Hypothèse

Puisque le clonage par transfert nucléaire offre une étape additionnelle de reprogrammation des cellules différenciées, la dérivation d’une ligné stable de cellules iPS autologues sera plus rapide et efficace à obtenir des cellules embryonnaires et fœtale clonées que directement des cellules somatiques de chevaux adultes.

2.2 Objectifs

2.2.1 Objectif général

Développer un protocole efficace de dérivation de cellules iPS équines autologues à partir de fibroblastes de la peau équine adulte.

2.2.2 Objectifs spécifiques

1) Notre premier objectif est de vérifier si les cellules fibroblaste fœtales clonées (ntFF) et cellules ES clonées (ntES) peuvent être reprogrammée en cellules iPS.

2) Notre deuxième objectif est de comparer le niveau de pluripotence entre les cellules équines ES non-transfectées aux cellules équines ntES dérivées en iPS.

2.3 Conception expérimentale

Ce projet compare deux types de production de cellules pluripotentes induites autologues équines, la reprogrammation de cellules fibroblaste fœtales ainsi que la reprogrammation de cellules embryonaire. Les cellules sont obtenues à partir de fibroblastes de la peau de chevaux adultes, passant par une étape de reprogrammation initiale de clonage par transfert nucléaire.

   24  

Figure 1 : Dérivation de cellules souches pluripotentes induites (iPS) autologues de cheval.

Obtention et culture de cellules fibroblastes de la peau équine, suivi du transfert et la fusion d’une cellule dans un ovocyte énucléé pour permettre l’activation embryonnaire et la formation d’un blastocyst ou d’un fœtus cloné. 1) Reprogrammation de cellules fibroblastes fœtales d’origine SCNT (ntFF) en cellules iPS (ntFF-iPS); 2) Reprogrammation de cellules souches embryonnaires d’origine SCNT (ntES) en cellules iPS (ntES-iPS). Toutes les cellules ont été reprogrammées par l’électroporation des vecteurs piggyBac MKOS (éclair jaune).

Chapitre 3. Résultats

Article 2 : Secondary reprogramming of cloned fetuses and embryos to produce autologous

pluripotent stem cells in horses

   26  

Secondary reprogramming of cloned fetuses and embryos to produce autologous pluripotent stem cells in horses

ABSTRACT

Autologous pluripotent stem cell lines can be derived from adult cells either by direct reprogramming through induced expression of pluripotency genes (iPS) or indirectly by reprogramming through somatic cell nuclear transfer (SCNT) followed by the derivation of embryonic stem cells (ESC). However, outcome efficiency of SCNT and iPS protocols are invariably low, indicating that, alone neither of these reprogramming routes is sufficient for deriving genetically and epigenetically stable pluripotent stem cells. We hereby report on the production of autologous equine iPS cells by combining SCNT and iPS reprogramming protocols. Adult skin fibroblasts were used for SCNT, and the resulting cloned embryos were either used to obtain fetal fibroblasts (ntFF), or used for ESC culture (ntES). Cells were then transfected using the piggyBac transposon-based doxycycline-inducible iPS derivation system. The ntFF-iPS colonies appeared at day 20-30 post-transfection with an estimated 0.03%

reprogramming efficiency. In contrast, ntES-iPS colonies appeared at day 7 post-transfection, with 0.17% reprogramming efficiency, and showed improved pluripotency marker expression when compared with ntES cells. These results indicate that stable equine iPS cell lines may be readily obtained from secondary reprogramming of cloned ntFF and ntES cells, opening novel avenues for developing autologous pluripotent stem cell therapies.

