8.1-Extraction des ARN totaux
L’extraction des ARN totaux est réalisée à partir de 5 à 10 racines de plantes de M.
truncatula cultivées soit in vitro soit dans des caissons de brumisation, et traitées à l’eau ou
aux FNods (10-9M, 6h ou 24h) (voir chapitre V, sections 2.3 et 4.2). Pour les racines inoculées par S. meliloti, les ARN totaux sont extraits à partir de lots de 10 racines prélevées à 1, 3 et 7 jours post inoculation (jpi). Environ 30 à 50 mg de tissus racinaires congelés sont broyés dans l’azote liquide et les ARN totaux sont extraits en utilisant le kit "Total RNA purification from plant" (Macherey-Nagel, Hoerdt, France). Lors des différentes extractions, un traitement à la DNase (30 min, température ambiante) sur colonne est réalisé comme décrit dans le kit. L’absence de contamination par l'ADN génomique est confirmée par amplification PCR de séquences du gène rip1 (Cook et al., 1995) en utilisant des amorces positionnées de part et d’autre d’une séquence d’introns.
La concentration des ARN totaux est déterminée par mesure de l’absorbance à 260 nm avec le spectrophotomètre Nanodrop ND-1000 (Nanodrop Technologies, Wilminghton, DE, USA). La qualité des ARN totaux est vérifiée en utilisant le système de puces « Agilent RNA 6000 Nano » (Agilent Technologies, Santa Clara, CA, USA).
8.2-Synthèse du premier brin d’ADNc
De 0.5 à 1µg d'ARN totaux sont utilisés pour la synthèse des premiers brins d'ADNc à partir d’échantillons extraits de lots de racines entières (sauvages, mutantes ou transgéniques).
Gène cible Amorce 5' Amorce 3' Tm (°C)
MtENOD11 (3'UTR) GCGTATTTGCAAGCAACAAG CCACATGCAAAGATGGGACG 60
MtENOD11
(séq. Codante) TGTTCCTCTAGGGCTTGCTG TGGATGCTAGGTGGAGGCTG 60
MtENOD12 ATAGGCATCCTCCAGCAGAA AACTTGGCCTTGCCCATAC 60
MtN6 GGCTTCTCTGTACTCCCAGGTT AAACAACTTCGCGAGCATTC 60
MtNIN CGTCTTCTTCTTCGAGTGGGA GTAATCCCATGCTGTCTGCA 60
ENOD8 ACATTGGTGTTGGTTGTGGA GGAGGATCATTGAAAACTCCAG 60
EF1α CTTTGCTTGGTGCTGTTTAGATGG ATTCCAAAGGCGGCTGCATA 60
Les réactions ont été réalisées selon le protocole décrit pour la "Superscript II reverse transcriptase" (Invitrogen, Renfrewshire, U.K.) en utilisant un oligonucléotide ancré (17T+V à 2,5µM). Afin de contrôler l'efficacité de la reverse transcriptase dans les différents échantillons, 30 ng d'ARN de nébuline transcrit in vitro ont été inclus dans le volume réactionnel.
8.3-RT-PCR quantitative (qRT-PCR)
Le protocole de qRT-PCR utilisé est celui décrit par Sauviac et al. (2005). Les réactions d'amplification ont été réalisées avec le "Light Cycler Fast Start Reaction Mix MasterPLUS SYBR Green I" (Roche, Mannheim, Germany), sur un thermocycleur Roche "light cycler real time PCR" et selon les instructions du fabricant.
