• Aucun résultat trouvé

[PDF] Top 20 Syphilis infection is associated with an increase in plasma viral load in HIV infected patients: results from the FHDH cohort -- ANRS CO4

Has 10000 "Syphilis infection is associated with an increase in plasma viral load in HIV infected patients: results from the FHDH cohort -- ANRS CO4" found on our website. Below are the top 20 most common "Syphilis infection is associated with an increase in plasma viral load in HIV infected patients: results from the FHDH cohort -- ANRS CO4".

Syphilis infection is associated with an increase in plasma viral load in HIV infected patients: results from the FHDH cohort -- ANRS CO4

Syphilis infection is associated with an increase in plasma viral load in HIV infected patients: results from the FHDH cohort -- ANRS CO4

... Syphilis infection is associated with an increase in plasma viral load in HIV infected patients: results ... Voir le document complet

3

Trends in survival after cancer diagnosis among HIV-infected individuals between 1992 and 2009. Results from the FHDH-ANRS CO4 cohort

Trends in survival after cancer diagnosis among HIV-infected individuals between 1992 and 2009. Results from the FHDH-ANRS CO4 cohort

... of the study is not taking into account of the causes of death in the analyses, although, in patients with multiple co-morbidities, the collected causes of ... Voir le document complet

33

Is Impact of Statin Therapy on All-Cause Mortality Different in HIV-Infected Individuals Compared to General Population? Results from the FHDH-ANRS CO4 Cohort

Is Impact of Statin Therapy on All-Cause Mortality Different in HIV-Infected Individuals Compared to General Population? Results from the FHDH-ANRS CO4 Cohort

... (HIV) infection induces chronic inflammation and immune activation, even during effective antiretroviral therapy (ART) [ 1 ...are associated with adverse cardiovascular outcomes in both ... Voir le document complet

10

Distinct Genetic Loci Control Plasma HIV-RNA and Cellular HIV-DNA Levels in HIV-1 Infection: The ANRS Genome Wide Association 01 Study

Distinct Genetic Loci Control Plasma HIV-RNA and Cellular HIV-DNA Levels in HIV-1 Infection: The ANRS Genome Wide Association 01 Study

... that the top SNPs associated with the control of viral load are located in the MHC locus in our and Fellay’s study even that the Fellay et ... Voir le document complet

12

Factors associated with non-AIDS-defining cancers and non HCV-liver related cancers in HIV/HCV-coinfected patients- ANRS-CO13 HEPAVIH cohort

Factors associated with non-AIDS-defining cancers and non HCV-liver related cancers in HIV/HCV-coinfected patients- ANRS-CO13 HEPAVIH cohort

... HCV infection in our patients (median 14 (8–22) years), no association was observed with HCV-related variables such as HCV transmission group, duration of HCV infection, cirrhosis, HCV ... Voir le document complet

12

Reduced bone mineral density in HIV-infected patients: prevalence and associated factors.: Reduced bone mineral density in HIV patients

Reduced bone mineral density in HIV-infected patients: prevalence and associated factors.: Reduced bone mineral density in HIV patients

... of the factors found to be associated with BMD, some of them were usual such as older age or lower BMI and others are described for the first time such as homosexual HIV transmission ... Voir le document complet

22

Hepatitis B testing, treatment, and virologic suppression in HIV-infected patients in Cameroon (ANRS 12288 EVOLCAM)

Hepatitis B testing, treatment, and virologic suppression in HIV-infected patients in Cameroon (ANRS 12288 EVOLCAM)

... population The cross-sectional ANRS 12288 EVOLCAM survey was performed between March and December 2014 in HIV- infected patients followed up in 19 hospitals in ... Voir le document complet

11

PLA2G1B is involved in CD4 anergy and CD4 lymphopenia in HIV-infected patients

PLA2G1B is involved in CD4 anergy and CD4 lymphopenia in HIV-infected patients

... HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or ...not. The documents may come from ... Voir le document complet

51

Ethical reflections on pharmacogenetics and DNA banking in a cohort of HIV-infected patients.

Ethical reflections on pharmacogenetics and DNA banking in a cohort of HIV-infected patients.

... respected is the patient's right not to receive the ...desirable in some cases not to pass on information that it is psychologically difficult for the ...Therefore, the ... Voir le document complet

19

Gut microbiota associated with HIV infection is significantly enriched in bacteria tolerant to oxygen

Gut microbiota associated with HIV infection is significantly enriched in bacteria tolerant to oxygen

... and the surrounding conserved regions V3_V4 primers with overhang adapters (FwOvAd_341F CGTCGGCAGCGTCAGATGTGTATAAG AGACAGCCTACGGGNGGCWGCAG; RevOvAd_785RG TCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACT ...to ... Voir le document complet

10

First-line cART regimen impacts the course of CD8+ T-cell counts in HIV-infected patients that achieve sustained undetectable viral load.