   28  

INTRODUCTION

The high proliferation properties and capacity for multilineage differentiation of stem cells have instigated a wave of new technology developed in the field of human and veterinary regenerative medicine. Advancements in this field have played an important role in disease modeling (Tan and Scotting, 2013) and animal studies have shown that stem cell therapy can induce improvement in conditions such as neurodegenerative disease (Lescaudron et al., 2012), cardiac disease

(Kanashiro-Takeuchi et al., 2011) and tissue repair (Oldershaw 2012). Multipotent somatic stem cells, such as bone marrow-derived mesenchymal stem cells or neural progenitor stem cells, can be easily collected and allow autologous transplantation (Jahagirdar, 2005). However, the collection of these cells results in heterogeneous populations with low percentages of true multipotent stem cells (Vidal et al., 2006) and once isolated, these cells have more limited differentiation capacities.

Pluripotent stem cells, on the other hand, have unlimited proliferation and are capable of

differentiation into any cell type of all three germ layers (Lanza and Rosenthal, 2004). Such cells are isolated from early embryos, such as embryonic stem cells (ESC) and epiblast stem cells (EpiSC), or from the genital ridges of developing fetuses (embryonic germ cells). Because of their fragility and due to ethical concerns, autologous pluripotent stem cells are difficult to obtain from humans. Some approaches have successfully been developed to circumvent these ethical and technical issues. Co-culture of differentiated cells with oocyte cell-free extracts has led to partial reprogramming of cells to an embryonic stem (ES)-like state (Miyamoto et al., 2009).

Recently, somatic cell nuclear transfer (SCNT) was successfully performed in humans and stable ESC lines were isolated (Tachibana et al, 2013).

Although these techniques have been widely used in domestic animals, attempts to obtain stable ESC lines have been largely unsuccessful (Talbot et al., 2008). Because of their similarities in physiology with humans, domestic species are considered excellent models for long-term experiments in biomedical research and more specifically, regenerative medicine. Derivation of pluripotent stem cell lines from large animals such as horses and pigs will thus benefit both human and veterinary clinical applications.

An important advance in recent years was the establishment of pluripotent stem cells by the Yamanaka group, who showed that the ectopic expression of four transcription factors, cMyc, Klf4, Oct4 and Sox2 (MKOS), induced the reprogramming of mouse and human differentiated somatic cells, known as induced pluripotent stem (iPS) cells (Takahashi et al., 2006; Takahashi et al., 2007). The iPSC have been derived from various other mammalian species, including

domestic ungulates including pigs (Ezashi et al., 2009), sheep (Li et al., 2011), cattle (Sumer et al., 2011) and horses (Nagy et al., 2011; Breton et al., 2013). However, iPS cell generation remains inefficient, with very few transformed cells achieving complete reprogramming.

Moreover, whereas many studies show that iPS cells and ESC share key pluripotency properties, others indicate that important differences remain between these two cell types, especially in genome integrity (Laurent et al., 2011; Mayshar et al., 2010).

   30  

generations (Wakayama et al, 2013) and, in pigs, serial re-cloning has even been suggested to restore epigenetic errors arising during a first generation nuclear transfer (Cho et al, 2007). By inducing the expression of pluripotency transgenes in differentiated tissues derived from iPS cells, secondary reprogramming systems have also been shown to accelerate reprogramming and to produce more homogeneous iPS population, suggesting that a second wave of reprogramming significantly increases the reprogramming factor expression and the amount of successfully reprogrammed iPS cells (Nagy, 2013).

In the present study, we hypothesized that autologous equine iPS cells may be obtained from adult fibroblasts through the sequential approach in which fibroblasts are reprogrammed initially by SCNT to obtain cells at earlier stages of development, and subsequently reprogrammed using genetically induced iPS-derivation systems. We report the rapid and efficient generation of equine iPS (eiPS) cell lines from SCNT-derived cloned fetal fibroblasts and ES-like cells using a piggyBac (PB) transposon delivery system used previously to derive eiPS from fetal fibroblasts (Nagy et al., 2011).

MATERIAL AND METHODS

Preparation of Equine Adult Fibroblast (eAF) and Fetal Fibroblast (ntFF) Cells

All procedures using live animals were performed in compliance with the institution’s guidelines for the care and use of laboratory animals, approved by the local animal care committee as sanctioned by the Canadian Council on Animal Care. Following asepsis of an area in the neck,

local anesthesia was administered and a 6 mm diameter full-thickness skin biopsy was collected from two male and two female adult horses. Skin samples were maintained in saline on ice and transported immediately to the laboratory for further processing.

