Haut PDF Rôle de la thrombospondine 1 dans la progression et la dissémination du cancer du sein

Rôle de la thrombospondine 1 dans la progression et la dissémination du cancer du sein

Rôle de la thrombospondine 1 dans la progression et la dissémination du cancer du sein

63 D ISCUSSION TSP1 expression is repressed by several oncogenes such as Ras, Jun, WT1, and Myc, and activated by the tumor suppressor P53 (Stenina-Adognravi, 2014). It might thus appear conflicting that a high expression of antiangiogenic TSP1 in clinical tumors is associated with a worse prognosis in a number of tumor types including melanoma (Jayachandran et al., 2014), prostate (Firlej et al., 2011), thyroid (Nucera et al., 2010) or pancreatic carcinomas (Okada et al., 2010). In breast cancer, TSP1 protein expression was also found associated with a reduced RFS in lymph node positive tumors (Fontana et al., 2005), with lymph node metastasis (Horiguchi et al., 2013), and as a predictive marker of distant metastasis in TNBC (Campone et al., 2015). In plasma, TSP1 level was identified as a reliable predictive biomarker of aggressiveness (Suh et al., 2012), increased in metastatic tumors (Byrne et al., 2007). We show here that TSP1 protein expression is statistically increased in high grade tumors, associated with a high mitotic index and with necrosis. TSP1 silencing in mouse mammary 4T1 cells had no effect on the tumor volume and growth rate, but significantly inhibited metastasis. This result shows that the TSP1 expression found in high grade tumor is not incidental but in fact required for metastasis. Inhibition of TSP1 in knock-out mice (Yee et al., 2009), or by systemic administration of antibodies (Wang et al., 1996) or siRNAs (Firlej et al., 2011) had also highlighted protumoral and/or pro metastatic effects of TSP1. Our experimental setting demonstrates that this property is linked to the TSP1 synthesized by tumor cells and not by the host cells. In addition, we demonstrate here that to undergo a full metastatic dissemination, tumor cells need to express TSP1 themselves: in experiments where tumor cells expressing high and low levels of TSP1 were mixed, as in the case of heterogeneous tumors, the secretion of TSP1 by the former did not allow TSP1-low cells to metastasize. This result is in line with a study showing that 74% of breast tumors with axillary lymph node invasion expressed TSP1 in the cytosol of tumor cells (Horiguchi et al., 2013), and also with our clinical analysis of metastatic breast tumors where TSP1 was expressed by tumor and not by stromal cells in over 90% of the cases. In paired liver metastases, TSP1 expression was also restricted to metastatic cells.
En savoir plus

124 En savoir plus

en
                                                                    fr

en fr Role of the Thrombospondin 1 in Tumor Migration, Invasion and Metastatic Dissemination in Prostate Cancer and Breast Cancer Rôle de la thrombospondine-1 dans la migration, l’invasion et la dissémination métastatique dans les carcinomes prostatiques et mammaires

The antiangiogenic effects of TSP1 are mediated by its binding to CD36 (10, 27). The TSP1–CD36 interaction also stimulates resorption by osteoclasts (52) and induces TIMP-1 production and secretion in prostate and breast tumor cell lines (53). In addition, our results now establish that TSP1 promotes prostate tumor cell migration. This function also requires CD36 as silencing of this receptor, or inhibition of the TSP1 –CD36 interaction using specific antibodies, impaired migration. The TSP1-mimetic antiangiogenic peptide ABT- 510 also stimulated migration in LNCaP cells although the role of CD36 in that activity was not investigated. These results support the hypothesis that the capacity of TSP1 to stimulate cell migration, invasion, and tumor dissemination is intrinsi- cally linked to its capacity to increase hypoxia. Similarly, hypoxia triggered by pharmacologic antiangiogenic drugs induces invasion (3, 4). These observations strongly suggest that the increased invasion and formation of distant metastasis in hypoxia occurs whatever the trigger of hypoxia. This is of particular importance in the treatment of prostate cancers because castration, the first-line treatment for invasive pros- tate tumors, represses VEGF (54) and induces TSP1 (11, 13, 55), creating a hypoxic stress which contributes to the antitumoral effect. Because hypoxia induces VEGF, the VEGF repression is only transient, and in the prostate of castrated rats, VEGF returns to control levels after 3 days (54). No such feedback mechanism occurs for TSP1, as castration induces TSP1 which increases hypoxia, which in turn induces TSP1 expres- sion in a vicious circle. Castration-resistant cells express TSP1, which stimulates their migration. These cells, which proliferate in low testosterone levels, have enhanced migrat- ing capabilities, and resist to hypoxia, are prone to give rise to aggressive metastases. Disrupting this vicious circle silencing TSP1 in patients undergoing chemical castration should help controlling cell dissemination in response to hypoxia-induced castration. In addition, our experimental data show that TSP1 silencing increases MVD. Therefore, association of TSP1 silencing with chemotherapeutic treat- ments should also be beneficial, improving penetration of therapeutic agents, and inhibiting invasion and metastasis dissemination.
En savoir plus

