalytic domain and restore the adenylated cyclase activity. An otherwise adenylate cyclase deficient strain (cya-) will become competent regarding cyclic AMP (cAMP) production. This metabolite recognizes and binds to the catabolite activator protein (CAP) to form a cAMP/CAP complex. This complex binds to various promoters and is indispensable, amongst others, to regulate the transcription of the lactose and maltose catabolic operons (Figure 44). Such a positive interaction can be observed on differential plates by the appearance of blue colonies on LB/X-Gal plate and red colonies on MacConkey plates.
Figure 44 Principle of the BACTH system. (A-C) Expression of the adenylate cyclase domain in E. coli cya- cells.
(A) When the domain is expressed alone there is residual production of cAMP. (B) When the two domain, T18 and T25, are expressed separately there is no production of cAMP. (C) When two protein fused to T18 and T25, respectively, interact they bring together the two subdomains of the catalytic domain and restore the production of cAMP (Figures adapted from [3]). (D) The cAMP produced by the reformed chimeric enzyme bind to CAP to act as a gene transcription regulator and activate the lactose and maltose operons (Figure adapted from[4]).
AMPKs form a heterotrimeric complex composed of a catalytic subunit α and two regulatory subunits β and γ. As such they do not represent a classic two-hybrid interaction system since three proteins that interact with each other are involved (i.e.
α with β, α with γ, and β with γ) [5, 6]. In the framework of this project, it will be of interest to screen both subunit TbAMPKα candidates (gene annotation Tb927.3.4560 and Tb927.10.5310), thus to adapt and modify the BACTH bipartite split-protein system to make it suitable for the detection of fruitful interactions with subunits TbAMPKβ and TbAMPKγ.
Several issues needed consideration. First, the complete heterotrimeric complex will only reconstitute the heterotrimer when all three subunits are expressed simultaneously, thus a third plasmid needed to be designed that would be compatible with both two-hybrid plasmids and that would express the third subunit. Then it cannot be excluded that there will be temporary or stable heterodimers of subunits β and γ, which may later provoke a positive signal in absence of subunit α (false positive read-out). Moreover, two subunits need to be expressed as proteins fused either to T25 or to T18, and this either to the N-terminus or to the C-terminus, meaning 24 combinations
for each subunit α candidate (48 in total) to be tested. In light of the numerous plasmids to be cloned for full coverage it was decided to apply Gateway® technology (Invitrogen) to simplify and speed up the cloning process [7].
A first, more rational, approach was based on in-silico comparison of crystal structures of mammalian AMPK and B. pertussis adenylate cyclase, aiming at the identification of a promising fusion partner combination. The analysis suggested fusing T25 to the N-terminus of the TbAMPKα subunit candidates and T18 to the N-terminus of the TbAMPKγ subunit. The TbAMPKβ subunit would be expressed (without tag or with a His-tag) using the same plasmid harbouring the T18-TbAMPKγ subunit, separated only by an intergenic region containing a Ribosome Binding Site (RBS) sequence.
The second, the complete combinatorial approach, was designed to cover all possible combinations. To this end, 5 plasmids were necessary, four plasmids containing T25 and T18 for N- or C-terminal fusions, and a fifth plasmid expressing the third subunit (untagged).
2C.2. Materials and Methods
2C.2.1. Constructs for first round BACTH
The Gateway-compatible plasmids suitable for BACTH experiments have been created recently [7] (Figure 45) and were a kind gift of Dr. S. Ouellette and Dr. D.
Ladant (Institut Pasteur, Paris).
Figure 45 The Gateway compatible BACTH vectors. Plasmid pST25-DEST and pUT18C-DEST were used for the first analysis. Image taken from [7].
The entry clones for subunits TbAMPKα1 and TbAMPKα2 were created the following way. The genes were amplified from pET30AMPKγβα1 and pET30AMPKγβα2 expression plasmids (for details consult Part 2D) using appropriate primer pairs (Table 16), and the products were transferred to the pDONR-P1P2 applying the protocol provided by the supplier (Life Technologies, BP recombination reaction), furnishing entry vectors for TbAMPKα1 and TbAMPKα2.
