2.1 Material
2.1.1 Antibiotics
Name stock concentration working concentration
for Dictyostelium:
in HL5c medium in Cosson medium
Penicillin 10 U/ml 100 U/ml 100 U/ml
Streptomycin 10 mg/ml 100 µg/ml 100 µg/ml
G418 10 mg/ml in water 7.5 µg/µl 10 µg/µl
Blasticidin S 10 mg/ml in water 7.5 µg/µl 10 µg/µl
Chloramphenicol 30 mg/ml in 100% ethanol 10 µg/ml 10 µg/ml Tetracycline 10 mg/ml in 70% ethanol,
sensitive to light
10-15 µg/ml 10-15 µg/ml
Doxcycline 10 mg/ml in water 10 µg/ml 10 µg/ml
for E.coli:
in LB medium
Ampicillin 500 mg/ml 100 µg/ml
2.1.2 Media, Buffers and Solutions
Recipes for buffers and solutions, which were used only for one specific method, can be found in the respective protocols. All solutions were made with double-distilled water.
2.1.2.1 Media HL5c medium pH 6.2
5.0 g/l Proteose peptone 5.0 g/l Yeast extract 5.0 g/l Proteose tryptone 1.2 g/l (8.8 mM) KH2PO4 0.35 g/l (2.5 mM) Na2HPO4
10.0 g/l (56 mM) Glucose
HL5 (Cosson) medium pH 6.65
14.3 g/l Bactopeptone (Oxoid L37) 7.15 g/l Yeast extract
18.0 g/l Maltose monohydrate 1.29 g/l Na2HPO4 x 12H2O 0.49 g/l KH2PO4
Low fluorescence medium
put on the cells 3h before imaging
Luria broth base (LB) 25 g/l Invitrogen powder ref: 12795-084
add freshly one of the reducing agent:
- 100 mM DTT
Tris acetate EDTA buffer (TAE)
0.25 % Bromophenol blue in water or TE
RNA running buffer
Ethidium bromide 1 mg/ml in water
2.1.3 Antibodies
GFP M mAb IF 1/5000, WB 1:2000 Sigma
IF 1/250, WB 1/10’000 TS lab, Claudia Kistler
MyoB R pAb WB 1/4000 Dr. M. Titus, (Novak and
RacB R pAb WB 1/500 Dr. J. Cardelli, (Lee et al.,
M mAb, P4D1 WB 1/400 Santa Cruz Biotechnology
Ubiquitin F2 mono- and immunofluorescence; WB, Western blot; NR, non-reduced samples
Secondary antibodies:
Antibody description Method, Dilution Supplier Goat anti-mouse/rabbit Ig
HRP-linked
WB 1/5000 - 1/10000 BioRad
anti-rabbit/mouse Ig Alexa 488, 594, 633
IF 1/2000 Molecular Probes
2.1.4 Molecular weight markers
Name Supplier
BenchTop 1kb DNA Ladder Promega
BenchTop 100 bp DNA Ladder Promega
Pageruler Prestained Protein Ladder Fermentas
2.1.5 Kits
Name Supplier
QIAquick PCR Purification Kit Qiagen
MiniElute Gel Extraction Kit Qiagen
Nucleobond PC100 Macherey-Nagel
High Pure PCR Template Preparation Kit Roche
RNeasy Protect Mini-Kit Qiagen
2.1.6 Cell lines
Name received from Reference
AX2 TS lab
drainin-null in AX2 G. Gerisch, Munich (Becker et al., 1999) GFP-drainin in AX2 G. Gerisch, Munich (Becker et al., 1999)
LvsA-null in DH1 A. De Lozanne (Kwak et al., 1999)
GFP-LvsA in DH1 A. De Lozanne (Gerald et al., 2002)
2.1.7 Vectors and plasmids
received from Reference
pDXA-GFP-for fusion TSlab
pBsR519 Dr. F. Puta (Puta and Zeng, 1998)
mRFPmars in pBsrH Dr. A. Müller-Taubenberger (Fischer et al., 2004)
pGEX-2T Amersham (Smith and Johnson, 1988)
pDXA-FLAG Dr. T. Egelhoff (Levi et al., 2000)
MB35 Dr. P. van Haastert (Blaauw et al., 2000)
MB38 Dr. P. van Haastert (Blaauw et al., 2000)
DD-domain Dr. D. Soldati (Banaszynski et al., 2006)