Autologous fetal fibroblast cells were obtained from cloned fetuses produced by somatic cell nuclear transfer (SCNT) using skin fibroblasts from the four adult horses above. Pregnant

recipient mares at 40 days of gestation were tranquilized with xylazine (0.2 mg/kg; Bayer Health Care) and acepromazine malate (0.02 mg/kg, Vétoquinol) and a catheter was introduced in the uterus to flush out the fetus in PBS (Invitrogen), which was transported on ice to the laboratory for recovery of skin samples.

Adult and fetal-derived skin was dissected and exposed to a 5 mg/ml collagenase I (Sigma) solution in DMEM (Invitrogen) for 3 h at 37°C. After dissociation, cells were washed twice in fresh DMEM with 10% FBS (Invitrogen), plated, cultured, and passaged once to obtain first passage equine adult fibrobalsts (eAF) and fetal (ntFF) fibroblasts. Stocks were frozen in DMEM with 10% FBS and 10% DMSO (Sigma).

Somatic Cell Nuclear Transfer (SCNT)

The procedure of SCNT was performed as described previously (Galli et al., 2003). Briefly, slaughterhouse-derived ovaries were dissected and follicles were aspirated using a 16 G needle to obtain cumulus oocyte complexes (COC) with multilayered compacted cumulus. COCs were cultured in 50 µl droplets of DMEM-F12 (Sigma), 10% FBS (Invitrogen), 2 mg/mL FSH (follicle

   32  

stimulating hormone; Bioniche), 5 mg/mL LH (luteinizing hormone; Bioniche), 40 µg/mL IGF-1 (insulin-like growth factor 1; Sigma) and 40 µg/mL EGF (epidermal growth factor; Sigma) at 38o_{C in a humidified atmosphere of 5% CO2, 5% O2 and 90% N2. After 24 h, secondary oocytes} with expanded cumulus were denuded and microsurgically enucleated in the presence of 0.8 M cytochalasin B (Sigma) by removal of the metaphase spindle and first polar body. After

microsurgery, fibroblast cells were injected into the perivitelline space of enucleated oocytes and the couplets were electrofused using a 1.2 KV/cm DC current. Fused couplets were activated by 4 minute exposure to 5 mM ionomycin (Sigma) followed by 3 h exposure to 100 mM 6-

(Dimethylamino)purine (6-DMAP; Sigma). After activation, reconstructed oocytes were washed and cultured in DMEM-F12 in vitro for 8-9 days to develop to the blastocyst stage.

Preparation of Equine Embryonic Stem-Like (ntES) cells

The ntES cells were obtained from somatic cell nuclear transfer (SCNT) cloned embryos. Viable day 8-9 blastocysts were cultured on mitomycin inactivated feeder layers consisting of mouse embryonic fibroblasts isolated from day 14.5 embryos with standard procedure (MEFs) (Jozefczuk, J. et al., 2012) using eiPS medium (see below). Once embryos attached to the well and began proliferating, mechanical separation was used to propagate the embryonic stem-like (ntES) cells to a first passage. The cells were then separated by TrypLE (Life Technologies) enzymatic separation for the second passage and once propagation was sufficient, cells were collected for transfection. Stocks were frozen in 90% FBS and 10% DMSO.