Chaque réaction de qRT-PCR a été réalisée avec 2µL d'une dilution 1:25 (v/v) d'ADNc premiers brins dans un volume final de 10µL. Les conditions d'amplification sont les suivantes: dénaturation initiale (95°C pendant 9 min) suivie de 45 cycles de dénaturation (95°C pendant 5 sec), hybridation (56-60°C pendant 10 sec), et élongation (72°C pendant 10- 30 sec). A la fin de la réaction de qPCR, la spécificité de chaque amplification est vérifiée d'abord par l'analyse des courbes de dissociation obtenues par le passage des échantillons de la température d'hybridation (60°C) à la température de dénaturation (95°C), ainsi que par l’analyse des échantillons sur gel d’agarose et/ou par séquençage du produit PCR obtenu. Les amorces et les températures d'hybridation utilisées pour l'amplification des séquences des gènes MtENOD11, MtENOD12, MtN6 ENOD8 et MtNIN et du facteur d'élongation EF1-α sont indiquées dans le tableau 5.7. Le gène EF1-α présente une expression constante dans nos conditions, et a donc servi comme contrôle interne afin de normaliser les niveaux d’expression obtenus sur nos gènes d’intérêt. Des fragments PCR correspondant à chaque gène ont été clonés dans pGEM-T (Promega, France) et des dilutions sériées (de 10-2 à 10-7) des plasmides obtenus ont été réalisées et utilisées dans chaque série de réactions qPCR pour générer une courbe de calibration. La concentration relative en transcrits dans chaque échantillon a été calculée sur la base de cette courbe de calibration, qui permet de corréler les valeurs de "cycle Threshold" (CT) obtenues à une concentration standard connue. Les niveaux
de transcrits des gènes MtENOD11, MtENOD12, MtN6, ENOD8 et MtNIN ont été normalisés avec les niveaux de transcrits du gène EF1-α. Les résultats présentés pour chaque échantillon représentent la moyenne de deux répétitions biologiques réalisées comprenant chacune deux réactions de qRT-PCR indépendantes (répétitions techniques).
Chapitre VI
109
-Chapitre VI-
Allison, L.A., Kiss, G.B., Bauer, P., Poiret, M., Pierre, M., Savoure, A., Kondorosi, E., and Kondorosi, A. (1993). Identification of 2 Alfalfa Early Nodulin Genes with Homology to Members of the Pea Enod12 Gene Family. Plant Molecular Biology 21, 375-380.
Andriankaja, A., Boisson-Demier, A., Frances, L., Sauviac, L., Jauneau, A., Barker, D.G., and de Carvalho-Niebel, F. (2007). AP2-ERF transcription factors mediate nod factor-dependent mt ENOD11 activation in root hairs via a novel cis-regulatory motif. Plant Cell 19, 2866-2885.
Ane, J.M., Levy, J., Thoquet, P., Kulikova, O., de Billy, F., Penmetsa, V., Kim, D.J., Debelle, F., Rosenberg, C., Cook, D.R., Bisseling, T., Huguet, T., and Denarie, J. (2002). Genetic and cytogenetic mapping of DMI1, DMI2, and DMI3 genes of
Medicago truncatula involved in Nod factor transduction, nodulation, and
mycorrhization. Mol Plant Microbe Interact 15, 1108-1118.
Ané, J.M., Kiss, G.B., Riely, B.K., Penmetsa, R.V., Oldroyd, G.E.D., Ayax, C., Levy, J., Debelle, F., Baek, J.M., Kalo, P., Rosenberg, C., Roe, B.A., Long, S.R., Denarie, J., and Cook, D.R. (2004). Medicago truncatula DMI1 required for bacterial and fungal symbioses in legumes. Science 303, 1364-1367.
Ané, J.M., Zhu, H., and Frugoli, J. (2008). Recent Advances in Medicago truncatula Genomics. Int J Plant Genomics 2008, 256597.
Ardourel, M., Demont, N., Debelle, F., Maillet, F., de Billy, F., Prome, J.C., Denarie, J., and Truchet, G. (1994). Rhizobium meliloti lipooligosaccharide nodulation factors: different structural requirements for bacterial entry into target root hair cells and induction of plant symbiotic developmental responses. Plant Cell 6, 1357-1374.
Arrighi, J.F., Barre, A., Ben Amor, B., Bersoult, A., Soriano, L.C., Mirabella, R., de Carvalho-Niebel, F., Journet, E.P., Gherardi, M., Huguet, T., Geurts, R., Denarie, J., Rouge, P., and Gough, C. (2006). The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes. Plant Physiology 142, 265-279.
Auriac, M.C., and Timmers, A.C. (2007). Nodulation studies in the model legume
Medicago truncatula: advantages of using the constitutive EF1alpha promoter and
limitations in detecting fluorescent reporter proteins in nodule tissues. Mol Plant Microbe Interact 20, 1040-1047.