2.1.8 Primer
1 Sec3 k.o. 5’ for 55.5°C cctttcaacttaaaatttgttagtcgattg
2 Sec3 k.o. 5’ rev 56.0°C (without BamHI),
4 Sec3 k.o.3’ rev 54°C (PacI) tttttt ttaattaa agagaaaactgttaaataggtg
5 Sec3 RT for 56.0°C (without BamHI),
7 Sec3-5’ for 56°C caccaagtgtgatactactatgg
Sec3-3'rev 52°C gtgcatatagtaattttaataatagtaatgg
8 Sec15 k.o. 5’ for 55.1°C tttcattttgtgttgctcttgattctc
9 Sec15 k.o. 5’ rev 56.3°C (without BamHI),
11 Sec15 k.o. 3’ rev 54.2°C attaaaagagtctgggtaatattataatcg
Sec15 k.o. 3’ rev2 55.2°C ggaatataatccatcttttacacttacc 12 Sec15 RT for 56.0°C (without BamHI),
14 Sec15-5’ for 56.3°C gaattggctctgtactatcaattgg
Sec15-3'rev 55°C gagaaaatgaatacagaatatgtttgttgg 17 Sec15_1_for_BamHI 53.4°C (without BamHI),
58.7°C
tta ggatcc agtaacaaaaaacaaaaagaa gaaattaacac
18 Sec15_1_rev 58°C tgaataaattggtgcagtgacaggtg
19 Sec15_2_for 53.9°C ttggttcattggctctttatcc
20 Sec15_2_rev 50.6°C ttcattctctgttaattgatctg
21 Sec15_3_for 51.7°C agaacgtgattcacattgttc
22 Sec15_3_rev_XhoI_
29 Exo70_C-term for 56.2°C aacaaaccagtgaaaccaagaacc
30 Exo70_C-term rev 52°C (without XhoI, EcoRI), 60.7°C
tat gaattc ctcgag
ttattgtgaatcaaaaactctatcaag
31 Bsr-3’ 55.8°C gcattgtaatcttctcgtcgc
32 Bsr-5’ 55.4°C gataaagctgacccgaaagc
33 DD-domain5'HindIII 56°C (without HindIII site), 59°C
35 Rab4_BamHI_for 46.5°C (without BamHI site), 56.7°C
37 Rab8A_BamHI_for 54.7°C (without BamHI site), 60.9°C
39 Rab8a-3' dst 48°C cctctgccttgaaaccgag
40 Rab11A_BamHI_for 56.7°C (without BamHI site), 61.9°C 42 Rab11B_BamHI_for 53.2°C (without BamHI site),
58.7°C
tat ggatcc
gtactaaaaacaatagaatatgattatttgtg 43 Rab11B_XhoI_ClaI_ 53.2°C (without XhoI site), tat ctcgag
rev 58.7°C ttaacaacaatcatatactggtttattaattg
2.1.9 Dictyostelium cell lines generated during this work
Name antibiotic resistance
1 pDXA-GFP-for fusion Sec8 G418
2 pDXA-GFP-for fusion Sec8/mRFPmars Sec15 G418/Blasticidin
3 pDXA-FlagSec8 G418
4 pDXA-GFP-for fusion Sec15 G418
5 pDXA-GFP-for fusion Sec15/LvsA-null G418
6 pDXA-GFP-for fusion Sec15/mRFPmars Sec15 G418/Blasticidin 7 pDXA-GFP-for fusion -Sec15/ mRFPmars Rab8a G418/Blasticidin 8 pDXA-GFP-for fusion Sec15/ mRFPmars Rab11a G418/Blasticidin 9 pDXA-GFP-for fusion Sec15/ mRFPmars Rab11c G418/Blasticidin 10 pDXA-GFP-for fusion Sec15/drainin-null G418/Blasticidin
11 pDXA-Flag Sec15 G418
12 mRFPmars Sec15 Blasticidin
13 mRFPmars Sec15/pDXA-GFP-for fusion Rab11b G418/Blasticidin 14 mRFPmars Sec15/pDXA-GFP-for fusion Abd G418/Blasticidin 15 mRFPmars Sec15/pDXA-GFP-for fusion Rab7b G418/Blasticidin
16 mRFPmars Sec15/GFP-drainin G418/Blasticidin
17 pDXA-GFP-for fusion VacB/mRFPmars Sec15 G418/Blasticidin
18 GFP-vatM/ mRFPmars Sec15 G418/Blasticidin
19 pGEM-T Sec15 k.d. tet G418/Blasticidin
20 mRFPmars Rab4 Blasticidin
21 pDXA-GFP-for fusion Rab8a G418
22 pDXA-DD-GFP-for fusion Rab8a WT G418
23 pDXA-DD-GFP-for fusion Rab8a CA G418
24 pDXA-DD-GFP-for fusion Rab8a DN G418
