Ghila and Gomez, 2008; Supplementary material
ANNEX 1: Materials and Methods
Strains
The strains used in this study were maintained as described (Brenner, 1974). lnp-1-deleted strains lnp-1(tm1247) and lnp-1(tm733) were obtained from “The National Bioresource Project for the Experimental Animal Nematode C.elegans” (NBRP; Japan) and outcrossed 3x with N2 animals. NW1229 (evIs111 (F25B3.3::GFP); from O. Hobert, Columbia University, New-York).
NM306 (jsIs1I (pSB120[psnb-1::SNB::1:: GFP];pRF4[rol-6]) from M. L. Nonet, Washington University, St-Louis). CB1265 (unc-104(e1265)). NL4256 rrf-3(pk1426). Some nematode strains used in this work were provided by the Caenorhabditis Genetics Center (CGC; University of Minnesota, Minneapolis).
Constructs
plnp-1::LNP-1 consists of a 4158bp genomic fragment, including a 2748bp genomic region upstream of the lnp-1 ATG start (plnp-1) and a 1680bp genomic lnp-1 coding sequence (LNP-1). psiah-1 consists of a 3247bp genomic region upstream of the siah-1 ATG start and the first four codons. All these fragments were generated by PCR and subcloned into either pPD95.75 GFP vector (from A. Fire, Stanford University School of Medecine, Stanford) or pPD95.75 RFP (from O. Hobert, Columbia University, New-York).
GST constructs, GST::LNP-1/LNP and GST::&LNP-1/&LNP, GST-SIAH-1: C.elegans lnp-1 cDNA (full-length coding region) was generated from total RNA as described by the supplier (cDNA synthesis system/Promega). Total RNA was isolated as described by the manufacturer (RNeasy kit, Qiagen). lnp-1 cDNA (fragment 1-1026nt) and &lnp-1 cDNA (fragment 473-1026nt) were amplified by PCR. Mouse lnp and &lnp cDNA were isolated by digestion from the pBSK::lnp cDNA plasmid (from Denis Duboule’s laboratory, University of Geneva, Switzerland).
siah-1 cDNA (full-length coding region 1-1260nt) was amplified by PCR using pY37E11AR.d plasmid as template (Open/Biosystems). The resulting fragments were subcloned into the pGEX4T1 vector (GE/Healthcare).
Yeast two hybrid construct: &lnp-1 (fragment 313-1026nt) was amplified by PCR from pGEX4T1::LNP-1 and subcloned into the pPDleu yeast vector (Invitrogen). Immunoprecipitation constructs, pCIHA::%LNP-1 and pCDNA3FLAG::SIAH-1. &lnp-1 (fragment 313-1026nt) and siah-1 (fragment 15-1251nt) were amplified by PCR from pGEX4T1::LNP-1 and pGEX4T1::SIAH-1, respectively, and subcloned into pCDNA3.1 FLAG and pCIHA vectors (from Denis Duboule’s laboratory, Geneva University, Switzerland).
RNAi construct, pPD129.36::&LNP-1. &lnp-1 fragment was isolated by digestion of pGEX4T1::LNP-1 with NcoI and XhoI, resulting in a 873 bp fragment subcloned into the pPD129.36 vector (from A. Fire, Stanford University School of Medecine, Stanford).
All constructs were checked for correct orientation and sequence (table 1).
Table 1. Oligo sequences and DNA templates used in PCR reactions:
constructs name 5’ oligo 3’ oligo template
plnp-1 5’GGAGCAAGATCTAAAAAAAAA
C.elegans GST::LNP-1(1-341), GST::&LNP-1(159-342; lacking the two transmembrane domains), GST::SIAH-1(1-419) and mouse GST::&LNP(223-425) proteins were produced in BL21 E.coli as described (Guan and Dixon, 1991). The proteins were expressed at 37°C except for GST::SIAH-1 which was expressed at 20°C. Proteins were purified using glutathione-sepharose beads (GE/Healthcare).
For antibody production, GST::&LNP, GST::&LNP-1 and GST:: &SIAH-1 beads were recovered in the supernatant by thrombin digestion (GE/Healthcare).
Anti-&LNP-1/&LNP antibodies: Rabbits were immunized with GST::&LNP-1 or GST::&LNP according to the manufacturer (Eurogentec). The resulting antisera were affinity immunopurified on &LNP-CNBR-activated sepharose beads (GE/Healthcare). Their specificities were confirmed by Western blot and antigen competition experiments (by Marie Gomez).