Averyhart-Fullard, V., Datta, K., and Marcus, A. (1988). A hydroxyproline-rich protein in the soybean cell wall. Proc Natl Acad Sci U S A 85, 1082-1085.
Battaglia, M., Solorzano, R.M., Hernandez, M., Cuellar-Ortiz, S., Garcia-Gomez, B., Marquez, J., and Covarrubias, A.A. (2007). Proline-rich cell wall proteins accumulate in growing regions and phloem tissue in response to water deficit in common bean seedlings. Planta 225, 1121-1133.
Bauchrowitz, M. (1995). Lectin genes from Medicago truncatula : cloning, characterization and analysis of expression patterns during Rhizobium-legume symbiosis. Thèse de Doctorat (Université de Freiburg, Allemagne).
Bauer, P., Crespi, M.D., Szecsi, J., Allison, L.A., Schultze, M., Ratet, P., Kondorosi, E., and Kondorosi, A. (1994). Alfalfa Enod12 Genes Are Differentially Regulated During Nodule Development by Nod Factors and Rhizobium Invasion. Plant Physiology 105, 585-592.
Chapitre VI
111 Bauer, P., Poirier, S., Ratet, P., and Kondorosi, A. (1997). MsEnod12A expression is
linked to meristematic activity during development of indeterminate and determinate nodules and roots. Molecular Plant-Microbe Interactions 10, 39-49.
Becker, A., Fraysse, N., and Sharypova, L. (2005). Recent advances in studies on structure and symbiosis-related function of rhizobial K-antigens and lipopolysaccharides. Mol Plant Microbe Interact 18, 899-905.
Ben Amor, B., Shaw, S.L., Oldroyd, G.E.D., Maillet, F., Penmetsa, R.V., Cook, D., Long, S.R., Denarie, J., and Gough, C. (2003). The NFP locus of Medicago truncatula controls an early step of Nod factor signal transduction upstream of a rapid calcium flux and root hair deformation. Plant Journal 34, 495-506.
Benaben, V., Duc, G., Lefebvre, V., and Huguet, T. (1995). TE7, An Inefficient Symbiotic Mutant of Medicago truncatula Gaertn. cv Jemalong. Plant Physiol 107, 53-62.
Bendtsen, J.D., Nielsen, H., von Heijne, G., and Brunak, S. (2004). Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340, 783-795.
Benlloch, R., d'Erfurth, I., Ferrandiz, C., Cosson, V., Beltran, J.P., Canas, L.A., Kondorosi, A., Madueno, F., and Ratet, P. (2006). Isolation of mtpim proves Tnt1 a useful reverse genetics tool in Medicago truncatula and uncovers new aspects of AP1- like functions in legumes. Plant Physiol 142, 972-983.
Bernard, P., and Couturier, M. (1992). Cell killing by the F plasmid CcdB protein involves poisoning of DNA-topoisomerase II complexes. J Mol Biol 226, 735-745.
Bernard, P., Kezdy, K.E., Van Melderen, L., Steyaert, J., Wyns, L., Pato, M.L., Higgins, P.N., and Couturier, M. (1993). The F plasmid CcdB protein induces efficient ATP- dependent DNA cleavage by gyrase. J Mol Biol 234, 534-541.
Bernhardt, C., and Tierney, M.L. (2000). Expression of AtPRP3, a proline-rich structural cell wall protein from arabidopsis, is regulated by cell-type-specific developmental pathways involved in root hair formation. Plant Physiology 122, 705-714.
Bersoult, A., Camut, S., Perhald, A., Kereszt, A., Kiss, G.B., and Cullimore, J.V. (2005). Expression of the Medicago truncatula DMI2 gene suggests roles of the symbiotic nodulation receptor kinase in nodules and during early nodule development. Molecular Plant-Microbe Interactions 18, 869-876.
Bibikova, T.N., Jacob, T., Dahse, I., and Gilroy, S. (1998). Localized changes in apoplastic and cytoplasmic pH are associated with root hair development in Arabidopsis
thaliana. Development 125, 2925-2934.