25 pDXA-DD-GFP-for fusion Rab8a WT/mRFPmars Sec15 G418/Blasticidin 26 pDXA-DD-GFP-for fusion Rab8a CA/mRFPmars Sec15 G418/Blasticidin 27 pDXA-DD-GFP-for fusion Rab8a DN/mRFPmars Sec15 G418/Blasticidin
28 pDXA-FLAG Rab8a G418
29 mRFPmars Rab8a Blasticidin
30 mRFPmars Rab11a Blasticidin
31 pDXA-GFP-for fusion Rab11b G418
32 mRFPmars Rab11c Blasticidin
2.2 Methods
2.2.1 Cell culture
D. discoideum cell lines are grown at 22ºC, in HL-5c medium supplemented with 100 U/ml Penicillin and 100 µg/ml Streptomycin (Gibco). Cells in adherent conditions are grown in Falcon Petri dishes (BD Biosciences) and splitted every 2-3 day before reaching confluency. Cells in suspension are grown in conical flacks shaken at 180 rpm at a density of 105-107 cells/ml with an optimal growth phase between 0.5 x 106 and 0.5 x 107 cells/ml. Mutant cells lines were constantly kept under selection by addition of antibiotics.
2.2.1.1 Long-term storage of cells
2.2.1.1.1 Cell freezing
Take confluent 2 plates of cells, wash them once with Soerensen buffer and take them up in 4 ml of cold HL5c-medium with 10% DMSO. 4 aliquots of 1 ml are immediately placed in ice-cold Nalgene MisterFreeze boxes filled with isopropanol and transferred to -80ºC to be gently frozen. After a minimum of 24 h, cells are transferred to liquid nitrogen.
2.2.1.1.2 Spore freezing
Prepare starvation agar plates (Soerensen buffer with 1.5% Bacto-Agar) and let them dry 1 - 2 hours under the sterile hood flow. Pellet 5 x 107 cells/ml and wash them in Soerensen buffer. Resuspend the cells in 108/total 2 ml Soerensen buffer and spread on a starvation agar plates. Incubate 30 min with lid open, until the plate is almost dry. Incubate 24 h at 22°C. The cells go through development and form spores. Collect these in the lid of the plate by repeated tapping of the plate. Take up the spores in Soerensen buffer, count and pellet (2400 rpm, 5 min) them. Take up the spores in Soerensen buffer plus 10% glycerol to a density of 1x107 spores/ml and freeze them in Nalgene MisterFreeze boxes.
Spore aliquots are transferred to liquid nitrogen after 24h.
2.2.2 Electroporation of Dictyostelium
Electroporation is used to insert DNA into Dictyostelium cells. It is mainly used for knock-out or knock-down of genes by replacement of the endogenous DNA sequence by homologous recombination with a mutant construct or for integration of an overexpression plasmid carrying a GFP- or RFP-fusion protein.
1 x EP buffer: 10mM K2HPO4/KH2PO4 50mM Sucrose
pH 6.2
1 x EP buffer ++: 10mM K2HPO4/KH2PO4
50mM Sucrose 1mM MgSO4
1mM NaHCO3
1mM ATP 1µM CaCL2
pH 6.2
prepare in advance:
- buffers, sterile filtrated
- ~10 µg of DNA dissolved in 100 µl of EP++ buffer in a sterile 1.5 ml reaction tube - AX2 cells 2 x 106 c/ml– 4 x 107 c/ml, per electroporation use 2 x 107 cells
Electroporator: Electro Square Porator ECM830 from BTX
procedure: (work always on ice) - take 2 x 107 cells
- flash spin tube to pellet cells. The time to pellet the cells should be minimized (approximately 2 s) - wash them twice with EP buffer.
