Plasmid purification

Bacteria transformation

100 ng (0.5 µl) of the DNA vector were mixed with 100 ul of TOP 10 competent bacteria.

After 30 min incubation on ice, the mix was heat-shocked during 45 seconds at 42°C. 250 µl of LB medium was added into the mix and kept at 37°C during 1 h in the water bath for recovery. 20 µl of the mix was plated on a 10 cm dish with LB-agar and ampicillin (100mg/ml) 1/1000 and incubated overnight at 30°C to reduce recombination event probability. The remaining transformed bacteria were frozen with 30% of glycerol 87% and kept at -80°C.

Bacteria culture and maxi-prep

After overnight incubation on LB-agar dish, only the cells that integrated the plasmid had grown. Single colony was picked and transferred into a 15 ml falcon tube containing 5 ml LB medium and 5 µl ampicillin for the overnight incubation at 30°C. Bmal1-luciferase is a low copy number plasmid and required a maxi-culture with important quantities of LB medium.

The next day 800 µl (1/500) of bacteria was incubated overnight at 30°C in 400 ml of LB medium containing 400 µl ampicillin. For Bmal1-luciferase plasmid, 3.2 L of LB medium

57 was used per maxiprep extraction, whereas for Per2-luciferase plasmid, 800 mL of LB culture was used per prep.

To purify the plasmid, the maxi-prep was performed using a JETSTAR maxikit (Brunschwig) based on a gravity flow procedure. Basically, after centrifugation of the medium, the cells are lysed, neutralized, washed and the DNA was eluted according to the manufacturer protocol.

Isopropanol precipitation was employed to obtain ultrapure DNA.

Plasmid digestion

To analyse the obtained plasmids, enzymatic restriction of the plasmid DNA was systematically performed. Nco I and Bgl II restriction enzymes were used to digest Bmal1-luc and Per2-luc plasmids. The digestion mix contained (for one mix): 1 µg of DNA, 2 µl of NEBuffer 3 (NEB), 0.2 µl of BSA 100x, 15.8 µl of H2O and 1 µl of Nco I or Bgl II (10 units/µl). The digestion mix was incubated during 1 hour at 37°C, and the digested fragments were separated on 1% agarose gel (Figure 10).

Figure 10. Restriction digest of the plasmid Bmal1-luc with Nco I and Bgl II. 1: 2 log ladder (NEB 0.1-10 kb), 2: Nco I, 3: Bgl II. The digestion using Nco I gave 5 fragments (approx. 200, 500, 1300, 2500 and 4300 b) while the digestion with Bgl II gave 4 fragments (approx. 500, 1300, 3000 and 4000 b).

1 2 3

58 6.6. Lentivirus production and titration

Lentivirus production

The Bmal1-luciferase (Bmal1-luc) or Per2-luciferase (Per2-luc) lentiviral particles [132]

were produced by transient transfection in 293T human embryonic kidney (HEK) cells using the polyethylenimine (PEI- 25 kDa, Polysciences) method [148]. HEK293T cells were transfected at 30-50% confluence, plated in 10 cm dish containing 10 ml of DMEM supplemented with 4.5 g/l glucose, 10% FCS and 1% P/S. To prepare the transfection mix for one 10 cm dish, 2 ml of OPTI-MEM® (InVitrogen) medium was preincubated for 10 min at room temperature, with subsequent addition of 12 µg of DNA vector of interest (concentration varied between 200 ng/µl and 1 µg/µl), 8.4 µg of psPAX2 (1 µg/µl) and 4.2 µg (1 µg/µl) of pMD2G. psPAX2 and pMD2G are packaging and envelop plasmids respectively, allowing for the viral particle production. The plasmids were mixed by vortex and kept during 5 min at room temperature.

Following 5 min incubation at room temperature, 55 µl of transfection reagent PEI (1 µg/µl) was added, the tube was mixed by vortex and kept 30 min at room temperature to let the formation of the transfection complexes formed by the association of transfection reagents and the plasmids. 2 ml of the solution is then distributed into the dish drop wise. The PEI allows the penetration of the transfected plasmids into the cells by endocytosis due to its ability to condensate the DNA and form DNA-PEI polyplexes. After 6-8 hours, the transfection medium is replaced by 12 ml of normal culture medium.