Transgenic animals and Rescue experiments
Transgenic worms were generated as previously described (Mello et al., 1991). Transgenes were microinjected at 20 ng/µl. Rol-6 was used as injection marker and injected at 50 ng/µl. In rescue experiments the plasmid was injected at the concentration of 50 ng/µl. pttx-3::RFP or the intestinal marker elt-2::GFP were used as markers and injected at 50 ng/µl. At least three independent transgenic strains were analyzed.
Yeast two-hybrid screen
Yeast two-hybrid experiments were performed using the Proquest system (Invitrogen) as described by the supplier. Briefly, we realized two independent screens (resulting in 2.106 colonies analyzed). MaV203 yeast cells were cotransformed with the bait pPDleu::&LNP-1 and the prey library (Proquest C.elegans cDNA library, Invitrogen). Transformations were plated on SC-Leu-Trp-His+10 mM 3AT plates and incubated at 30°C for 60 to 72 hours. A total of 8 colonies were growing under the selection plates, which resulted to be all positive in X-Gal assays. The clones were further analyzed by sequencing.
Transfection and Immunoprecipitation
HEK293T cells were transiently cotransfected with FLAG::SIAH-1 and HA::&LNP-1 plasmids using Lipofectamine TM2000 (Invitrogen) as described by the manufacturer. After 48 hours, cells were lysed in cold lysis buffer (20 mM Hepes pH 7.4, 150 mM NaCl, 0.1% Nonidet P-40, 1 mM EDTA, 1 mM PMSF, protease inhibitor cocktail tablets) and immunoprecipitated with anti-HA antibody. The complex antibody-antigen was pulled down with protein G coupled agarose beads (EZviewTM red protein G affinity gel; Sigma). Beads were washed several times with lysis buffer. Bound proteins were eluted in SDS sample buffer and separated by SDS-PAGE and analyzed by immunoblotting with the appropriate antibodies at the dilution indicated by the supplier.
RNAi feeding experiments
(RNAi) bacteria clones: lnp-1(RNAi) bacteria clone was obtained by transforming pPD129.36::&LNP-1 into HT115(DE3) E.coli strain as described (Kamath, 2001). siah-1(RNAi) bacteria clone (Y37E11A_93.G) was obtained from the MRC geneservice.
Bacterial feeding RNAi experiments were performed as previously described (Kamath et al., 2001). Briefly single bacteria colonies were picked and grown in LB medium with ampicilin and incubated at 37°C for 8-10 hours. For bacterial induction, bacteria were seeded on NGM plates containing IPTG and ampicillin and allowed to dry overnight at room temperature. For non-induced control experiments bacteria were seeded on plates containing only ampicillin.
For behavioral assays, we used the hypersensitive RNAi rrf-3(pk1426) strain, which was maintained at 16°C. Eggs were prepared from rrf-3 gravid adults using a hypochlorite treatment as described (Lewis, 1995). 100 to 200 eggs were placed per plate. After 5 days of RNAi treatment at 16°C, young adults were tested for behavioral experiments (e.g. aldicarb treatment, thrashing assay).
Behavioral Assays
Sensitivity to aldicarb: Acute sensitivity to aldicarb was determined by a full time course of the onset of paralysis assay following acute exposure of a population of animals to aldicarb as previously described (Sieburth et al., 2005). For each strain, 25–30 worms were placed on NGM plus 0.5 mM aldicarb plates and prodded every 30 minutes over a 6 hour period to determine if
they retained the ability to move, worms that did not respond to repeated prodding were classified as paralyzed. Each experiment was repeated three times.
Thrashing behavior: was performed as previously described (Miller et al., 1996). Young adults hermaphrodites were placed in glass chambers containing 100 µl of M9 buffer. After a 5 minutes recovery period, thrashes were photographed for 1 minute using Improvision OpenLab 5.0.1 and a Leica/DFC320 camera connected to a Leica/MZ125 binocular and counted manually. One thrash was considered as a change in the direction of bending at the mid body.
Serotonin-induced egg-laying assay: Young adult hermaphrodites were placed individually in microtitre wells containing 100 µl of 7.5 mM serotonin (Sigma) in M9 solution as described (Trent et al., 1983). After 90 minutes the number of eggs in each well was counted.
Nose-touch response: was assayed as previously described (Hart et al., 1995). Each animal was tested on food for reversal of locomotion after a forward collision with a hair. Each animal was tested 10 times and 10 animals were tested for each genotype.
