[PDF] Top 20 The C-Terminal Domain of the Sudan Ebolavirus L Protein Is Essential for RNA Binding and Methylation
Has 10000 "The C-Terminal Domain of the Sudan Ebolavirus L Protein Is Essential for RNA Binding and Methylation" found on our website. Below are the top 20 most common "The C-Terminal Domain of the Sudan Ebolavirus L Protein Is Essential for RNA Binding and Methylation".
The C-Terminal Domain of the Sudan Ebolavirus L Protein Is Essential for RNA Binding and Methylation
... HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or ...not. The documents may ... Voir le document complet
22
The methyltransferase domain of the Sudan ebolavirus L protein specifically targets internal adenosines of RNA substrates, in addition to the cap structure
... RNA methylation also plays a key role in disguising viral RNAs as host ‘self’ RNAs, allowing them to escape host surveillance by intracellular sensors regulating interferon ...receptors and RIG-like ... Voir le document complet
12
A Crystal Structure of the Dengue Virus NS5 Protein Reveals a Novel Inter-domain Interface Essential for Protein Flexibility and Virus Replication
... Structural and functional studies of the complete NS5 polypeptide have been initiated by several research ...model for NS5 from WNV was proposed [ 12 ]. In this model, the MTase active ... Voir le document complet
28
Allele-specific binding of RNA-binding proteins reveals functional genetic variants in the RNA
... tested the functional impacts of three disease-associated ASB ...requiring the SNVs to reside in exons or within 500 nt to exon–intron ...boundaries. The splicing reporters were con- structed ... Voir le document complet
16
Triadin binding to the C-terminal luminal loop of the ryanodine receptor is important for skeletal muscle excitation contraction coupling.
... stores is controlled by complex interactions between multiple ...Triadin is a transmembrane glycoprotein of the junctional sarcoplasmic reticulum of striated muscle that interacts with ... Voir le document complet
15
TGF-B induced protein IG-H3 is essential for the growth of human liver metastases
... TGFB-INDUCED PROTEIN IG-H3 IS ESSENTIAL FOR THE GROWTH OF HUMAN LIVER ...University of Liege, Liège, Belgium ; (2) Centre Hospitalier Universitaire de Liège, Liège, ... Voir le document complet
1
Structural dynamics in the C terminal domain homolog of orange carotenoid protein reveals residues critical for carotenoid uptake
... partner. The hinge point that allows this rotation of the CTT helix between the closed and open conformation is between A129 and ...S130. The phi and psi ... Voir le document complet
38
A Single-Domain Antibody Targeting Complement Component C5 Acts as a Selective Inhibitor of the Terminal Pathway of the Complement System and Thus Functionally Mimicks the C-Terminal Domain of the Staphylococcus aureus SSL7 Protein
... and deposition of the lytic complex on both endothelial cells and ...reproducing the selectivity of the inhibition observed with SSL7-CT, ...CP- and AP-induced ... Voir le document complet
12
The cAMP pathway regulates mRNA decay through phosphorylation of the RNA-binding protein TIS11b/BRF1
... S334 is a key residue in TIS11b interaction with the mRNA decay machinery TTP has been reported to activate both 3′→5′ mRNA decay, by recruiting the multi- subunit Ccr4-Not deadenylase complex to ... Voir le document complet
15
The Set1 N-terminal domain and Swd2 interact with RNA polymerase II CTD to recruit COMPASS
... ). The GEO accession number for the sequence data reported in this paper is ...(Y2H). The SET1 open reading frame was cloned as a bait into vector pB66 (N-GAL4 BD-bait-C ...screening ... Voir le document complet
11
S100A4 Protein Is Essential for the Development of Mature Microfold Cells in Peyer’s Patches
... ) and DOCK2-GFP knock-in mice ( Kunisaki et ...within the exon 2 of mouse S100a4 was selected using the CHOPCHOP web design tool ( ...0 and 5 0 - AAACTGGTCAGTAGCTCCTTGAGC 3 0 ) ... Voir le document complet
21
Removal of C-terminal Src kinase from the immune synapse by a new binding protein
... regulates the Src family kinases Lck and Fyn in T cells. Engagement of the T cell antigen receptor results in a removal of Csk from the lipid raft-associated transmembrane ... Voir le document complet
1
Molecular dynamics studies of the nucleoprotein of influenza A virus: role of the protein flexibility in RNA binding
... structure of the H1N1 protein to which the missing regions have been ...modeling is an available tool to study protein dynamics, especially of flexible regions unsolved by ... Voir le document complet
10
Inactivation of the Celf1 gene that encodes an RNA-binding protein delays the first wave of spermatogenesis in mice.
... Quantification of the delay of the first wave of ...A, For each mouse, we analysed 300 seminiferous tubules in 15 testis ...to the most differentiated germ cells that it ... Voir le document complet
9
The C-Terminal Domain of the Bacterial SSB Protein Acts as a DNA Maintenance Hub at Active Chromosome Replication Forks
... of RecS and RecQ appear similar (between 150 and 300 copies per cell) as judged by western-blotting of total protein extracts of cells expressing the RecS-SPA or RecQ-SPA ... Voir le document complet
16
RNA-directed DNA methylation
... whether RNA-directed coding- sequence-methylation has functional consequences, it is evident from both transgene and RNA-virus-experiments that dsRNA can also trigger promoter ... Voir le document complet
8
Terminal minihelix, a novel RNA motif that directs polymerase III transcripts to the cell cytoplasm - Terminal minihelix and RNA export
... Singer**, and Alain Doglio‡ ‡‡ From the ‡U526-Laboratoire de Virologie, Faculte´ de Me´decine, Avenue de Valombrose, 06107 Nice cedex 2, France, the 储 Institut de Ge´ne´tique Mole´culaire de ... Voir le document complet
10
The Cish SH2 domain is essential for PLC-gamma 1 regulation in TCR stimulated CD8(+) T cells
... Transfection of Jurkat cells, fixation and ...using the Amaxa ...μg/ml of antibody (anti-CD3-Ucht1) from BD Pharmigen (custom concentration of Catalog # ...550367). The chambers ... Voir le document complet
10
Random mutagenesis defines a domain of Theiler's virus leader protein which is essential for antagonism of nucleocytoplasmic trafficking and of cytokine gene expression
... Trafficking and Cytokine Gene Expression 䌤 Ce ´line Ricour, 1 Fabian Borghese, 1 Fre ´de ´ric Sorgeloos, 1 Stanleyson ...2 and Thomas Michiels 1 * Universite ´ catholique de Louvain, de Duve Institute, ... Voir le document complet
10
Potassium Acts as a GTPase-Activating Element on Each Nucleotide-Binding Domain of the Essential Bacillus subtilis EngA
... hydrolyze and to exchange nucleotides rapidly, several bacterial GTPases involved in ribosome assembly show a relatively high intrinsic GTPase activity even in the absence of additional ... Voir le document complet
15
Sujets connexes