- remove the supernatant and resuspend the cells in 100 µl DNA containing EP++ buffer - transfer the cell-DNA mix into a chilled cuvette
- incubate the cuvette on ice for 1 min
- meanwhile take the electroporator holder out of the refrigerator and connect it to the main machine.
The values should be set to 300 V, 2 ms x 5 cycles of square pulses in 5 sec duration - place the wiped cuvette into the electroporater holder and zap it
- take out the cuvette and place on ice immediately - incubate the cuvette on ice for 10 min
- put 1 ml of HL5c medium in the cuvette and transfer the cell suspension from the cuvette into the two dishes (each 500 µl) containing 10 ml of fresh HL5c medium.
- incubate the cells over night at 22°C
- add selection medium on the cells the next day
The selection process can either be carried out in medium or on agar plates with Klebsiella aerogenes bacterial lawn.
a) selection in medium
3 - 4 days under selection the non-transformed cells start to die. The surviving cells form colonies, which can be picked by sucking up with a pipette and transfered into 12-well dishes for further characterisation.
b) selection on agar plates
Instead of addition of selection medium to the transformation plate, the cells are taken off the transformation and spread on Soerensen agar plates containing antibiotics for selection.
Prepare 3 - 4 Soerensen agar plates à 20 ml with 50 µg/ml antibiotic per transformation and 1 fresh KA plate per Soerensen agar plate. Wash the KA of the plate and take them up in 3 - 4 ml Soerensen
buffer containing Penicillin, Streptomycin and the appropriate antibiotic for mutant selection (50 µg/ml). Spread the mix on 3 - 4 of the Soerensen agar plates à 20 ml with 50 µg/ml antibiotic and incubate at 22°C. After approximately 1 week the first clones should be visible.
2.2.3 Isolation of genomic DNA from Dictyostelium
- grow AX2 cells in shaking culture up to a density of 1 x 106 to 4 x 106 cells/ml - take in total 2 x 108 cells and pellet them by centrifuging 5 min at 1600 rpm
- discard the supernatant, resuspend the cells in 10 ml of ice-cold water and pellet the cells again
- repeat this washing step once
- discard the supernatant and resuspend the cells in 45 ml lysis buffer
- now add NP40 to the cell suspension until the solution is clear, but max. 5 ml
- while you do that, always invert the tube carefully to mix. During this step the cells are lysed, but the nuclei stay intact
- centrifuge 15 min at 4000 rpm to pellet the nucleus
- discard the supernatant by pipetting, because the pellet can be loose
- resuspend the pellet carefully in 5 ml SDS-lysis buffer + 100 µl proteinase K (25 mg/ml) - incubate for 1 h at 60ºC
- take 5 reaction tubes and transfer in each of them 1 ml of your suspension
- add 1:1 vol. Phenol/Chloroform (5 ml) to the suspension and mix carefully, until it is a homogeneous solution. The proteins are denatured.
- centrifuge 15 min at 8000 rpm
- now you see 2 phases: The upper phase contains the DNA, the interphase contains the proteins and the lower phase contains the Chloroform
- take the upper phases from the difftent tubes and transfer them into one new tube. Don't take any of the interphase!
- depending on the colour of the upper phase, continue in the protocol or repeat the last 4 steps (adding of 1:1 vol. Phenol/Chloroform, centrifugation, transfer into a new tube) until the upper phase is clear (approximately 2 x)
- add to the clear upper phase 2 vol. 100% Ethanol and 1/10 vol. 8 M LiCl. At this step, you precipitate the genomic DNA
- centrifuge at 4ºC, 30 min, 10000 rpm - wash the DNA pellet with 5 ml 70% Ethanol - centrifuge at 4ºC, 10 min, 10000 rpm
- dry the DNA briefly by placing the inverted tube on a paper towel - dissolve the DNA in 200 µl TE buffer. Use a cut blue tip.
