Materials and methods

Materials

Recombinant rat and human agrin was purchased from R&D System and horse serum from ThermoFisher scientific. YFP–STIM1 was a gift from Dr Anant B. Parekh (University of Oxford, UK) and YFP-STIM2 was obtained from Addgene. YFP–STIM1L was constructed as previously described (Darbellay, Arnaudeau et al. 2011).

Cell culture and transfection

Stim1^-/-/Stim2^-/- MEFs (DKO cells) generated by targeted gene disruption (Oh-Hora, Yamashita et al. 2008) were a kind gift from Dr Masatsugu Oh-hora (Tokyo Medical and Dental University, Tokyo, Japan). DKO cells were cultivated and transfected as previously described (Sauc, Bulla et al. 2015).

Human primary myoblasts were expanded from satellite cells obtained after enzymatic cellular dissociation from human muscle sample. Samples were obtained from patients without known neuromuscular disease after informed consent, as approved by the University Hospital of Geneva Research Committee on the use of humans as experimental subjects (Protocol CER n°12-259 and n°05-078). All work on human subjects was carried out in accordance with the Declaration of Helsinki. After dissociation, two methods were used to obtain a pure population of myogenic cells: clonal selection (figure VII.1B) or FACS (figure VII.5 and figure VII.6) as described in (Arnaudeau, Holzer et al. 2006) and (Laumonier, Koenig et al.

2017) respectively. Myoblasts were cultivated and the differentiation induced as indicated in (Laumonier, Koenig et al. 2017). For myofibers differentiation, cells were cultured on a Matrigel (Dutcher) layer diluted 1:100 in F-10 medium. 2 days after changing from GM to DM, a second layer of matrigel diluted at 1:3 in DM was apposed onto the myotubes and DM was changed every 2 days until the end of the experiment.

Immunoprecipitation and Western blotting

Muscle biopsies were cut into small pieces (<1 mm³) in lysis buffer (0.5% Nonidet NP-40, 0.5%

CHAPS, 50 mM Tris pH 7.4, 250 mM NaCl, 5 mM EDTA) supplemented with protease inhibitor cocktail tablets from Roche and let for 30 min on ice. Lysates were clarified by centrifugation and protein extracts were estimated using a Bradford-based detection method (Protein Assay Dye Reagent from Bio-Rad). For myotube protein extraction, cells were washed twice in PBS and the same procedure as for biopsies was applied. For each immunoprecipitation between 400 μg and 500 μg of protein extracts were incubated with 5-6 μg and 2-5 μg of STIM1 (Rb Ab, AB9870, Millipore) and dystrophin (Rb Ab, Ab15277, Abcam) antibody respectively at 4°C during 1h on wheel. Protein A/G dynabeads (Thermofisher scientific) were added to the immune complexes and let overnight on wheel at 4°C. The negative control was performed

using lysates with dynabeads without any antibody. Nonspecifically bound proteins were removed by washing the beads three times with 1 ml of lysis buffer, and bound material was solubilized in 2X Laemmli sample buffer, boiled for 90 s, and resolved by SDS-PAGE. The proteins were transferred onto nitrocellulose membranes, which were blocked with TBST buffer (20 mM Tris-HCl, pH 7.5, 147 mM NaCl, 0.1% Tween 20) containing Polyvinyl Alcohol 0.01%. Blots were incubated with the primary antibodies diluted in 5% BSA TBST as follows:

rabbit polyclonal antibody against STIM1 (1∶2000; Millipore), engineered rabbit monoclonal antibody against STIM1L (1μg/ml, Geneva Faculty of Medicine), rabbit polyclonal antibody against dystrophin (1∶200; LS-C202905/53620, LSBio), mouse monoclonal antibody against α-Tubulin (1∶10000; clone DM1A, Sigma). Membranes were then incubated with horseradish peroxidase-conjugated anti-mouse (#1721011, Bio-Rad, 1:6000) or anti-rabbit (#7074, Cell Signaling, 1:6000) secondary antibodies diluted 1∶6000, and the immunoreactive proteins were visualized with an ECL detection system.