139 En savoir plus

Rôle de la sphingosine kinase-1 dans la survie et la progression des cellules tumorales prostatiques LNCaP vers l'androgéno-indépendance

Rôle de la sphingosine kinase-1 dans la survie et la progression des cellules tumorales prostatiques LNCaP vers l'androgéno-indépendance

Abstract Prostate cancer is the most frequently diagnosed cancers in men and is the second leading cause of death from cancer. As prostate cancer cell proliferation is regulated and stimulated by androgens, strategies aimed at reducing the production of androgens and/or effects are the standard of care in the management of patients with recurrent or advanced disease. Notwithstanding that androgen deprivation therapy (ADT) is initially effective, ultimately all patients invariably become resistant to hormonal manipulation. It is not clear how prostate cancer cells make the transition from being androgen-dependent to being androgen- independent after hormone ablation therapy. We have shown in the Lab that sphingosine kinase-1 (SphK1) enzymatic activity and expression are markedly increased in tumor samples from prostate cancer patients (as compared with normal counterparts) correlating with other markers such as PSA level, tumor grade as well as with the clinical outcome after prostatectomy. SphK1 is an oncogenic enzyme, which produces sphingosine 1-phosphate, a lipid mediator lipid mediator playing a major regulatory role in tumor cell growth, survival, invasion, and angiogenesis. We have explored the potential role of SphK1 in the regulation of androgen-dependent cell growth and survival in the hormono-sensitive LNCaP prostate cancer cell model. We provide the first evidence that androgen privation induces a differential effect on SphK1 activity in the hormono-sensitive LNCaP cell model.
En savoir plus

177 En savoir plus

en
                                                                    fr

en fr role of the SOCS-1 protein in the colorectal cancer progression Role de la protéine SOCS-1 dans la progression tumorale colique

Conclusion Les modèles de cancérogenèse colorectale proposent plusieurs voies d’accumulation d’erreurs génétiques (LOH+, MSI+, CIMP+) qui entrainent l’apparition de carcinomes à partir de lésions bénignes. Les altérations génétiques les plus fréquentes sont des mutations somatiques et des délétions chromosomiques. La voie Wnt/Wingless, les voies Ras-MAPK et la voie TGF-β /SMAD semblent les plus systématiquement touchées. Mais d’autres détériorations génétiques semblent participer spécifiquement à la progression tumorale colique. L’activité constitutive de la kinase Src tronquée augmente la tumorigénicité in-vitro et in-vivo. De manière intéressante, une étude rapporte que ce type de mutation est observée dans environ 12% des tumeurs colorectales métastatiques (Irby et al., 1999). La perte de l’expression du gène suppresseur de tumeur DCC (Deleted in Colorectal Carcinoma) qui code pour un récepteur membranaire de la netrine est associée à un mauvais pronostic clinique. Pourtant, peu de données sont disponibles au sujet de ses fonctions biologiques (Bernet and Fitamant, 2008). Bien que son rôle dans la régulation de l’apoptose aie été suggéré (Chen et al., 1999). Autrement, l’expression de plusieurs autres gènes est dérégulée dans les tumeurs colorectales alors qu’ils ne sont pas mutés. C’est le cas du gène codant pour la protéine cyclo-oxygénase (COX)-2 et le facteur de croissance IGF-II. Bien que ces événements semblent postérieurs aux altérations génétiques, ils pourraient avoir des rôles critiques.
En savoir plus

189 En savoir plus

Blocage pharmacologique et déplétion de LRH-1 dans des modèles cellulaires murin et humain pour explorer son rôle dans la progression tumorale mammaire