Spontaneous reversal frequency: was assayed as described (Zheng et al, 1999). Single young adult hermaphodites were placed on NGM plates in the absence of food. The animals were allowed to adjust to the plates for 5 minutes. The number of spontaneous reversals for each animal was counted over a 5 minutes period. 10 animals were tested for each genotype and reported scores reflect the mean number of reversals per minute.
Immunohystochemistry
On whole worms: Immunohystochemistry was performed as previously described (Ghila et al., 2008). L4 larvae/young adults were washed in PBS and fixed for 4 hours in Lavdowsky fixative (50% ethanol, 10% acetic acid, 4% formaldehyde in water). Then worms were washed in PBS and incubated overnight in 2% TritonX-100/PBS. The larvae/eggs were permeabilized by microwave 7 minutes at 750W and incubated 30 minutes in 0.1% NaCitrate/0.5% TritonX-100/PBS. They were then washed in 0.5% TritonX-100 in PBS (PBST), and treated with 3%
H2O2/PBS (blocking the endogenous peroxidase), blocked in 2% BSA/PBST and incubated overnight at 4°C with the appropriate first antibody (e.g. anti-LNP-1 1:500; anti-GFP 1:200, Roche; see Table 2). Animals were washed in PBST and incubated for 3 hours at room temperature with the corresponding secondary antibody diluted 1/100 (anti-rabbit HRP, Jackson; anti-mouse HRP, Sigma) as described in the TSA Kit #2, 15 or 40 kit protocols (Molecular Probes) and with detection time of 12 minutes. The larvae/young adults were washed in PBS and water, mounted in Mowiol and examined on Axioplan2/Zeiss microscope equipped with a Plan-Apochromat 40x objective. Images were acquired through a Leica/DFC480 camera using the Openlab System Software (Improvision). Confocal imaging was performed on a Leica/TCS/SP2/AOBS microscope. The images were processed using PhotoshopCS software (Adobe Systems). For all colocalization imaging, Z-stacks were acquired and average or maximum projection was recorded.
Fluorescence Analysis and Quantification
Measurements of SNB-1::GFP, RAB-3::Venus and GLR-1::GFP puncta were performed on confocal images as described previously (Ackley et al., 2005; Dai et al., 2006; Ghila et al., 2008) Synchronized worms were imaged in the same day, in the region between nerve ring and anterior gonad bend (50 µm were selected in this area). Images with minimal fluorescence saturation were obtained using identical laser settings. For each worm a 3.5 µm Z-stack containing 20 Z-planes was acquired. Confocal images were projected into a single plane using maximum projection and exported as tiff file with a scale bar. Using ImageJ 1.34s (NIH, USA), the files were converted to a binary image and the fluorescence profile was analyzed using plot profile command. This command displays a two-dimensional graph of the intensities of pixels along a line within the image (in our case ventral cord or dorsal cord). The x-axis represents distance along the line and the y-axis is the pixel intensity. The listed pixel intensity table was generated in 1-pixel increments. The total and average pixel intensities were calculated. The threshold was set by using the threshold command so that the binary images resembled the RGB image. The analyze particle command was used with a minimum size of 4 pixels and a maximum size of 10.000 pixels and the outline particles, exclude on edges, include interior holes and reset counter options were selected. Scaling was set by measuring the scale bar (GFP images 10 pixels equaled 1 µm). The resulting measurement were exported to Microsoft excel for statistical analysis.
In vitro ubiquitination assays
0.01 to 0.25 µg of GST::SIAH-1 was incubated with 50 nM E1, 500 nM GST::UbcH5c, 10 µM 6xHis-tagged ubiquitin and 2 mM ATP in reaction buffer (50 mM Tris-Cl, pH 7.5, 2.5 mM MgCl2 and 0.5 mM DTT). 0.2 to 5 µg of purified GST::%LNP-1 was added to the reaction as indicated.
After 90 minutes incubation at room temperature, the reactions were quenched by addition of 2x SDS-PAGE gel loading buffer, separated by SDS-PAGE and analyzed by immunoblotting with an anti-Ubiquitin antibody to visualize polyubiquitinated conjugates.
In vitro SUMOylation assays
The in vitro SUMOylation reaction was performed as described in the protocol from SUMOylation kit (Biomol Int). 200nM of LNP-1::GST was incubated with 1#M SUMO E1, 10#M SUMO E2, 0.1#M Mg-ATP and 5#M of either His6-SUMO 1/2/3. As a control reaction 4#g of RG1 protein was used. After 60 minutes incubation at 30°C, the reactions were quenched by 2xSDS-PAGE gel loading buffer and analyzed by western blotting.