First-line cART regimen impacts the course of CD8+ T-cell counts in HIV-infected patients that achieve sustained undetectable viral load.

... selected HIV-1 infected and treatment-naive patients who initiated a first-line triple cART between Jan 2002 and Dec 2009 and who maintained an undetectable HIV plasma ... Voir le document complet

9

Plasma Level of Soluble ST2 in Chronically Infected HIV-1 Patients with Suppressed Viremia

Plasma Level of Soluble ST2 in Chronically Infected HIV-1 Patients with Suppressed Viremia

... between plasma sST2 levels and the phenotype of the immune activation observed in these ...patients. In the ACTIVIH study, a double hierarchical clustering of the ... Voir le document complet

5

Downregulation of CD94/NKG2A inhibitory receptors on CD8+ T cells in HIV infection is more pronounced in subjects with detected viral load than in their aviraemic counterparts.

Downregulation of CD94/NKG2A inhibitory receptors on CD8+ T cells in HIV infection is more pronounced in subjects with detected viral load than in their aviraemic counterparts.

... heterodimer is a C-type lectin recep- tor, formed by the covalent association of CD94, a pro- tein with a short non-signaling intracytoplasmic tail [1], and one of the NKG2 ...CD94 is ... Voir le document complet

4

Inappropriately low glycated hemoglobin values and hemolysis in HIV-infected patients.: Glycated hemoglobin in HIV - infected patients

Inappropriately low glycated hemoglobin values and hemolysis in HIV-infected patients.: Glycated hemoglobin in HIV - infected patients

... method is certified by the National Glycohemoglobin Standardisation Program (NGSP) and is traceable to the Diabetes Control and Complications Trail ...(DCCT). The CD4 lymphocyte count ... Voir le document complet

7

The Level of DING Proteins Is Increased in HIV-Infected Patients: In Vitro and In Vivo Studies

The Level of DING Proteins Is Increased in HIV-Infected Patients: In Vitro and In Vivo Studies

... associated apolipoprotein with anti-atherogenic activity ...PON1 is an extensively studied protein that exhibits paraoxonase, lactonase and arylesterase activity, and participates in ... Voir le document complet

10

Low CD4/CD8 Ratio Is Associated with Non AIDS-Defining Cancers in Patients on Antiretroviral Therapy: ANRS CO8 (Aproco/Copilote) Prospective Cohort Study

Low CD4/CD8 Ratio Is Associated with Non AIDS-Defining Cancers in Patients on Antiretroviral Therapy: ANRS CO8 (Aproco/Copilote) Prospective Cohort Study

... follow-up, the propor- tion of patients having a CD4/CD8 ratio > 1 reaching 20% at 9 years and 30% at 12 ...1227 patients 43.7%) in the study had at least one NADE after M4, ... Voir le document complet

13

Tobacco addiction and HIV infection: toward the implementation of cessation programs. ANRS CO3 Aquitaine Cohort.

Tobacco addiction and HIV infection: toward the implementation of cessation programs. ANRS CO3 Aquitaine Cohort.

... L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignemen[r] ... Voir le document complet

25

HIV-1 DNA in peripheral blood mononuclear cells is strongly associated with HIV-1 disease progression in recently infected West African adults.

HIV-1 DNA in peripheral blood mononuclear cells is strongly associated with HIV-1 disease progression in recently infected West African adults.

... HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or ...not. The documents may come from ... Voir le document complet

18

Dairy consumption is associated with lower plasma dihydroceramides in women from the D.E.S.I.R. study

Dairy consumption is associated with lower plasma dihydroceramides in women from the D.E.S.I.R. study

... of the data. The size of our study may seem limited, however repeated measurements of ceramides were performed, which is not the case in larger cohort studies with only ... Voir le document complet

24

Low prevalence of lipodystrophy in HIV-infected Senegalese children on long-term antiretroviral treatment: the ANRS 12279 MAGGSEN Pediatric Cohort Study

Low prevalence of lipodystrophy in HIV-infected Senegalese children on long-term antiretroviral treatment: the ANRS 12279 MAGGSEN Pediatric Cohort Study

... and the duration on treat- ment, eight months on ...treated with stavudine for more than one year were at greater risk to present with possible sign(s) of lipoatrophy than those never ...assessment ... Voir le document complet

10

Show all 10000 documents...