Blocage pharmacologique et déplétion de LRH-1 dans des modèles cellulaires murin et humain pour explorer son rôle dans la progression tumorale mammaire

iv SOMMAIRE Le cancer du sein est l’une des pathologies les plus mortelles chez les femmes. Malgré les nombreuses avancées des dernières décennies, il demeure un pourcentage de femmes qui ne peuvent bénéficier de traitements ciblés et moins agressifs telles les thérapies hormonales. En effet, les tumeurs présentant un profil triple négatif (TN) n’expriment pas les récepteurs à l’œstrogène (ER), à la progestérone (PR) et au facteur de croissance épidermique humain 2 (HER2) qui sont visés par de tels traitements. Une cible thérapeutique pour ce type de tumeur est donc toujours sujette à la recherche. Parmi de nombreuses avenues, il y a le récepteur nucléaire orphelin LRH-1 (Liver receptor homolog-1), lequel joue un rôle dans une variété de fonctions physiologiques et pathophysiologiques. Plus particulièrement, dans la tumorigenèse, LRH-1 est impliqué dans les processus d’initiation tumorale jusqu’à la formation de métastases. D’ailleurs, ses fonctions divergent lorsque LRH-1 est exprimé dans une tumeur TN, leur conférant un caractère plus agressif et le rendant ainsi une cible prometteuse. De plus, étant donné que la tumeur n’est pas uniquement composée de cellules cancéreuses, nous devons considérer le microenvironnement qui les entoure. Le composant le plus abondant de cet environnement est le fibroblaste activé, le CAF (Cancer-associated fibroblast), reconnu pour ses rôles majeurs dans la tumorigenèse. Nous tenterons donc, dans le cadre de ce projet, d’explorer davantage le rôle de LRH-1 et du sécrétome des CAFs dans la prolifération et la migration cellulaire de lignées cellulaires de carcinomes mammaires murins et humains donnés et tenterons d’évaluer s’il peut exister une relation entre les deux.
En savoir plus

130 En savoir plus

Pépite | Étude du rôle des facteurs de transcription ETV4 et ETV1 de la famille ETS dans le processus tumoral de cancers hormono-dépendants : le cancer du sein, la progression métastatique du cancer de la prostate

Pépite | Étude du rôle des facteurs de transcription ETV4 et ETV1 de la famille ETS dans le processus tumoral de cancers hormono-dépendants : le cancer du sein, la progression métastatique du cancer de la prostate

Fig. 5 MMP13 acts as a regulator of ETV4 tumorigenic-induced response in (MMT) mammary epithelial cells. a Relative MMP13 mRNA expression in the MMT-ETV4 and MMT-ETV4-shMMP13 cells determined by real-time PCR and normalized to Cyclophillin A levels. mRNA expression in MMT-ETV4 cells was arbitrarily = 1. Error bars indicate SD. b Zymography analysis of MMP13 protein activity (55 kDa) issue from the supernatant of MMT-ETV4 and MMT-ETV4-shMMP13 cells. c MMT-ETV4 and MMT-ETV4-shMMP13 cell proliferation analysis by cell counting. The 2 charts represent the number of counted cells at 10, 35, 55, 80 and 100 hours. Experiments were conducted 3 times in triplicate. Error bars indicate SD. d MMT-ETV4 and MMT- ETV4-shMMP13 cell migration analysis by Boyden chamber culture system. Histogram represents the relative number of counted cells that have migrated to the lower side. The number of MMT-ETV4 cells was arbitrarily = 1. Experiments were conducted 3 times in triplicate. Error bars indicate SD. Statistical significance **P≤ 0.01. The lower panel depicts two representative pictures of each experiment. e MMT-ETV4 and MMT-ETV4-shMMP13 cell invasion analysis by Boyden chamber culture system coated with Matrigel®. Histograms represent the relative number of counted cells that have invaded to the lower side. The number of MMT-ETV4 cells was arbitrarily = 1. Experiments were conducted 3 times in triplicate. Error bars indicate SD. Statistical significance ****P≤ 0.0001. The lower panel depicts two representative pictures of each experiment. f Anchorage independent growth. MMT- ETV4 versus MMT-ETV4-shMMP13 cells were cultured 10 days in soft agar. This histogram represents the number of clones counted for experimental point. Soft agar assays were conducted 3 times in triplicate. Magnification x5.
En savoir plus

289 En savoir plus

en
                                                                    fr

en fr Caspase-1 involvement in colorectal cancer cell death phenomenons Rôle de la caspase-1 dans les phénomènes de mort cellulaire dans le cancer colorectal