2.2.3.1 Preparation of chromosomal DNA from Dictyostelium grown in 12-well plates - take cells from a confluent well of a 12-well plate
- spin them down, discard supernatant
- resuspend pellet in 290 µl 0.3% SDS in TE-buffer - add 10 µl ProteinaseK (25 mg/ml), incubate 1h at 45°C - add 200 µl water, mix
- add 500 µl Phenol/Chloroform, mix by inverting
- centrifuge 20 min at max. in a table top centrifuge (ca. 13000 rpm) - transfer the upper phase into a new tube
- add 2.5 vol. ice-cold 100% Ethanol + 1/10 vol. 8 M LiCL
- centrifuge 30 min at max. in a table top centrifuge (ca. 13000 rpm) - discard supernatant
- add 300 µl 70% Ethanol - air-dry pellet
- take pellet up in 20 µl water - use 1-3 µl DNA for PCR
2.2.4 Preparation of electroporation-competent E. coli
E.coli cells are able to replicate plasmid DNA. To be able to take up the plasmid DNA they have to be made "electroporation-competent". The cells get very fragile during this procedure, thus it is important to work quickly in the cold room, to avoid pipetting rather resuspensd by vibration on a vortexer and to use pre-cooled material.
prepare in advance:
- 1 l LB medium - 2 l ice cold water
- 30 ml ice cold 10% glycerol, sterile
procedure:
- inoculate 30 ml LB medium with the E. coli strain of your choice - grow overnight at 37˚C
- next day, inoculate 2 x 500 ml medium (in 2 l flasks) with 12.5 ml overnight culture each - grow to OD600 of 0.7 - 0.9. Start measuring OD after 2 h. Cells should be ready after 2 - 3 h - chill flasks in an ice-water bath for 10 min
- pour culture into three sterile centrifuge bottles, pellet 10 min, 4500 rpm, 2˚C
- discard the supernatant and resuspend in 2 x 400 ml ice cold water (reduce to two bottles), pellet 10 min, 5000 rpm, 2˚C
- resuspend cells in 400 ml water (reduce to one bottle), pellet 10 min, 5500 rpm, 2˚C - resuspend cells in 400 ml water, pellet 10 min, 6000 rpm, 2˚C
- resuspend cells in 20 ml 10% glycerol, fill into sterile plastic tube, pellet 15 min, 6000 rpm, 2˚C - resuspend cells in 2 ml of sterile 10% glycerol
- make aliquots of 85 µl (sufficient for two electroporations), snap-freeze in liquid nitrogen - store at -80˚C.
- determine competence of cells (= number of transformants per µg of DNA) by electroporating them with 100 pg pUC18-DNA supplied with the Stratagene electrocompetent cells. Thaw a fresh aliquot of the plasmid as the concentration already is low in the stock solution and is diluted further for transformation
2.2.5 Transformation of E. coli cells
Transformation by electroporation is used to insert foreign DNA into an organism. Here it is used for replication of plasmid DNA.
Electroporator: Electro Cell manipulator ECM630 from BTX - melt the E. coli cells on ice
- transfere 40 µl cells in an 1.5 ml reaction tube - add 1 µl of DNA
- incubate 5 min on ice
- transfere the solution into an sterile electroporation cuvette (0.2 cm) - pulse (electroporation parameters: 1800 V, 125 Ω, 50 µF)
- immediately after the pulse: add 700 µl LB medium into the cuvette - plate onto LB agar plates with the appropriate antibiotic for selection
2.2.6 Cloning
In the following paragraphs all the different steps of cloning will be explained. Starting with amplification of a gene or a gene fragment from genomic DNA by PCR (2.2.2) or from RNA by RT-PCR (2.2.). In a second step, all amplificons were directly cloned by ligation (2.2.2) into the vector pGEM-T easy. With the help of Colony-PCR (2.2) the new plasmids were tested. After selection of positive plasmids these were send for sequencing to Eurofins MWG Operon (Germany). The subsequent cloning steps will be explained in the paragraph "Cloning strategies" (2.2.).
2.2.7 Polymerase Chain Reaction (PCR)
The Polymerase Chain Reaction (Mullis, 1990) is a method to amplify DNA-molecules in vitro (Saiki et al., 1988). The exact details can be found in texts books as for example "Molecular Cell Biology"
(Lodish et al., 2007).