Cell cultures
C3H/3T3 cells (ATCC no. CCL-226) were cultured on 6-well plates or coverslips in DMEM media (Gibco no. 10313) supplemented with 3% FBS (Gibco no. 26140), 4 mM L-glutamine (Gibco no. 25030), and antibiotics (100 U/mL penicillin, 100 U/mL streptomycin). Cells were
grown at 37°C with 5% CO2. Culture media was replaced every 3–4 days of growth. Cells were plated in triplicate from initial cultures at densities of 100 cells/cm2 and subcultured every 7 days (7–8 cell doublings per passage).
Lnp gene silencing
The transfection with Hiperformance 2-for-Silencing siRNA duplexes (Qiagen) was performed conform RNAi Human/Mouse Control Kit Handbook (Qiagen). Target sequence of the siRNA duplexes were duplex-1: AAGGTTTGATCCAGACTCAAA and duplex-2:
AAGAAACTTATAAGACAGCTA. One day before transfection 105 C3H fibroblast cells were cultured in 12-well plate in 0.5 ml of DMEM medium and incubated under normal growth conditions. Cells were transfected using RNAiFect Transfection Reagent. The final concentration of siRNA used was 100nM. Cells were incubated with the transfection complexes under normal growth conditions for 72h. The transfection efficiency was monitored at the protein level by IF on transfected cells that were analyzed by confocal imaging and at the mRNA level by real-time RT-PCR. The RNeasy system (Qiagen) was used for purification of high quality of total RNA. First-strand complementary DNA synthesis was performed in the presence of 250 ng/#l random hexamer primers and the SuperScript II Reverse Transcriptase (Invitrogen).
Quantitative PCR was performed using the Taqman Applied biosystem kit in a Light-Cycler (Roche). Real-time PCR experiments are performed on 7900HT SDS system (Applied Biosystems) at the NCCR Frontiers in Genetics Genomic Platform. The expression data were compared with levels of three housekeeping genes (Tbp, Tubb4, Rps9) to normalize for variable amounts of RNA in different samples.
Immunocytochemistry
On fibroblast cells: cells cultured on coverslips were fixed with 4% PFA, quenched 5 minutes with 30 mM NH4Cl/PBS, washed 5 minutes in 0.1% TritonX-100/PBS, permeabilized with 0.1%
saponin in PBS/serum buffer, blocked for 1 hour in 2% BSA and incubated overnight at 4°C with primary antibodies (anti-LNP 1:500; anti-actin, 1:1000, Sigma; anti-a-tubulin 1:2000, Abcam;
anti-TfR 1:100, Zymed; anti-EEA-1 1:50, Abcam; anti-LBPA(GC4) 1:50, gift from J. Gruenberg;
anti-vinculin 1:500, Sigma). Cells were washed in PBS and incubated for 2 hours at room temperature with the corresponding secondary antibodies AlexaFluor488 and AlexaFluor555 (1:500, Molecular Probes). The nuclei were stained for 10 min in DAPI 1#g/ml. Cells were mounted in Mowiol and examined on an Axioplan2 Zeiss microscope. Pictures were captured with a Leica TCS/SP2/AOBS confocal microscope equipped with a 100' Plan-Apochromat objective and HeNe1, HeNe2 and Argon lasers. The images were processed using PhotoshopCS software (Adobe Systems).
In vivo endocytic transport assay: Cells were grown on coverslips and then incubated with 3 mg/mL rhodamin-dextran for 10 min at 37°C in DMEM containing 10 mM Hepes medium. Cells
were re-incubated in marker-free medium for an additional 40 min at 37°C. Then, cells were fixed in 4%PFA and processed for immunofluorescence, as above.
On PC12 cells: cells were grown on polylysin-coated glass coverslips and differentiated with NGF (100 ng/ml; Alomone labs) for 72 hours. Cells were fixed with 4% PFA and IF was performed as described above. The primary antibodies used were LNP 1:500; anti-synaptophysin 1:100, VP-38 clone, Sigma; anti-a-tubulin 1:2000, Abcam; anti-kinesin 1:200;
anti-TfR 1:100, Zymed.
Fluorescence analysis and quantifications
Images with minimal fluorescence saturation were obtained using identical laser settings.
Confocal images were exported as tiff file with a scale bar. To quantify the total fluorescence in mock- and lnp RNAi-treated cells, we used the ImageJ 1.34s (NIH, USA) plot profile command.
The total and average pixel intensities were calculated. The resulting measurement were exported to Microsoft excel for statistical analysis.
