Taqman Gene expression probes
Gene Abbreviation Gene name Species ABI assay ID
Acacb Acetyl-Coenzyme A carboxylase beta mouse Mm01204667_m1
ACS-1 Acyl-CoA synthetase long-chain family member 1 mouse Mm00484217_m1
Acsbg1 Acyl-CoA synthetase bubblegum family member 1 mouse Mm00547366_m1
AdipoQ Adiponectin mouse Mm00456425_m1
C/EBPα CCAAT/enhancer binding protein alpha mouse Mm00514283_s1
FABP-4 / aP2 Adipocyte fatty acid binding protein 4 / aP2 mouse Mm00445880_m1
FAT / CD36 CD36 antigen / fatty acid translocase mouse Mm00432403_m1
FATP / Slc27a1 Long-chain fatty acid transport protein 1 / Solute carrier family 27 member 1 mouse Mm00449511_m1
GyK Glycerol kinase mouse Mm00433907_m1
LPL Lipoprotein lipase mouse Mm00434764_m1
LXRα / NR1H3 Liver X receptor alpha / Nuclear receptor subfamily 1, group H, member 3 mouse Mm00443454_m1 OLR1 Oxidized low density lipoprotein receptor 1 / Lectin-like receptor 1 mouse Mm00454586_m1
PPARγ Peroxisome proliferator activated receptor gamma mouse Mm00440945_m1
SMRT Silencing mediator of retinoid and thyroid receptors/ Nuclear receptor co-repressor 2 mouse Mm00448796_m1
Promoter primers for ChIP
Gene Abbreviation Gene name Species Sequence (5'-> 3')
Forward TGCTGAATTATTGTCCTTACCC Reverse TTCTCTACCAGAGCAAGAGATGG Forward CATTTGCCTTCTTACTGGATCAGA Reverse TGGGCTGTGACACTTCCACTAGT Forward AATCCTAACCACATCTGAACTTTAGCA Reverse GCTGTCCCGTTGGAATCTGA
Forward CTCTTTCCCCTGCTGTCTGTTT Reverse CCAGTCATGCTTCATGACCTTTC Forward ACACATCAGTAGGAAAGCAAGAAA Reverse TTCCTTTCAAAACCTACATCTTCA mouse
P0
OLR1 Oxidized low density lipoprotein receptor 1 / Lectin-like receptor 1
mouse
GyK Glycerol kinase mouse
mouse
AdipoQ Adiponectin mouse
FABP-4 / aP2 Adipocyte fatty acid binding protein 4 / aP2
185
II.4. Discussion and Perspectives
The lentivirus mediated small interference RNA technique is a valuable tool for the down- regulation of different target genes. This technique could be used as a high through put screening method for the investigation of protein involvement in different metabolic pathways.
siRNA’s expression ensures an efficient and relatively easy knock-down of target genes without having any effect on other related proteins. Their use is particularly valuable in the absence of available knock-out cellular models or of specific inhibitors against the target protein. By their expression through lentivirus vectors, siRNAs can be used as a first step tools in the investigation of the role of a target protein in different pathways and cellular types. Indeed, by the use of lentivirus vectors we were able to transduce several cell types from different species such as mouse, human and finally rat. This is of high interest in our laboratory since very often experiments are conducted in at least two of the species mentioned above, giving us a certain flexibility in the choice of experimental models. Besides their tropism and high diversity in their ability to transduce different animal species, the lentivirus vectors ensure the permanent integration of siRNAs in the host genome, facilitating the creation of siRNAs expressing cell lines. Moreover, the expression of GFP proteins under the EF1α promoter by the same vector expressing the siRNAs, ensure the tracing of infected cells, their sorting when convenient and the measurement of the percentage of infected cells in a given populations. Furthermore, in contrast of other viral vectors, the lentivirus vectors were shown to be devoid of immunogenic potential for the host cells or organisms. However, we have to keep in mind that infection with lentivirus vectors gives populations of heterogeneous infected cells where the lentivirus genome can be integrated at different sites from one cell to another. Moreover, the number of integration sites might be also variable from one cell to another. The integration numbers can have a repercussion on the expression of endogenous genes, which served as integration site for the lentivirus.
As shown here, the siPPARβ was used successfully to decipher the role of this receptor in the embryonic death observed in the PPARβ-/- mice. siPPARβ lentivirus mediated expression allows an efficient infection of the rat Rcho-1 trophoblast. Their infection with siPPARβ inhibits
their differentiation into giant cells, which play a major role in placental development. Moreover, the use of this cellular model allowed the exploration of the pathway by which PPARβ is involved in their differentiation. We were able to show that PPARβ is involved in the control of the activity of several proteins from the Akt pathway as well as the expression of adipose differentiation related protein (ADRP) important for the lipid droplet accumulation in giant cells. In the future, using siRNA mediated knock-down of these proteins we could point out their role in the giant cell differentiation. Besides, the knock-down of ADRP could give us a hint on the role of lipid droplet accumulation in the giant cells during embryogenesis.
3T3L1 cells are often used as a suitable model for the in vitro adipocyte differentiation. The pertinence of this model was well proved during the last years. Infection of 3T3L1 cells with lentivirus vector expressing siPPARγ is an important tool when studying adipocyte differentiation.
As showed in section Results II.3.3.2., the use of siPPARγ in 3T3L1 cells proved that the adipogenic effect of phthalate plasticizers (such as Mono Ethyl Hexyl Phthalate and of its active metabolite Di Mono Ethyl Hexyl Phthalate) was PPARγ specific, since knock-down of this receptor blocked the adipocyte differentiation.
Future experiments using this powerful technique will certainly allow us to decipher other pathways controlled by PPAR members in metabolism but also in other cellular functions such as cancer, angiogenesis, tissue repair, inflammation and many others.
PERSPECTIVES