Bibikova, T.N., Gilroy, S. (2003). Root hair development. J. Plant Growth Regul. 21, 383- 415.
Boisson-Dernier, A., Chabaud, M., Garcia, F., Becard, G., Rosenberg, C., and Barker, D.G. (2001). Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations. Mol Plant Microbe Interact 14, 695-700.
Boisson-Dernier, A., Andriankaja, A., Chabaud, M., Niebel, A., Journet, E.P., Barker, D.G., and de Carvalho-Niebel, F. (2005). MtENOD11 gene activation during rhizobial infection and mycorrhizal arbuscule development requires a common AT- rich-containing regulatory sequence. Molecular Plant-Microbe Interactions 18, 1269- 1276.
Boivin, C., Ndoye, I., Lortet, G., Ndiaye, A., De Lajudie, P., and Dreyfus, B. (1997). The
Form Stem Nodules on Sesbania rostrata, although They Are Less Adapted to Stem Nodulation than Azorhizobium caulinodans. Appl Environ Microbiol 63, 1040-1047. Bono, J.J., Riond, J., Nicolaou, K.C., Bockovich, N.J., Estevez, V.A., Cullimore, J.V.,
and Ranjeva, R. (1995). Characterization of a Binding-Site for Chemically Synthesized Lipo-Oligosaccharidic Nodrm Factors in Particulate Fractions Prepared from Roots. Plant Journal 7, 253-260.
Borisov, A.Y., Madsen, L.H., Tsyganov, V.E., Umehara, Y., Voroshilova, V.A., Batagov, A.O., Sandal, N., Mortensen, A., Schauser, L., Ellis, N., Tikhonovich, I.A., and Stougaard, J. (2003). The Sym35 gene required for root nodule development in pea is an ortholog of Nin from Lotus japonicus. Plant Physiol 131, 1009-1017.
Boualem, A., Laporte, P., Jovanovic, M., Laffont, C., Plet, J., Combier, J.P., Niebel, A., Crespi, M., and Frugier, F. (2008). MicroRNA166 controls root and nodule development in Medicago truncatula. Plant J 54, 876-887.
Bradley, D.J., Kjellbom, P., and Lamb, C.J. (1992). Elicitor- and wound-induced oxidative cross-linking of a proline-rich plant cell wall protein: a novel, rapid defense response. Cell 70, 21-30.
Brewin, N.J. (1991). Development of the legume root nodule. Annu Rev Cell Biol 7, 191- 226.
Brewin, N.J. (2004). Plant cell wall remodelling in the rhizobium-legume symbiosis. Critical Reviews in Plant Sciences 23, 293-316.
Bright, L.J., Liang, Y., Mitchell, D.M., and Harris, J.M. (2005). The LATD gene of
Medicago truncatula is required for both nodule and root development. Mol Plant
Microbe Interact 18, 521-532.
Broughton, W.J., Jabbouri, S., and Perret, X. (2000). Keys to symbiotic harmony. Journal of Bacteriology 182, 5641-5652.
Caetano-Anolles, G., and Gresshoff, P.M. (1991). Plant genetic control of nodulation. Annu Rev Microbiol 45, 345-382.
Campbell, R.E., Tour, O., Palmer, A.E., Steinbach, P.A., Baird, G.S., Zacharias, D.A., and Tsien, R.Y. (2002). A monomeric red fluorescent protein. Proc Natl Acad Sci U S A 99, 7877-7882.
Capoen, W., Goormachtig, S., De Rycke, R., Schroeyers, K., and Holsters, M. (2005). SrSymRK, a plant receptor essential for symbiosome formation. Proc Natl Acad Sci U S A 102, 10369-10374.
Cardenas, L., Vidali, L., Domnguez, J., Prez, H., Snchez, F., Hepler, P.K., and Quinto, C. (1998). Rearrangement of actin microfilaments in plant root hairs responding to
rhizobium etli nodulation signals. Plant Physiol 116, 871-877.
Cassab, G.I. (1998). Plant Cell Wall Proteins. Annu Rev Plant Physiol Plant Mol Biol 49, 281-309.