Equine fetal fibroblasts were maintained in DMEM High Glucose (Invitrogen) supplemented with 2 mM GlutaMaxTM (Invitrogen), 0.1 mM Non-essential amino acids (Invitrogen), 0.1 mM Betamercaptoethanol (Sigma), 1 mM Sodium Pyruvate (Invitrogen), 50 U/ml

Penicillin/Streptomycin (Invitrogen) and 15% fetal bovine serum (HyClone). Culture media for eiPS and ntES cells was the same as above, supplemented with 1000 U/ml leukemia inhibitory factor (LIF; ESGRO, Millipore), 10 ng/ml bFGF (Peprotech), 1.5 µg/ml Doxycycline (Sigma) 3 µM GSK (Glycogen Synthase Kinase) inhibitor (StemGent), 0.5 M MEK (mitogen-activated protein kinase) inhibitor (StemGent), 2.5 µM TGF-β (transforming growth factor) inhibitor (StemGent) and Thiazovivin (StemGent). From day 8 of the reprogramming process until day 15, the media was also supplemented with 25 µM ALK (activin receptor-like kinase) receptor

inhibitor (StemGent) for the adult and fetal cells.

Gene transfection protocol

Plasmids for the piggyBac procedure (PB-TET-MKOS, PB-GFP, PB-CAG-rtTA and pCyL43 PBase) were constructed as previously described (Nagy et al., 2011). All cells (ntFF and ntES) were transfected with the Neon electroporation device (Invitrogen) according to the

manufacturer’s instruction, using preset program 14. For each electroporation in 10 µl tips, 2.5×105 cells were used with a total of 1 µg mixed DNA. The DNA mixture consisted of equal weight ratios of all four plasmids. Cells were seeded in wells of a 9.6 cm2 surface area for culture.

   34  

Establishment of eiPS Cell Lines

As soon as well-defined colonies appeared post-transfection and prior to passaging of the cells, colonies were picked mechanically. The first passage of the isolated colonies used mechanical dissociation. From the second passage onward, the lines were dissociated enzymatically with TrypLE Select (Invitrogen) and cultured on MEFs in eiPS media. The cells were passaged every 3-4 days at a 1:5 ratio. At the appropriate level of expansion, the cells were cryopreserved in 90% FBS and 10% DMSO.

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR)

RNA was collected from cells grown in 60 mm tissue culture plates by brief enzymatic

dissociation, resuspension with culture media, centrifugation, and snap freezing of the pelleted cells. RNA was extracted by isopropanol and purified with RNeasy Mini kit (Qiagen #74104) following manufacturer’s protocol. Reverse transcription was performed using QuantiTect Reverse Transcription kit (Qiagen #205313) with the RT primers and Mix provided by the kit. The reaction was performed at 42° C for 30 min. For all samples, a negative RT was used as a control, consisting of an RT reaction omitting the reverse transcriptase. The following RT-PCR primers were used to detect and quantify the expression of equine specific KLF4 (forward: GTGCCCCAAGATCAAGCAG, reverse: TGCTGAGAGGGGGTCCAGT, amplify 89 bp, Roche probe #94), NANOG (forward: CGGGGCTCTATTCCTACCACC, reverse:

GGTTGCTCCAAGACTGGCTGT, amplify 129 bp, Roche probe #3), OCT4 (forward:

Roche probe #3) and SOX2 (forward: CTTGGCTCCATGGGTTCG, reverse:

TGGTAGTGCTGGGACATGTGA, amplify 188 bp, Roche probe #70). The relative

concentration of mRNA was quantified using RotorGene comparative quantification analysis system (Qiagen). These measurements were normalized with the equine specific housekeeping genes GAPDH (forward: GAGATCCCGCCAACATCAAA, reverse:

AAGTGAGCCCCAGCCTTCTC, amplify 97 bp, Roche probe #159), SDHA (forward: GCACCTACTTCAGCTGCACG, reverse: AACTCCAAGTCCTGGCAGGG, amplify 94 bp, Roche probe #37) and RPL32 (forward: GAAGCACATGCTGCCCAGT, reverse:

CTTTGCGGTTCTTGGAGGAG, amplify 89 bp, Roche probe #132). We have established that none of these primer pairs amplify mouse transcripts (data not shown).