The genes for subunits TbAMPKγ and TbAMPKβ were obtained by PCR (from pET30AMPKγβα2) as bicistronic DNA fragment (still containing the intergenic region with the RBS sequence needed for bicistronic expression) and subsequently introduced into pDONR-P1P2 as outlined before to give entry vector for TbAMPKγβ.
The entry vectors were recombined (LR recombination reaction) with pST25-DEST (for TbAMPKα1 and TbAMPKα2; will express T25-TbAMPKα1 or T25-TbAMPKα2, respectively) and pUT18C-DEST (for TbAMPKγβ bicistron) to obtain pST25-TbAMPKα1, pST25-TbAMPKα2, and pUT18C-TbAMPKγβ. The latter plasmid was finally mutated by QuikChange mutagenesis to remove the stop codon of the gene coding for subunit TbAMPKβ which provoked the read-through to a His6-tag located downstream (pUT18C-TbAMPKγβ-His_clone8). This plasmid will simultaneously express T18-TbAMPKγ and C-terminally His6-tagged subunit TbAMPKβ. A second plasmid, pUT18C-TbAMPKγβ-His_clone2, was created by modifying the intergenic region and integrating between the two gene the same promotor as the one present upstream of TbAMPKγ (Table 16).
Table 16 Primer sequences for entry clones construction and T18-TbAMPKγβ modifications
Remove stop codon to obtain the read through (for His-tagged TbAMPKβ) Beta stop for 5’- CCACGGCATCCCTCCAAGAAGGACTAGTGGATCCG -3’
Beta stop rev 5’- CGGATCCACTAGTCCTTCTTGGAGGGATGCCGTGG -3’
Replace the intergenic region between TbAMPKγ and TbAMPKβ for clone 2
CAP dom for 5’- GAGTCAGTGCGGCTGTGGTACCTGAGAAGAGCGCCCAATACGCAAACCG -3’
CAP dom rev 5’-
CTGAACTCCTTGGCGCTGTGTTGTCCCATGGTCATAGCTGTTTCCTGTGTG -3’
2C.2.2. Constructs for second round BACTH
First, the series of destination vectors was completed by constructing the pUT18-DEST vector. The Gateway cassette was amplified by PCR using plasmid pSNT25-DEST as template, reverse primer 5’-AAAAGCTAGCGGATCCCCATCAAACAAGTTTGTAC-3’
(NheI recognition site underlined) and forward primer M13. The product was digested with NheI/KpnI and ligated into plasmid pUT18-zip digested with XbaI/KpnI (NheI and XbaI harbouring compatible cohesive ends) to yield pUT18-DEST. Correct in-frame insertion of the DNA fragment was verified by automated sequencing.
Then a new plasmid, compatible with pST25-DEST/pSNT25-DEST and pUT18C-DEST/pUT18-DEST in respect of the origin of replication and the antibiotic resistance and also harbouring the Gateway cassette, was designed. This plasmid, called
pTRI-DEST, will receive any gene of interest from an entry vector via the LR recombination reaction, providing both a starting ATG codon and a STOP codon. The genes in this plasmid will express the subunit of interest as is and not as a fusion.
Plasmid pTRI-DEST was constructed by assembling four PCR fragments using Gibson cloning technology [8]. The final plasmid contained i) the CloDF13 origin of replication found in pCDM4 (pCDM4 was a gift from Mattheos Koffas (Addgene plasmid # 49796) [9]), ii) the gentamycin resistance gene of pAV1 (Dr. Vadas, University of Geneva), iii) the upstream part of the Gateway cassette of pSNT25-DEST, and iv) the downstream part of the Gateway cassette found in pST25-DEST (Table 17). The fractions were fused in a single go by Gibson assembly using the protocol provided by the supplier (NEB, USA), yielding plasmid pTRI-DEST. The full plasmid was verified by automated sequencing.
Gentamycine for (GmRfwd) 5’- TTACATTAATTGCGTTGCGCCCGCGGCCGGGAAGCCGA -3’
Gentamycine rev (GmRrev) 5’- GTGCCAGCTGGGCGACTTCGCTGCTGCCC -3’
Gateway cassette 1 a2_attB1/a2_attB2 (subunit α2), gb_attB1/g_attB2 (subunit γ), and b_attB1/b_attB2 (subunit β) (Table 18). Subsequent introduction into pDONR-P1P2 (BP recombination reaction) following exactly the recommendations of the supplier yielded the final entry
clones with respect to all subunits. All genes were cloned without start codon (not needed) and without stop codon (not allowed for the purpose of this study).