Catoira, R., Galera, C., de Billy, F., Penmetsa, R.V., Journet, E.P., Maillet, F., Rosenberg, C., Cook, D., Gough, C., and Denarie, J. (2000). Four genes of
Medicago truncatula controlling components of a nod factor transduction pathway.
Plant Cell 12, 1647-1665.
Catoira, R., Timmers, A.C.J., Maillet, F., Galera, C., Penmetsa, R.V., Cook, D., Denarie, J., and Gough, C. (2001). The HCL gene of Medicago truncatula controls Rhizobium-induced root hair curling. Development 128, 1507-1518.
Chapitre VI
113 Cermola, M., Fedorova, E., Tate, R., Riccio, A., Favre, R., and Patriarca, E.J. (2000).
Nodule invasion and symbiosome differentiation during Rhizobium etli-Phaseolus
vulgaris symbiosis. Mol Plant Microbe Interact 13, 733-741.
Chabaud, M., Larsonneau, C., Marmouget, C., and Huguet, T. (1996). Transformation of barrel medic (Medicago truncatula Gaertn) by Agrobacterium tumefaciens and regeneration via somatic embryogenesis of transgenic plants with the MtENOD12 nodulin promoter fused to the gus reporter gene. Plant Cell Reports 15, 305-310. Chabaud, M., Venard, C., Defaux-Petras, A., Becard, G., and Barker, D.G. (2002).
Targeted inoculation of Medicago truncatula in vitro root cultures reveals MtENOD11 expression during early stages of infection by arbuscular mycorrhizal fungi. New Phytologist 156, 265-273.
Chabaud, M., de Carvalho-Niebel, F., and Barker, D.G. (2003). Efficient transformation of Medicago truncatula cv. Jemalong using the hypervirulent Agrobacterium
tumefaciens strain AGL1. Plant Cell Rep 22, 46-51.
Charron, D., Pingret, J.L., Chabaud, M., Journet, E.P., and Barker, D.G. (2004). Pharmacological evidence that multiple phospholipid signaling pathways link rhizobium nodulation factor perception in Medicago truncatula root hairs to intracellular responses, including Ca2+ spiking and specific ENOD gene expression. Plant Physiology 136, 3582-3593.
Cheng, H.P., and Walker, G.C. (1998). Succinoglycan is required for initiation and elongation of infection threads during nodulation of alfalfa by Rhizobium meliloti. J Bacteriol 180, 5183-5191.
Choi, H.K., Mun, J.H., Kim, D.J., Zhu, H., Baek, J.M., Mudge, J., Roe, B., Ellis, N., Doyle, J., Kiss, G.B., Young, N.D., and Cook, D.R. (2004). Estimating genome conservation between crop and model legume species. Proc Natl Acad Sci U S A 101, 15289-15294.
Combier, J.P., Frugier, F., de Billy, F., Boualem, A., El-Yahyaoui, F., Moreau, S., Vernie, T., Ott, T., Gamas, P., Crespi, M., and Niebel, A. (2006). MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by
microRNA169 in Medicago truncatula. Genes Dev 20, 3084-3088.
Combier, J.P., Vernie, T., de Billy, F., El Yahyaoui, F., Mathis, R., and Gamas, P. (2007). The MtMMPL1 early nodulin is a novel member of the matrix metalloendoproteinase family with a role in Medicago truncatula infection by Sinorhizobium meliloti. Plant Physiol 144, 703-716.
Compaan, B., Yang, W.C., Bisseling, T., and Franssen, H. (2001). ENOD40 expression in the pericycle precedes cortical cell division in Rhizobium-legume interaction and the highly conserved internal region of the gene does not encode a peptide. Plant and Soil 230, 1-8.
Cook, D., Dreyer, D., Bonnet, D., Howell, M., Nony, E., and VandenBosch, K. (1995). Transient induction of a peroxidase gene in Medicago truncatula precedes infection by
Rhizobium meliloti. Plant Cell 7, 43-55.
Cook, D.R. (1999). Medicago truncatula - a model in the making! Commentary. Current Opinion in Plant Biology 2, 301-304.