Cancers colorectaux métastatiques En cas de métastases synchrones à priori résécables, la chirurgie s’encadre d’une chimiothérapie dite péri-opératoire dont le but est non seulement de faciliter le geste chirurgical mais aussi de tester la chimiosensibilité de la maladie en écartant ainsi les maladies rapidement évolutives sous chimiothérapie. Plusieurs associations de chimiothérapies ont été testées et ont montré un bénéfice en survie (globale et/ou sans progression) et le FOLFOX est le protocole recommandé. En cas de métastases non résécables, le traitement repose alors exclusivement sur la chimiothérapie dans le but de maintenir la qualité de vie et d’allonger la survie du patient. Il existe plusieurs protocoles de chimiothérapie qui reposent principalement sur le 5-FU, l’oxaliplatine et l’irinotécan auxquels s’ajoutent les thérapeutiques ciblées comme les anti-EGFR et le bévacizumab (Hochster et al., 2008). De multiples combinaisons de ces agents sont possibles et leur choix dépend du caractère agressif de la maladie, de l’existence d’anomalies génétiques, de l’état général du patient et de ses souhaits. Chez un patient en bon état général, non symptomatique, présentant une maladie peu évolutive, une mono-chimiothérapie est initiée et une escalade thérapeutique est ensuite proposée en cas d’évolutivité de la maladie (Ducreux et al., 2011).
En savoir plus

144 En savoir plus

Dissémination du cancer de la prostate : un chemin pavé de gras

Dissémination du cancer de la prostate : un chemin pavé de gras

En dehors de l’obésité, des études récentes montrent que certains patients pourraient présenter une accumulation anormale de ce TAPP indépendamment de l’indice de masse corporelle (IMC), ces TAPP abondants étant associés à des cancers agressifs. Nous avons montré, en mesurant le volume de TAPP sur les IRM de 147 patients atteints de CaP, que l’abondance du TAPP est dissociée de l’IMC et des autres dépôts adipeux. Ainsi, un sous-groupe de patients présente un TAPP particulièrement abondant et l’accumulation de ce dépôt adipeux ectopique est associée à des cancers plus agressifs. Nous avons, pour la première fois, combiné à cette étude clinique une caractérisation biologique de ces TAPP abondants qui révèle qu’ils sont très différents d’un TA obèse. En effet, si on retrouve une hypertrophie adipocytaire dans ces TAPP, il n’existe pas d’infiltration par des cellules immunes (en particulier macrophages). Par une approche protéomique, nous avons montré une diminution d’expression de plusieurs collagènes (collagènes I, IV, VI et XII) dans les TAPP abondants, ces résultats ayant été validés par des approches indépendantes. Ce résultat suggère une matrice extracellulaire plus lâche dans les TAPP abondants, ce qui permettrait une expansion « saine » du TA. A l’inverse, une augmentation de l’expression d’endotrophine (ETP), un peptide bioactif issu du clivage du collagène VIα3, a été retrouvée dans le sécrétome des TAPP abondants. L’ETP a été décrite comme un acteur majeur de la progression tumorale dans le cancer du sein qui, en favorisant la fibrose, l’angiogenèse et l’inflammation, induit des tumeurs plus agressives. Ainsi, nos résultats suggèrent qu’il existe un remodelage extensif de la matrice extracellulaire dans les TAPP abondants, qui pourrait expliquer à la fois l’expansion « saine » du TA et son rôle dans la progression du cancer de la prostate.
En savoir plus

108 En savoir plus

en
                                                                    fr

en fr The influence of hypoxia on podoplanin expression in cancer-associated fibroblasts (CAF) and its role in the progression of breast cancer L'influence de l'hypoxie sur l'expression de podoplanine dans les fibroblastes associés au cancer (CAF) et son rôle dans la progression du cancer du sein