PCR machines: - Tpersonal from Biometra
- GeneAmp PCR System 2400 from Perkin Elmer
Reaction: 2.5 µl 10 x PCR-buffer 2.0 µl 25 mM MgCl2
2.5 µl 2 mM dNTPs 2.5 µl 10 µM primer1 2.5 µl 10 µM primer2 x µl DNA (10 – 100 ng)
0.25 µl Taq-Polymerase (Promega) x µl H2O
25 µl
Program:
First Denaturation: 95°C 3 min
Denaturation: 95°C 15 sec
Annealing: Tm – 1-2°C (primer dependent) 30 sec
Elongation: 62°C amplificate dependent
(30 sec/500 bp)
Final Elongation 62°C 5 min
We have chosen a lower elongation temperature than usual, 62°C instead of 72°C, as Dictyostelium has very high DNA content of adenonsine and thymidine (Su et al., 1996).
2.2.8 Reverse Transcriptase-PCR (RT-PCR) with Roche Titan One Tube RT-PCR System
This method is used to reverse transcribe mRNA into complementary DNA (cDNA). RNA is isolated from Dictyostelium with Qiagen RNeasy Protect Midi Kit.
Reactions: Mix 1: 1 µl 10 mM dNTPs 2 µl 10 µM primer1 2 µl 10 µM primer2 x µl RNA (1µg –100 pg) 0.2 µl DTT-solution 0.2 µl RNase inhibitor 1 µl MgCl2
x µl H2O 25 µl
Mix 2: 10 µl 5 x RT-buffer
1 µl Enzyme mix
14 µl H2O 25µl
Mix both reactions in one tube (50 µl)!
Program:
1 RT-reaction: 50 °C 30 min
2 First Denaturation: 94°C 2 min
3 Denaturation: 94°C 10 sec
4 Annealing: Tm – 1-2°C 30 sec
5 Elongation: 68°C amplificate dependent (30 sec/500 bp)
→ 5 cycles of steps 3 to 5
6 Denaturation: 94°C 10 sec
7 Annealing: Tm – 1-2°C 30 sec
8 Elongation: 68°C amplificate dependent (30 sec/500 bp)
→ 25 cycles of steps 6 to 8; each cycle + 5 sec elongation time
9 Final Elongation 62°C 5 min
2.2.9 Ligation
The principal of a ligation is to form new 3'-5' phosphodiester bounds between nucleotids by the enzyme ligase. This is used to insert DNA sequences in a vector to create plasmids with new characteristics. The ratio between vector and insert should be 1:3 (for sticky ends). The amounts can be calculated with the following equation:
ng of vector x kb size of insert 3
--- x --- = ng of insert kb size of vector 1
a) Ligation in pGEM-T Easy (Promega-Kit)
All PCR amplificats were directly cloned by ligation into the vector pGEM-T easy. A vector with a large multiple cloning site (MCS) for further cloning steps.
Reaction: 5 µl 2 x Rapid ligation buffer 1 µl vector (50 ng, pGEM-T easy) x µl PCR product
1 µl T4 DNA Ligase x µl H2O
10 µl
b) Ligation in other vectors
This reaction mix is used for ligation in any other vector, e.g. in pDXA-GFP for fuion.
Reaction: 1 µl 10 x Ligase-buffer 1 µl vector
x µl PCR product 1 µl T4 DNA Ligase x µl H2O
10 µl
Incubate the reaction mix at least 1 h at RT. Afterwards it can be transformed directly into E. coli. One way to optimise the transformation efficency is desalting of the ligation reaction mix:
- add 50 µl H2O to the ligation reaction - add 500 µl n-Butanol
- vortex 5 sec
- centrifuge 10 min at 13000 rpm
- remove the supernatend and dry the pellet
- resuspend the pellet in 5 µl 1 : 10 diluted TE-buffer - use 2 µl for transformation in E. coli
2.2.10 Colony PCR
With this method E. coli clones can be checked directly one day after transformation for the integration of the right plasmid. Pick with a tooth pick a few cells of a clone from the transformation plate and transfer them into a PCR tube containing 10 µl of water. Proceed as for a classical PCR with two exceptions:
a) first denaturation time is prolonged to 10 min
b) reaction mix has to be adjusted, which means less water and no DNA
2.2.11 DNA precipitation
Before transformation, plasmid DNA is precipitated 30 min by addition of 2.5 (v/v) 100% ethanol, 1/10 (v/v) 8M LiCl and 30 min centrifugation at 4 °C. DNA pellet is then washed with 70% ethanol and air dried.