Table 18 Primers and corresponding sequences used for PCR amplification primer sequence
b_attB2 5’- GGGGACCACTTTGTACAAGAAAGCTGGGTtTTGGAGGGATGCCGTGGGTT -3’
Finally, all four entry clones with respect to the TbAMPK subunits were successfully created and verified by automated sequencing.
2C.2.3. BATCH experiment
Co-transformation of DHMI or BTH101 competent cells with all possible combinations of construct (2 or 3 plasmids) were carried out. The BACTH experiment was performed following Battesti et al. protocol [3]. Briefly, after 5 min incubation of plasmid and competent cells on ice, 0.5 μL of each plasmid (20 ng/μL) was added to 50 μL competent cells. The heath-shock was performed for 90 s at 42°C, after 60 min incubation at 37°C cells were incubated for 48 h at 30°C on 2xTY agar plates containing the correct antibiotics (gentamycine 10 μg/mL for pTRI construct, ampicilline 100 μg/mL for pUT18 construct and spectinomycine 100 μg/mL for pST25 plasmids) for the selection. Several colonies were picked and used to inoculate 3 mL cultures for subsequent overnight incubation (2xTY at 30°C, 150 rpm) containing the
correct antibiotics and supplemented with 0.5 mM IPTG. The day after, 2 μL of each culture was deposited on MacConkey (Difco) agar supplemented with 1% maltose and 2xTY agar supplemented with 40 μg/mL X-gal and incubated at 30°C for several days.
The plates contained the appropriate antibiotics (Gentamycine 10 μg/mL, ampicilline 100 μg/mL, spectinomycine 100 μg/mL) and 0.5mM IPTG. Successful complementation restoring the Cya+ phenotype will produce red colonies on MacConkey/maltose plates and blue ones on 2xTY/X-gal plates.
The plasmids pKT25-zip and pUT18C-zip served as positive controls for complementation (provided by the BACTH kit). They express the T25-zip and T18-zip fusion proteins that can associate because of dimerization of the leucine zipper motifs cloned to the T25 and T18 fragments. When pKT25-zip and pUT18C-zip are co-transformed into DHM1 or BTH101 cell lines they restore a characteristic Cya+ phenotype.
Plasmids pUT18C and pKT25C served as negative control as they express T25/T18 without fusion partner, which does not allow restoring the Cya+ phenotype.
2C.2.4. Competent cells used
Two non-reverting Cya- E. coli reporter strain are provided with the kit and have different genetic backgrounds. Depending on the experiment, the use of one or the other may be more relevant
BTH101: The BTH101 E. coli strain represents a non-reverting adenylate cyclase deficient (cya-) reporter strain with the following genotype: F-, cya-99, araD139, galE15, galK16, rpsL1 (Str r) , hsdR2, mcrA1, mcrB1. This strain grows and exhibits excellent BACTH efficiency, however due to the rec+ background some plasmid instability can occur.
DHMI: DHMI is another E. coli strain that can be used for BACTH experiments. The strain genotype is as follows: F-, cya-854 , recA1, endA1, gyrA96 (Nal r) , thi1, hsdR17 , spoT1 , rfbD1, glnV44(AS). The DHMI strain grows more slowly and has lower complementation efficacy, but It provides better plasmid stability compared to BTH101.
Competent cells were prepared using a calcium chloride method as previously described (Part 2A).
2C.2.5. Western Blot
Western Blot analyses were performed as previously described in Part 2A. Table 19 presents the antibodies (primary and secondary) used in this work. Antibodies were diluted with 3% BSA in TBS-T.
Table 19 List of primary and secondary antibodies.
Tag/epitope 1st antibody 2nd antibody Detection system His-tag mouse anti-His, protein-protein interaction with respect to the subunits TbAMPKα1/TbAMPKα2, TbAMPKγ and TbAMPKβ. However, as the BACTH system is designed to detect interactions between two proteins of interest when expressed as fusions with T18 or T25 at the N or C-terminal end, some adaptations were necessary since TbAMPK consists of three subunits. In TbAMPK it is neither known which interaction pair (α+β, α+γ, or β+γ) nor which fusion (T18 or T25 at either N- or C-terminus), would be the ideal one to obtain a positive signal.