14 3. STRESZCZENIE Guz stanowi rodzaj patologicznej tkanki, zbudowanej z komórek rakowych, zmodyfikowanej macierzy zewnątrzkomórkowej, komórek śródbłonka, naczyń krwionośnych i limfatycznych, komórek odpornościowych, jak również aktywowanych fibroblastów zwanych fibroblastami towarzyszącymi nowotworom (ang. Cancer-associated fibroblasts, CAFs). Mikrośrodowisko guza odgrywa ważną rolę zarówno w rozwoju nowotworu jak i przerzutowaniu. Jednakże wiedza o poszczególnych składnikach mikrośrodowiska jest bardzo ograniczona. Podoplanina (PDPN) jest transbłonową glikoproteiną typu mucyny i ulega ekspresji w komórkach rakowych i CAFs, w zależności od rodzaju nowotworu. Podoplanina indukuje agregację płytekkrwi, co ułatwia tworzenie przerzutów. In vivo, wykazano jej rolę w promowaniu przerzutów komórek rakowych piersi do węzłów chłonnych. W niniejszej pracy przedstawiono, że podoplanina moduluje aktywność osi CCL21/chemokina CCR7/receptor, w sposób zależny od hipoksji. W przyjętym modelu,komórki raka sutka MDA-MB-231 wykazują ekspresję receptora powierzchniowego CCR7 dla CCL21, która jest silnym chemoatraktantem zdolnym do wiązania podoplaniny. Wpływ osi CCL21/CCR7 na adhezję komórek raka sutka MDA-MB-231 zmniejsza się w warunkach hipoksji, tak jak w środowisku guza. Rozwój raka jestzależny od podścieliska guza, w którym CAFs charakteryzują się zmienioną ekspresją genów i właściwościami odrębnymi od normalnych fibroblastów. Wspierają one rozwój nowotworu, rekrutacjękomórek progenitorowych śródbłonkai angiogenezę poprzez wydzielanie czynnika SDF-1 (ang. Stromal derived factor-1). W przypadku raka piersi do 80% fibroblastów wykazuje fenotyp CAF. W niniejszej pracy utworzenie modelu CAF z nadekspresją podoplaniny pozwoliło wykazać udział osi CCL21/CCR7 w rozpoznaniu komórki nowotworowej przez CAF poprzez wiązanie CCL21 dopodoplaniny. Wzrost ekspresji podoplaniny osiągnięto w warunkach hipoksji, a jej nadekspresja prowadziła do redukcji adhezji, co czyni ją cząsteczką antyandhezyjną przy braku CCL21. Wciąż niewiele wiadomo o wpływie podoplaniny na komórki nowotworowe. Z tego punktu widzenia, dobrymi kandydatami do badania regulacji genów mających wpływ na proces nowotworzenia jak i na ekspresję podoplniny są mikroRNA, które regulują ekspresję genów na poziomie post-transkrypcyjnym. MiR-21 jest kluczowym regulatorem procesunowotworzenia i działa poprzez degradację docelowych mRNA białek takich jak PTEN (ang. Tumor
En savoir plus

142 En savoir plus

Rôle de la signalisation Sphingosine kinase-1 Sphingosine 1-Phosphate dans les interactions stroma-cellules épithéliales au sein des métastases osseuses du cancer de la prostate

Rôle de la signalisation Sphingosine kinase-1 Sphingosine 1-Phosphate dans les interactions stroma-cellules épithéliales au sein des métastases osseuses du cancer de la prostate

La Sphingosine kinase-1 est un oncogène La démonstration du caractère oncogénique de la SphK1 a été mise en évidence par les travaux de Xia. L’auteur montre que la surexpression de la SphK1 dans des fibroblastes NIH-3T3 entraîne la transformation de ces cellules et leur capacité à former des tumeurs lorsqu’elles sont greffées sur des souris SCID ( severe combined immunodeficiency ) (Xia, Gamble et al. 2000) (Figure 6). L’ARN messager de la SphK1 est par ailleurs, significativement plus élevé dans de nombreuses tumeurs solides que dans les tissus sains correspondants : sein, côlon, poumons, ovaires, estomac, utérus, rein, rectum, et petit intestin (French, Schrecengost et al. 2003; Johnson, Johnson et al. 2005). Ainsi, les travaux de French révèlent que, dans le cancer du sein, l’expression de l’ARNm de la SphK1 est 4 fois plus importante dans des tumeurs que dans l’épithélium sain ; de la même manière, Kawamori met en évidence une augmentation de l’ARNm et de la protéine SphK1 dans un modèle de carcinogenèse du côlon (Kawamori, Osta et al. 2006) et Le Scolan montre que l’augmentation de la transcription de la SphK1 dans un modèle de leucémie chez la souris est corrélée à la progression de la maladie (Le Scolan, Pchejetski et al. 2005).
En savoir plus

252 En savoir plus

Effet de l'inhibition par ARN interférence de la thrombospondine-1 sur la potentialisation de la réponse immune dans un contexte tumoral