Cooper, J.B., and Long, S.R. (1994). Morphogenetic Rescue of Rhizobium-Meliloti Nodulation Mutants by Trans-Zeatin Secretion. Plant Cell 6, 215-225.
Cooper, J.E. (2007). Early interactions between legumes and rhizobia: disclosing complexity in a molecular dialogue. Journal of Applied Microbiology 103, 1355-1365.
Coque, L., Neogi, P., Pislariu, C., Wilson, K.A., Catalano, C., Avadhani, M., Sherrier, D.J., and Dickstein, R. (2008). Transcription of ENOD8 in Medicago truncatula nodules directs ENOD8 esterase to developing and mature symbiosomes. Mol Plant Microbe Interact 21, 404-410.
Crespi, M.D., Jurkevitch, E., Poiret, M., Daubentoncarafa, Y., Petrovics, G., Kondorosi, E., and Kondorosi, A. (1994). Enod40, a Gene Expressed During Nodule Organogenesis, Codes for a Nontranslatable Rna Involved in Plant-Growth. Embo Journal 13, 5099-5112.
Csanadi, G., Szecsi, J., Kalo, P., Kiss, P., Endre, G., Kondorosi, A., Kondorosi, E., and Kiss, G.B. (1994). Enod12, an Early Nodulin Gene, Is Not Required for Nodule Formation and Efficient Nitrogen-Fixation in Alfalfa. Plant Cell 6, 201-213.
de Carvalho-Niebel, F., Lescure, N., Cullimore, J.V., and Gamas, P. (1998). The
Medicago truncatula MtAnn1 gene encoding an annexin is induced by nod factors and
during the symbiotic interaction with Rhizobium meliloti. Molecular Plant-Microbe Interactions 11, 504-513.
de Carvalho-Niebel, F., Timmers, A.C.J., Chabaud, M., Defaux-Petras, A., and Barker, D.G. (2002). The Nod factor-elicited annexin MtAnn1 is preferentially localised at the nuclear periphery in symbiotically activated root tissues of Medicago truncatula. Plant Journal 32, 343-352.
de Ruijter, N.C.A., Rook, M.B., Bisseling, T., and Emons, A.M.C. (1998). Lipochito- oligosaccharides re-initiate root hair tip growth in Vicia sativa with high calcium and spectrin-like antigen at the tip. Plant Journal 13, 341-350.
de Ruijter, N.C.A., Bisseling, T., and Emons, A.M.C. (1999). Rhizobium Nod factors induce an increase in sub-apical fine bundles of actin filaments in Vicia sativa root hairs within minutes. Molecular Plant-Microbe Interactions 12, 829-832.
Denarie, J., Debelle, F., and Prome, J.C. (1996). Rhizobium lipo-chitooligosaccharide nodulation factors: signaling molecules mediating recognition and morphogenesis. Annu Rev Biochem 65, 503-535.
Denarié, J., Debellé, F., and Rosenberg, C. (1992). Signaling and Host Range Variation in Nodulation. Annual Review of Microbiology 46, 497-531.
d'Erfurth, I., Cosson, V., Eschstruth, A., Lucas, H., Kondorosi, A., and Ratet, P. (2003). Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume
Medicago truncatula. Plant J 34, 95-106.
D'Haeze, W., and Holsters, M. (2002). Nod factor structures, responses, and perception during initiation of nodule development. Glycobiology 12, 79R-105R.
D'Haeze, W., Glushka, J., De Rycke, R., Holsters, M., and Carlson, R.W. (2004). Structural characterization of extracellular polysaccharides of Azorhizobium caulinodans and importance for nodule initiation on Sesbania rostrata. Mol Microbiol 52, 485-500.
Dickstein, R., Bisseling, T., Reinhold, V.N., and Ausubel, F.M. (1988). Expression of Nodule-Specific Genes in Alfalfa Root-Nodules Blocked at an Early Stage of Development. Genes & Development 2, 677-687.
Chapitre VI
115 Dower, W.J., Miller, J.F., and Ragsdale, C.W. (1988). High-Efficiency Transformation of
Escherichia-Coli by High-Voltage Electroporation. Nucleic Acids Research 16, 6127-
6145.