2C.3.1. First rational approach
In light of the numerous plasmids to be cloned it was decided to apply Gateway technology to simplify and speed up the cloning process. In a first attempt to reduce the number of plasmids to be cloned, a potentially successful combination of an interaction pair was identified in-silico by analysing the location and orientation of the N- and C-terminal regions in the crystal structures of human AMPK and B. pertussis adenylate cyclase. It appeared that T25 fused to the N-terminus of the TbAMPKα subunit candidates (T25-TbAMPKα1 and T25-TbAMPKα2) and T18 fused to the N-terminus of the TbAMPKγ subunit (T18-TbAMPKγ) would represent a suitable
combination (data not shown). The third subunit TbAMPKβ could then be expressed via bicistronic expression when located downstream of T18-TbAMPKγ and with the appropriate intergenic region.
All plasmids were successfully cloned and used for BACTH analysis. Two different clones, clone 2 and clone 8, expressing the regulatory subunits TbAMPKγβ were created. In clone 2, the small intergenic region between TbAMPKγ and TbAMPKβ of clone 8 was replaced by the sequence containing the same promoter set-up (CAP binding site, lac promoter, lac operator) present upstream of the TbAMPKγ gene. In both clones subunit TbAMPKβ is expressed with a His6-tag at the C-terminus. In total four different interactions were tested (T25-α1 with T18γ/β_clone2; T25-α1 with T18γ/β_clone8; T25-α2 with T18-γ/β_clone2; and T25-α2 with T18-γ/β_clone 8) on two different differential media.
Positive and negative complementation controls were performed in DHMI cells line and transformations were directly incubated on MacConckey and 2xTY/X-gal differential plates. Positive control transformation using pKT25-zip and pUT18C-zip plasmids (both expressing the leucine zipper of GCN4 [2]) produced the expected Cya+ phenotype (red colonies on MacConkey and blue colonies on 2xTY/X-gal, respectively), whereas the negative control using pUT18C and pKT25C (not expressing the Zip fusion protein) produced white/transparent colonies on both plates (Figure 46 (A)).
However, since only a few colonies grew when spreading the transformation reaction directly on the differential plate, a more complex protocol was implemented for the subsequent tests to allow more efficient expression of the fusion proteins [3]. The final BACTH experiments with the plasmids expressing TbaMPKα1 (or T25-TbaMPKα2) fusion protein together with T18-TbAMPKγ and subunit TbAMPKβ did not restore the characteristic Cya+ phenotype. Indeed, the colonies observed were transparent in both differential plates (Figure 46 (B)).
Figure 46 BACTH analysis. (A) As positive control DHM1 cells were co-transfected with pKT25-zip and pUT18C-zip. As negative control DHMI were co-transfected with pUT18C and pKT25C. (B) DHMI cells co-transfected with α2/pUT18C-γβ clones 8 and 2. (C) DHMI cells co-transfected with α2/pUT18C-γβ and pST25-α1/pUT18C-γβ clones 8 and 2.
Despite the negative outcome of the BACTH experiment, it cannot be concluded that TbAMPKα1 and TbAMPKα2 do not interact with the TbAMPKβ and the TbAMPKγ subunit. It may well be that the heterotrimeric complex is formed but that the adenylate cyclase related domains (T25 and T18) do not approach close enough for reconstituting the cyclase activity. Indeed, it has been found before that these domains can interfere with the formation of the complex of interest [3]. Alternatively, the fusion proteins may not express well or well enough, or the bicistronic expression vector failed to provide the beta-subunit.
To address the latter question T25-TbAMPKα2 and T18-TbAMPKγβ_clone 2 as well as T25-TbAMPKα2 and T18-TbAMPKγβ_clone 8 were co-expressed in LOBSTR-BL21(DE3) cells. An attempt to isolate the complex was made by Nickel affinity chromatography via the His6-Tag attached to the C-terminus of the TbAMPKβ subunit.
Fractions of interest were loaded on SDS-PAGE gels and stained by Coomassie Blue.