Bisulfite Sequencing

Approximately 400–500 ng of total genomic DNA was used for a bisulfite treatment reaction using the EpiTect Bisulfite kit (Qiagen). Primers specific for bisulfite-converted DNA were designed within the equine OCT4 region to amplify a 513-bp fragment, spanning from 124 to 658 bp downstream of exon 1 (GenBank accession no. NW_001867389). Each PCR reaction was performed in triplicate using the OCT4 primers (forward: TTTAGTGGGTTAGGAATTGGGT, reverse: CCAACTTCCAACTCCCCCAAA). The PCR reaction was carried out in a final volume of 50 µl, containing 1–2 µl of bisulfite-treated DNA, 0.2 µM each primer, 0.3 mM mixed dNTP, 13 PCR buffer, 1.5 mM MgCl2, and 2.5 units of Platinum Taq DNA polymerase (Invitrogen). The reactions were performed using an initial 2-min step at 94°C followed by 50 cycles of 30 sec at 94°C, 30 sec at 53°C, 1 min at 72°C, and a final 3-min step at 72°C. The PCR products were

   36  

resolved in 1% agarose gels, followed by purification using the QIAquick Gel Extraction kit (Qiagen). Purified fragments were subcloned in pGEM-T Easy Vector (Promega), and cell transformation was performed using competent Escherichia coli DH5a cells (Invitrogen). To ensure that reliable data were collected, a total of 20–23 clones for each sample were picked and sequenced.

Immunocytochemistry

Cells grown in 4-well tissue culture plates (Corning) on coverslips were washed twice with DPBS (Invitrogen) and fixed with 4% paraformaldehyde solution for 15 min. After washing with DPBS twice, cells were permeabilized with chilled 0.1% triton for 10 min, washed twice with DPBS and blocked 60 min with 5% normal goat serum (Jackson ImmunoResearch) in DPBS. Cells were then incubated overnight at 4°C with the following primary anti-mouse, anti-rat or anti-human antibodies; (i) anti-Nanog (Reprocell), (ii) anti-SSEA1 (Stemgent), (iii) anti-SSEA3 (Stemgent) (iv) anti-SSEA4 (Stemgent), (v) anti-TRA-1-60 (Stemgent), (vi) anti-Rex-1

(Millipore). After two washes in DPBS, cells were incubated for 60 min at room temperature with Cy3 or Cy5 conjugated secondary antibodies (Stemgent). For control experiments, the primary antibody was omitted.

Statistical Analysis

All values are expressed as mean ± SD. To determine significance between two groups, comparisons were made using Student’s t-test. Analysis of multiple groups was performed by

one-way ANOVA using Graphpad Prism V5.0 (Graphpad Software. San Diego, CA, USA). P < 0.05 was considered significant.

RESULTS

Reprogramming of Fibroblast from SCNT-Derived Fetuses

Equine adult fibroblasts from four horses were used for somatic cell nuclear transfer (SCNT) to obtain blastocysts that were transferred to surrogate mares for implantation. Gestations were terminated to recover 40 days fetuses that were then used to obtain fetal fibroblast (ntFF)

cultures. (Figure 1.A) Using the previously established PB transposon-based system (Wang et al., 2008), the four reprogramming factors c-Myc, Klf4, Oct4 and Sox2 (MKOS) were transfected in SCNT-derived ntFFs to induce reprogramming. The cell survival rate after transfection was estimated to be 75% and, from the ratio of GFP positive cells 24h after plating, transfection efficiency was estimated at 46% (data not shown).

GFP positive ES-like colonies began to appear 21-25 days after transfection of SCNT-derived ntFF. These colonies were morphologically similar to fetal eiPS cells previously obtained (Nagy et al., 2011) with well-defined edges, monolayer organization (Figure 1.B) elevated nucleus to cytoplasm ratio and positive for alkaline phosphatase staining (data not shown). A total of four independent SCNT-derived ntFF primary cell cultures were transfected producing an average of 25 (± 2) colonies per cell culture. Of those colonies, 4 ntFF-iPS lines were successfully

   38  

cells surviving electroporation divided by the number of colonies found on each plate) was estimated to 0.029% (Table 1).