Downie, J.A., and Walker, S.A. (1999). Plant responses to nodulation factors. Current Opinion in Plant Biology 2, 483-489.
Ehrhardt, D.W., Atkinson, E.M., and Long, S.R. (1992). Depolarization of Alfalfa Root Hair Membrane-Potential by Rhizobium-Meliloti Nod Factors. Science 256, 998-1000. Ehrhardt, D.W., Wais, R., and Long, S.R. (1996). Calcium spiking in plant root hairs
responding to Rhizobium nodulation signals. Cell 85, 673-681.
El Yahyaoui, F., Kuster, H., Ben Amor, B., Hohnjec, N., Puhler, A., Becker, A., Gouzy, J., Vernie, T., Gough, C., Niebel, A., Godiard, L., and Gamas, P. (2004). Expression profiling in Medicago truncatula identifies more than 750 genes differentially expressed during nodulation, including many potential regulators of the symbiotic program. Plant Physiol 136, 3159-3176.
Endre, G., Kereszt, A., Kevei, Z., Mihacea, S., Kalo, P., and Kiss, G.B. (2002). A receptor kinase gene regulating symbiotic nodule development. Nature 417, 962-966.
Estevez, J.M., Kieliszewski, M.J., Khitrov, N., and Somerville, C. (2006). Characterization of synthetic hydroxyproline-rich proteoglycans with arabinogalactan protein and extensin motifs in Arabidopsis. Plant Physiol 142, 458-470.
Fang, Y.W., and Hirsch, A.M. (1998). Studying early nodulin gene ENOD40 expression and induction by nodulation factor and cytokinin in transgenic alfalfa. Plant Physiology 116, 53-68.
Felle, H.H., Kondorosi, E., Kondorosi, A., and Schultze, M. (1996). Rapid alkalinization in alfalfa root hairs in response to rhizobial lipochitooligosaccharide signals. Plant Journal 10, 295-301.
Felle, H.H., Kondorosi, E., Kondorosi, A., and Schultze, M. (1998). The role of ion fluxes in Nod factor signalling in Medicago sativa. Plant Journal 13, 455-463.
Ferguson, B.J., and Mathesius, U. (2003). Signaling interactions during nodule development. Journal of Plant Growth Regulation 22, 47-72.
Filipowicz, W., Bhattacharyya, S.N., and Sonenberg, N. (2008). Mechanisms of post- transcriptional regulation by microRNAs: are the answers in sight? Nature Reviews Genetics 9, 102-114.
Foucher, F., and Kondorosi, E. (2000). Cell cycle regulation in the course of nodule organogenesis in Medicago. Plant Molecular Biology 43, 773-786.
Fowler, T.J., Bernhardt, C., and Tierney, M.L. (1999). Characterization and expression of four proline-rich cell wall protein genes in Arabidopsis encoding two distinct subsets of multiple domain proteins. Plant Physiology 121, 1081-1091.
Franssen, H.J., Nap, J.P., Gloudemans, T., Stiekema, W., Vandam, H., Govers, F., Louwerse, J., Vankammen, A., and Bisseling, T. (1987). Characterization of Cdna for Nodulin-75 of Soybean - a Gene-Product Involved in Early Stages of Root Nodule Development. Proceedings of the National Academy of Sciences of the United States of America 84, 4495-4499.
Fraysse, N., Couderc, F., and Poinsot, V. (2003). Surface polysaccharide involvement in establishing the Rhizobium-legume symbiosis. European Journal of Biochemistry 270, 1365-1380.
Frugier, F., Kosuta, S., Murray, J.D., Crespi, M., and Szczyglowski, K. (2008). Cytokinin: secret agent of symbiosis. Trends Plant Sci 13, 115-120.
Gage, D.J., Bobo, T., and Long, S.R. (1996). Use of green fluorescent protein to visualize the early events of symbiosis between Rhizobium meliloti and alfalfa (Medicago
sativa). J Bacteriol 178, 7159-7166.
Gage, D.J., and Margolin, W. (2000). Hanging by a thread: invasion of legume plants by rhizobia. Current Opinion in Microbiology 3, 613-617.