Fraction 5-8 of the purification of T25-TbAMPKα2/T18-TbAMPKγβ_clone8 (Figure 47 (C-D)) showed the presence of two bands that were not visible in the corresponding fractions of the purification of T25-TbAMPKα2/T18-TbAMPKγβ_clone 2 (Figure 47 (A-B)). The protein around 40kDa could correspond to TbAMPKβ-His subunit (expected size: 38 kDa) whereas the second band around 75kDa could correspond to the T18-TbAMPKγ fusion protein (expected size: 73 kDa). However, no protein of 95 kDa (the
expected size for the T25-TbAMPKα2 fusion) could be observed, suggesting that the negative BACTH results may be due to the lack of TbAMPKα2 subunit.
Figure 47 TbAMPK complex expression, Nickel affinity purification and Coomassie-stained SDS-PAGE gels with interesting fractions of co-expressed TbAMPKα subunit with clone 2 (A-B) and clone 8 (C-D) both expressing TbAMPKγβ subunits.
A Western blot analysis was carried out to further evaluate the identity of the protein observed around 40 kDa. Probing with an anti-His-antibody revealed two bands, a first one around 40 kDa and a second one around 30 kDa. This result indicates that the protein at 40 kDa indeed represents the full length TbAMPKβ-His subunit while the smaller His-tagged protein most likely corresponds to a C-terminally truncated version of the TbAMPKβ subunit (Figure 48). Interestingly, both variants of the tagged TbAMPKβ subunit were also detected for T25-TbAMPKα2/T18-TbAMPKγβ_clone2 in
the corresponding fractions but at different intensities. Apparently both clones are able to express the subunits via the bicistronic expression system approach.
Figure 48 Western blot analysis against His epitope on TbAMPKβ subunit (LI-COR, odyssey scan)
Taken together these results shows that the rational approach could not provide conclusive results with respect to the identification of the proper catalytic subunits in TbAMPK. Facing the complexity of the problem (size of bipartite split protein fragments, the fusion site to obtain functional subunits, the expression level, fusion protein stability) that may interfere with heterotrimeric complex formation, it was decided to go for a full combinatorial approach, meaning to test all possible fusions (N/C-terminus, for both T25 and T18, for all three subunits).
In order to overcome the problem of the formation of the heterotrimeric complex and investigate others combinations of C- and N- terminus tagging of all subunits, a full combinatorial approach was planned.
2C.3.2. Full combinatorial approach
For the combinatorial approach it was needed to create a series of plasmids for testing all possible combinations of N- and C-terminal fusions of TbAMPKα1, TbAMPKα2, TbAMPKβ and TbAMPKγ subunits with either T25 or T18. Moreover, for this approach a bicistronic expression plasmid was not allowed, thus all three subunits needed to be
expressed in the same bacterial cell from a separate plasmid. The creation of a series of plasmids carrying the subunit alone (pTRI-series) was therefore necessary.
The pTRI-DEST plasmid were designed to harbour the gentamycin resistance cassette, the CloDF13 origin of replication (compatible with the p15A and the ColE1 origin of replication of the other two plasmids) [10] and the Gateway cassette (Figure 49).
The plasmid needed for fusing the subunits of interest to the C-terminus of T18 was successfully cloned by introducing the Gateway cassette of pSNT25-DEST into pUT18-zip plasmid (Figure 49).
Figure 49 Destination vectors created for full combinatorial approach corresponding to pTRI-DEST and pUT18-DEST.
The entry clones for all TbAMPK subunits were successfully created by amplification of the gene of interest and subsequent integration into pDONR-P1P2 (Figure 50).
Figure 50 Entry clones created for the full combinatorial approach carrying the TbAMPKα1, TbAMPKα2, TbAMPKβ and TbAMPKγ gene.
Finally, five plasmids were successfully created for each subunit, affording a total of 20 plasmids required for the full combinatorial approach. Each subunit was integrated in the plasmids, allowing the fusion of subdomains T25 and T18 at the N- or C- terminus while pTRI would express each subunit alone. The same was accomplished with zip gene which served as positive controls (Figure 51).
Figure 51 Example with the ZIP-tagged plasmids of a complete-set of vectors needed for the BACTH experiments for each subunit. ZIP tagged in C and N-terminus of pUT18 (pUT18C and pUT18) and in pST25 (pST25 and pSNT25) as well as ZIP cloned into pTRI plasmid.
Several combinations of positive and negative controls were tested. The interaction of
Several combinations of positive and negative controls were tested. The interaction of