2.2.12 Separation of nucleic acids on an agarose gel
Agarose gel electrophoresis is used to separate DNA or RNA fragments by size. Agarose in a concentration of 0.6% - 1.5%, dependent on the size of the fragment to separate, is desolved in TAE buffer by heating up in the microwave. Let the agarose cool down to 55 °C and add ethidium bromid (1 µl/ml). Pour the agarose in a suitable chamber and wait until it is gelified. Load the gel and run it at a constant voltage of 60 V to 130 V, depending on the gel size. Afterwards the gel is documented under exposition to UV-light.
2.2.13 Nucleic acid quantification
Optical density at 260 nm / 280 nm is measured in a quartz cuvette after dilution of the nucleic acid solution in water. The 260/280 ratio should be close to 1 for pure DNA or RNA. OD260 of 1 is indicative of a RNA concentration of 40 µg/mL and DNA concentration of 50 µg/mL.
2.2.14 Digestion of DNA with restriction endonucleases
Restriction endonucleases are enzymes that specifically recognize specific DNA sequences and hydrolyse the DNA backbone bond on each DNA strand. Conditions for reaction mix and temperature vary from supplier to supplier and should be looked up for each reaction.
2.2.15 Cloning strategies
2.2.15.1 Cloning into vectors for protein fusion to various tags
All genes were initially cloned in pGEM-T easy and then sub-cloned in other vectors for tagging to a fusion protein. The fusion protein is always placed N-terminal of the protein of interest. All primers are listed and numbered under 2.1.8.
coding sequence vector restriction sites primers final plasmid
Sec3 N-term pGEM-T easy - 5/6 pGEM-T easy
Sec3 RT
Sec3 N-term pGEX-2T BamHI/EcoRI taken from
pGEM-T easy Sec3 RpGEM-T
Sec8 pDXA-FLAG BamHI/XhoI taken from
pGEM-T easy Sec8
Sec15 mRFPmars BamHI/EcoRI taken from
pGEM-T easy Sec15 full-length
mRFPmars Sec15
Sec15 pDXA-FLAG BamHI/XhoI taken from Sec15 N-term pGEX-2T BamHI/EcoRI taken from
pGEM-T easy Sec15 RpGEM-T
pGEX-2T Sec15 RT
Exo70 C-term pGEM-T easy BamHI/XhoI, EcoRI
2.2.15.2 Cloning strategy for "classical" knock-out of Sec15
The aim of this strategy is to delete the major part of the Sec15 gene and replace it by homologous recombination with a BsR-resistance cassette. Homologous recombination is achieved with about 500 bp of upstream flanking sequence plus coding sequence of the targeted gene respectively 500 by of downstream flanking sequence plus coding sequence. These two sequences were cloned separately into the vector pGEM-T easy. For the sequence 5' of Sec15 we used the primer combination of Sec15
k.o. 5’ for / Sec15 k.o. 5’ rev (BamHI) resulting in the plasmid pGEM-T Sec15-5'k.o. The 3' sequence was amplified with the primer combination Sec15 k.o. 3’ for (BamHI) / Sec15 k.o. 3’ rev2 resulting in the plasmid pGEM-T Sec15-3'k.o. In a second step both sequences were joined by restriction digestion with BamHI in one vector, resulting in the plasmid pGEM-T Sec15-5'-3'k.o. During a last step the
k.o. 5’ for / Sec15 k.o. 5’ rev (BamHI) resulting in the plasmid pGEM-T Sec15-5'k.o. The 3' sequence was amplified with the primer combination Sec15 k.o. 3’ for (BamHI) / Sec15 k.o. 3’ rev2 resulting in the plasmid pGEM-T Sec15-3'k.o. In a second step both sequences were joined by restriction digestion with BamHI in one vector, resulting in the plasmid pGEM-T Sec15-5'-3'k.o. During a last step the