Immunostaining

Immunostainings were realized following the same protocol on tissue and cells. Concerning tissue preparation, hamstring muscle samples were embedded in Tissue Tek (Sakura Finetek), cut in 5-μm cryo-sections and stored at –80°C until use. Cryo-sections or cells were washed once with PBS and fixed with paraformaldehyde 4%. Then, samples were washed 3 times with PBS before incubation in a mix of Triton X-100 0.3% and goat serum 5% in PBS during 1h for permeabilization and blocking procedures. Engineered rabbit or mouse monoclonal against STIM1L (10μg/ml; Geneva Faculty of Medicine), rabbit polyclonal anti-MEF2 (1∶200; C-21, Santa Cruz Biotechnology), mouse monoclonal anti-SERCA1 and anti-SERCA2 (1∶200; ab2819 and ab2861 respectively, Abcam), mouse monoclonal anti-spectrin (1:100; LS-C202905/53620, LSBio), rabbit polyclonal anti-STIM1 (1:200; S6197, Sigma), mouse monoclonal anti-RyR1 (1:200; 34C, Hybridoma bank), α-actinin (1∶200; EA-53, Sigma), mouse monoclonal anti-Myosin heavy chain (1∶200; MF20, Hybridoma bank) antibodies were diluted in antibody buffer solution (PBS, BSA 1%, Triton X-100 0.3%) before being applied on samples overnight at 4°C. The secondary antibodies were used at 1:6000 : Alexa-Fluor 488 labeled goat anti-mouse IgG, Alexa-Fluor 546 labeled goat anti-rabbit IgG, Alexa-Fluor 546 labeled goat

anti-Mouse IgG2b (Thermofisher scientific) together with DAPI (100 ng/ml; Sigma). After extensive 3 washes with PBS, cover glasses were mounted on microscope slides using Immu-Mount (ThermoFisher scientific) and examined on a Zeiss confocal laser scanning microscope.

Real-time PCR

Total RNA was extracted from human muscle biopsies and muscle cells using TRIzol and 0.5 µg of total RNA was reverse-transcribed with the PrimeScript^TM RT reagent Kit (TaKaRa) according to the manufacturer’s instructions. Real-time PCR experiments were performed at the Genomics Platform of Geneva Faculty of Medicine ( http://www.ige3.unige.ch/genomics-platform.php). For each PCR reaction, 1/6^th of the cDNA template was PCR-amplified on a SDS 7900 HT instrument (Applied Biosystems). Raw threshold-cycle (Ct) values were calculated with SDS 2.2 software (Applied Biosystems). A mean quantity was calculated from triplicate PCR reactions for condition, and this quantity was normalized to the average of two endogenous control genes (β2 microglobulin and ALAS1) as described by Vandesompele et al.

(Vandesompele, De Preter et al. 2002). Fold changes obtained for each condition were then normalized by quantity in adult sample. Primers used for the real-time PCR are listed in the following table (all sequences are oriented 5’-3’):

Gene Sense Antisense

SERCA1 CAGTGGCTGGCTCTTCTTC GCACCCACATAGCCCCC

SERCA2 CCTTGAGGACTCTGCCAACTTT ACGAAGGTCAGATTGGTCTCATATT

RyR1 TGGCCATCATCCAGGGTCT GGTCTCGGAGCTCACCAAAAG

DHPR GTGCTCAGCACCAGCTACAGC CCTCGAACCAGAGCCTTTTG

MYH7 AGGAGCTCACCTACCAGACGG GCAGCCGCAGCAGGTTT

MYH2 AAACTGGAGGCCAGGGTACG TTGCTCACTCTCAACCTCTCCTT

MYH1 CAAGCTGAAGAAGCGGAGGA GCGGAATTTGGAGAGGTTGAC

β2 microglobulin TGCTCGCGCTACTCTCTCTTT TCTGCTGGATGACGTGAG-TAAAC

ALAS1 CTCACCACACACCCCAGATG AGTTCCAGCCCCACTTGCT

Statistics

All analysis was performed with GraphPad Prism 7 software. All values are reported as mean

± S.E.M.