Table 2. Antibodies utilized for indicated applications in this study:
Antibodies Species Dilution Application Company
Primary antibodies
Mouse LNP rabbit 1:500 WB/IF Our lab (Eurogentec)
C. elegans LNP-1 rabbit 1:250 WB/IF/IHC Our lab (Eurogentec)
C. elegans SIAH-1 rabbit 1:250 WB Our lab (Eurogentec)
SIAH-( goat 1:100 WB/IF/IHC Santa Cruz (H18):sc-5504
Tubulin mouse 1:2000 WB/IF/IHC Sigma
Actin mouse 1:1000 IF Sigma
hTfR mouse 1:100 IF Zymed Laboratories Inc
EEA-1 mouse 1:50 IF Abcam ab15846
LBPA (GC4) mouse 1:50 IF Gift from Prof. Gruenberg (Unige)
Synaptophysin mouse 1:200 IF Sigma
Kinesin mouse 1:100 IF Abcam ab9097
Kinesin goat 1:100 IF Santa Cruz (aA-20):sc15931
Vinculin mouse 1:500 IF Sigma
GFP mouse 1:200 WB/IF/IHC Roche
GFP chicken 1:100 IHC Chemicon Int.
GST goat 1:1000 WB GE Healthcare
HA-probe rabbit WB Santa Cruz (Y-11):sc-805
FLAG mouse WB Sigma
ubiquitin mouse 1:5000 WB Abcam ab7254
MH27 mouse 1:100 IHC Developmental studies hybridoma bank
Secondary antibodies
Anti-mouse HRP goat 1:5000/1:100 WB/IHC Sigma
Anti-rabbit HRP goat 1:10000/1:100 WB/IHC Jackson ImmunoResearch
Anti-goat HRP donkey 1:10000/1:100 WB/IHC Promega
Anti-chicken HRP rabbit 1:1000/1:100 WB/IHC Promega
anti-mouse Alexa488 donkey 1:500 IF/IHC Invitrogen
Anti-mouse Alexa555 donkey 1:500 IF/IHC Invitrogen
Anti-rabbit Alexa555 donkey 1:500 IF/IHC Invitrogen
Anti-rabbit Alexa488 donkey 1:500 IF/IHC Invitrogen
Anti-goat Alexa633 donkey 1:500 IF Invitrogen
Anti-chicken Alexa488 donkey 1:500 IHC invitrogen WB = western blot; IF = immunofluorescence; IHC = immunohistochemistry
Table 3. Quantitative analysis of the GLR-1::GFP in ventral nerve cord (Results, Figure 5):
total fluorescence intensity in ventral cord
nuIs24 nuIs24xtm733 nuIs24xnuIs89 nuIs24xnuIs89xtm733 nuIs24xtm1968 nuis24xtm733xtm1968
mean 18.455 44.53 9.74 14.18 31.13 17.38
sd 4.57 11.88 0.93 4.61 12.25 10.46
sem 2.29 0.65 0.095 0.22 3.69 3.48
p-value <0.0001 <0.0001 <0.0001 <0.0001
>0.0001
normalized to wild-type
mean 1 2.41 0.53 0.77 1.687 0.942
sem 0.023 0.035 0.005 0.012 0.2 0.19
puncta width (#m)
nuIs24 nuIs24xtm733 nuIs24xnuIs89 nuIs24xnuIs89xtm733 nuis24xtm1968 nuis24xtm733xtm1968
mean 0.871 1.165 0.744 0.878 1.437 1.034
SD 0.344 0.42 0.187 0.335 0.464 0.39
SEM 0.046 0.053 0.037 0.047 0.06 0.05
p-value <0.0001 0.0864 0.9211 <0.0001 0.023
puncta density /50#m
nuIs24 nuIs24xtm733 nuis24xnuis89 nuis24xnuis89xtm733 nuis24xtm1968 nuis24xtm733xtm1968
mean 24.8 43.67 3.5 17.67 28.91 20.4
SD 8.1 9.03 1.38 5.43 8.41 4.88
SEM 3.62 3.68 0.56 2.22 2.54 1.54
p-value 0.0057 >0.0001 0.1149 0.3755 0.2077
>0.0001
nose-touch behaviour
n2 tm733 tm1968 tm733x tm1968
mean 93 88.5 94 90
SD 6.6 8.1 9.4 7.7
SEM 1.5 1.8 2.1 2.3
p-value 0.0616 0.6988 0.2628
reversal behaviour
n2 tm733 tm1968
mean 2.52 4.16 2
SD 1.055 1.26 1.077
SEM 0.472 0.564 0.482
p-value 0.0561 0.4626