Using reverse-transcriptase PCR and comparative quantification assays, endogenous pluripotent gene expression was measured in both ntFF and ntFF-iPS cells. ntFF-iPS cells showed significant increase in OCT4 (18 fold), NANOG (18 fold) and SOX2 (30 fold) expression (Figure 2),

indicating a consistent transcriptional upregulation of the endogenous pluripotency network. However, KLF4 expression was significantly higher in ntFF, which may be indicative of their dermal (skin) origin. Together, these results indicate that SCNT-derived ntFF can be efficiently reprogrammed into pluripotent eiPS lines thereby circumventing the limitations of producing iPS directly from adult horses by allowing the production of autologous iPS cell lines from cloned fetuses.

Reprogramming of SCNT-Derived Embryonic Stem-like Cells

Equine adult fibroblasts from the same four horses were used for somatic cell nuclear transfer (SCNT) to derive day 8 blastocysts that were then allowed to attach and cultured on gelatin and inactivated MEF covered dishes to derive ES-like lines (ntES). After 7 days in culture, these ntES cells were transfected with reprogramming factors and cultured to produce iPS lines (ntES-iPS). As for fetal fibroblasts, survival rate after transfection of ntES was estimated to be 75%, and 46% of the surviving cells expressed GFP 24 h after plating (data not shown). Various small but distinct GFP positive colonies appeared 2-3 days after transfection and at day 5-7 the colonies were large enough for manual picking and transfer as individual colonies to fresh culture dishes

(Figure 3.A-B). These ntES-iPS colonies were GFP positive (Figure 3.C) and morphologically similar to the control early passage ntES cultures, with well-defined edges and monolayer organization. Since the colonies were already present at the time of transfection, the ALK receptor inhibitor SB431542 was not added to the iPS initial culture media.

Four independent ntES lines were transfected, and an average of 144 (± 30) ntES-iPS colonies were produced per cell line. The reprogramming efficiency was estimated to 0.167% (Table 1). Of those colonies, four (one from each horse) were selected and expanded into established ntES- iPS lines that were maintained up to at least 15 passages and all showed alkaline-phophatase staining (Figure 3.D).

The non-transfected ntES lines used as controls in this study were cultured in parallel with the ntES-iPS lines for comparative analysis. At early passage, ntES cells showed the typical morphology of rounded and monolayered colonies with well defined edges. However, from passages 6 to 8, ntES cells showed slower proliferation, as indicated by fewer colonies and delayed confluence compared with ntES-iPS lines (Figure 3.E-F). Of the four ntES lines used as controls in this study, two reached senescence at 10 passages (line 1 and 2), one at passage 15 (line 3) and the other at passage 17 (line 4). Moreover, most ntES cells cryopreserved at passage 13 and further did not survive after thawing (data not shown). This sluggish growth pattern and freezing sensitivity contrasted to ntES-iPS lines that continued growing vigorously without slowing for over 20 passages even after cryopreservation (data not shown). Together, these results indicate that transfection of ntES cells with the four exogenous reprogramming factors used in this study leads to the efficient and rapid derivation of morphologically and kinetically

   40  

stable ntES-iPS cell lines that reliably withstand cryopreservation. In support to the phenotypic characteristics of the ntES-iPS lines, immunofluorescence analyses revealed the expression of key pluripotency markers NANOG, TRA1-60, REX-1, SSEA1, SSEA-3 and SSEA4 in the ntES- iPS cell lines further supporting their pluripotent status (Figure 4).

Pluripotency Expression in ntES and ntES-iPS Cell lines

Our next step was to determine whether the expression levels of pluripotency genes were

upregulated in ntES-iPS cell lines in comparison to their respective ntES counterpart. Using qRT- PCR with equine-specific primers for the endogenous pluripotency markers, we observed a wide variation in the expression patterns of these genes among the four ntES-iPS cell lines. OCT4 and