To control the transfection efficiency, parallel dish with 293T cells was transfected with PWPTS-GFP plasmid. The day after the transfection, the efficiency was evaluated by fluorescence microscopy (Figure 11).

59 Two days following the transfection the cells are expected to reach the peak of production of lentiviral particles which are delivered into the medium. The medium containing lentiviral particles is collected and filtered through 0.45 mm filter.

Lentivirus concentration

The collected particles were concentrated to 100 fold into smaller volumes. For concentrating lentiviral particles, medium collected at the previous step was distributed equivalently in the ultracentrifuge tubes and subjected to ultracentrifugation at 26000 RPM during 2h10min at 4°C (Beckman coulter ultracentirfuge, rotor SW 52). The supernatant was then discarded and the pellet was resuspended in 200 µl of PBS (100-fold concentration). The resulting concentrated solution was aliquoted and stored at -80°C.

60 A. B.

C.

Figure 11. Efficiency of lentiviral transfection. A: DIC, B: FITC, C: merge. 293T human embryonic kidney cells transfected with lentivector containing PWPTS-GFP plasmid using the PEI method. The efficiency of the transfection was 80%.

Lentivirus titration

The virus titre was determined using HT1080 cells. 50 000 cells were plated in a 3.5 cm dish with 1 ml medium at 70 % confluence one day prior to the transduction. The cells were transduced with 10 µl of 100X concentrated lentivectors (PWPTS-GFP or Bmal1-luc or Per2-luc). 24 hours later, the medium was replaced, and four days later, lentiviral expression

61 reached maximal levels. The virus titration was then outsourced to Pr. J. Kiss laboratory at the CMU. Basically, the titration was performed by qPCR and FACS. One plicate of transduced cells with PWPTS-GFP was used for fluorescence-activated cell sorting (FACS) and DNA was extracted from the other plicate. Cells transduced with either Bmal1-luc or Per2-luc were subjected to DNA extraction only (DNAeasy kit, Qiagen). Before FACS assay, cells transduced with PWPTS-GFP lentivector were centrifuged and resuspended in PBS + 1%

formaldehyde. BD Accuri^tm C6 flow cytometer (BD biosciences) was used to define the percentage of GFP positive cells.

qPCR was performed on the extracted DNA to measure the number of copies of lentivectors integrated in the cells. GAG gene expression is measured since it is specific to HIV-1 vectors and Human beta actin gene (HB2) was used to normalize for the amount of genomic DNA.

The following primers were used:

GAG forward 5'- GGAGCTAGAACGATTCGCAGTTA - 3' reverse 5'- GGTTGTAGCTGTCCCAGTATTTGTC - 3'

HB2 forward 5' – TCCGTGTGGATCGGCGGCTCCA - 3' reverse 5'- CTGCTTGCTGATCCACATCTG - 3'

A mix containing 4 µl of reverse and forward primers (0.86 µM), 5 µl of master mix SYBR green I and 1µl of DNA for a total volume of 10 µl were added to eachwell (qPCR reaction).

The qPCR was performed using Lightcycler® 480 (Roche, Reinach, Switzerland). The pre-incubation allowing for enzyme activation was done in one cycle during 10 minutes at 95°C.

The amplification was done during 40 cycles, with each round including denaturation during 15 seconds at 95°C, pairing, elongation and acquisition during 60 seconds at 60°C. Each biological sample was assessed in technical duplicates.

62 To determine the titer, a standard curve was generated using known copy number of particles per cells of different dilutions of DNA. The exponential formula derived from this curve is applied on the unknown samples to obtain the copy number of particles per cell. The following equation determines the titer (Protocol from Patrick Salmon’s lab [149]):

Titer (cells-transducing units / ml) = 100000 (target cells) x number of copy per cell of the sample / volume of supernatant (ml).

Typical lentivirus titers obtained for our preparations were 1.10⁴ units/ml for Bmal1-luc and 3.10⁴ units/ml for Per2-luc.