Gage, D.J. (2002). Analysis of infection thread development using Gfp- and DsRed- expressing SinoRhizobium meliloti. Journal of Bacteriology 184, 7042-7046.
Gage, D.J. (2004). Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol Mol Biol Rev 68, 280-300.
Galibert, F., Finan, T.M., Long, S.R., Puhler, A., Abola, P., Ampe, F., Barloy-Hubler, F., Barnett, M.J., Becker, A., Boistard, P., Bothe, G., Boutry, M., Bowser, L., Buhrmester, J., Cadieu, E., Capela, D., Chain, P., Cowie, A., Davis, R.W., Dreano, S., Federspiel, N.A., Fisher, R.F., Gloux, S., Godrie, T., Goffeau, A., Golding, B., Gouzy, J., Gurjal, M., Hernandez-Lucas, I., Hong, A., Huizar, L., Hyman, R.W., Jones, T., Kahn, D., Kahn, M.L., Kalman, S., Keating, D.H., Kiss, E., Komp, C., Lalaure, V., Masuy, D., Palm, C., Peck, M.C., Pohl, T.M., Portetelle, D., Purnelle, B., Ramsperger, U., Surzycki, R., Thebault, P., Vandenbol, M., Vorholter, F.J., Weidner, S., Wells, D.H., Wong, K., Yeh, K.C., and Batut, J. (2001). The composite genome of the legume symbiont Sinorhizobium
meliloti. Science 293, 668-672.
Gamas, P., Niebel, F.D.C., Lescure, N., and Cullimore, J.V. (1996). Use of a subtractive hybridization approach to identify new Medicago truncatula genes induced during root nodule development. Molecular Plant-Microbe Interactions 9, 233-242.
Gamas, P., de Billy, F., and Truchet, G. (1998). Symbiosis-specific expression of two
Medicago truncatula nodulin genes, MtN1 and MtN13, encoding products
homologous to plant defense proteins. Molecular Plant-Microbe Interactions 11, 393- 403.
Gao, M., D'Haeze, W., De Rycke, R., Wolucka, B., and Holsters, M. (2001). Knockout of an azorhizobial dTDP-L-rhamnose synthase affects lipopolysaccharide and extracellular polysaccharide production and disables symbiosis with Sesbania
rostrata. Mol Plant Microbe Interact 14, 857-866.
Genovesi, V., Fornale, S., Fry, S.C., Ruel, K., Ferrer, P., Encina, A., Sonbol, F.M., Bosch, J., Puigdomenech, P., Rigau, J., and Caparros-Ruiz, D. (2008). ZmXTH1, a new xyloglucan endotransglucosylase/hydrolase in maize, affects cell wall structure and composition in Arabidopsis thaliana. Journal of Experimental Botany 59, 875- 889.
Geurts, R., and Bisseling, T. (2002). Rhizobium nod factor perception and signalling. Plant Cell 14, S239-S249.
Gherbi, H., Markmann, K., Svistoonoff, S., Estevan, J., Autran, D., Giczey, G., Auguy, F., Peret, B., Laplaze, L., Franche, C., Parniske, M., and Bogusz, D. (2008). SymRK defines a common genetic basis for plant root endosymbioses with arbuscular mycorrhiza fungi, rhizobia, and Frankia bacteria. Proceedings of the National Academy of Sciences of the United States of America 105, 4928-4932.
Chapitre VI
117 Gleason, C., Chaudhuri, S., Yang, T., Munoz, A., Poovaiah, B.W., and Oldroyd, G.E.
(2006). Nodulation independent of rhizobia induced by a calcium-activated kinase lacking autoinhibition. Nature 441, 1149-1152.
Godfroy, O., Debelle, F., Timmers, T., and Rosenberg, C. (2006). A rice calcium- and calmodulin-dependent protein kinase restores nodulation to a legume mutant. Molecular Plant-Microbe Interactions 19, 495-501.
Godiard, L., Niebel, A., Micheli, F., Gouzy, J., Ott, T., and Gamas, P. (2007). Identification of new potential regulators of the Medicago truncatula-Sinorhizobium
meliloti symbiosis using a large-scale suppression subtractive hybridization approach.