Effet de l'inhibition par ARN interférence de la thrombospondine-1 sur la potentialisation de la réponse immune dans un contexte tumoral

Les anti-PD1 ont donné de très bons résultats dans le mélanome et le cancer de l’ovaire par exemple [149]. Cependant utilisé seul, ce traitement anti-PD1 n’a montré que de très faibles résultats dans le cancer du sein. A titre d’exemple, dans les cancers du sein ER+HER2- et PD- L1+ le taux de réponse durable après traitement au Pembrolizumab n’est que de 8% (KEYNOTE- 028) [150]. Dans les TNBC métastatiques (tous niveaux d’expression de PD-L1 dans les tumeurs), le taux de réponse est de 23% de réponse globale si le Pembrolizumab est donné en première ligne et de 4,7% si il est utilisé après l’échec d’un premier traitement (KEYNOTE-086) [151, 152]. L’utilisation d’un anticorps anti-PD-1 a pour conséquence à la fois le blocage de la signalisation PD-1/PD-L1 mais également de PD-1/PD-L2. Il est tout de même important de prendre en considération que la voie PD-1/PD-L2 a un rôle important dans la tolérance aux antigènes du soi. Ainsi, les anti-PD-1 peuvent induire des phénomènes d’autoimmunité. Une autre approche consiste à administrer des anti-PD-L1. Les anti-PD-L1 visent non seulement à limiter la toxicité du traitement d’immunothérapie (en comparaison aux anti-PD-1) mais également à bloquer simultanément PD-1 et CD80. En effet, CD80 (B7.1) peut être exprimé par les LT CD8+. Il interagit avec une haute affinité avec PD-L1, pouvant conduire à l’inhibition de la prolifération des LT CD8+ [153], voire à leur mort [154]. Toutefois, les anti-PD-L1 montrent également une très faible efficacité dans les cancers du sein puisqu’elle est de 4,8% de réponse globale [155].
En savoir plus

187 En savoir plus

Rôle des calpaïnes extracellulaires dans la progression des adénocarcinomes lépidiques

Rôle des calpaïnes extracellulaires dans la progression des adénocarcinomes lépidiques

Dès 2006, l’Institut national du cancer (INCa) a mis en place un programme national pour soutenir la struc- turation de la génétique moléculaire par la mise en place de soutiens aux technologies innovantes et coû- teuses (STIC) et le développement de 28 plateformes hospitalières de génétique moléculaire. Le STIC ERME- TIC a été le prototype des STIC dans le domaine des tumeurs solides et a permis d’accompagner la diffusion de la recherche des mutations activatrices de l’EGFR. Dans une première étape, une assurance qualité impli- quant 16 des plateformes de l’INCa a été réalisée pour le séquenc¸age des exons 18 à 21 de l’EGFR [5] ; dans une deuxième étape, le séquenc¸age a été appliqué à plus de 500 malades consécutifs recevant de l’erlotinib et a permis de confirmer la place majeur de ce test pour sélectionner les malades répondeurs aux inhibiteurs de tyrosine kinase (ITK) de l’EGFR [6] ; une troisième étape a permis de démontrer le caractère coût-efficace d’une sélection préthérapeutique basée sur le séquenc¸age, plutôt que sur des critères cliniques ou à l’absence de sélection [7]. Depuis 2010, les tests moléculaires sont gratuits pour les patients et les établissements de santé et permettent de déterminer les patients qui relèvent d’une thérapie ciblée. Cette démarche innovatrice a été saluée dans un éditorial de Nature Medicine [8]. La recherche des mutations du gène EGFR permet de traiter les CBNPC métastatiques mutés pour l’EGFR par un ITK d’EGFR dès la première ligne. En 2011, 20 403 patients ont ainsi bénéficié d’une recherche de mutation permettant d’identifier 1 958 patients éligibles aux ITK d’EGFR dès la première ligne. À cet effet, l’INCa a alloué un budget exceptionnel de 1,7 millions d’euros aux plateformes pour la réalisation des recherches des mutations d’EGFR. En plus de l’intérêt médical pour les patients, cette stratégie est efficace d’un point de vue financier. En effet, le traitement par ITK d’EGFR
En savoir plus

226 En savoir plus

Le rôle de la protéine de liaison à l'ARN Staufen 1 dans le développement et la progression tumorale

Le rôle de la protéine de liaison à l'ARN Staufen 1 dans le développement et la progression tumorale

92 sérieusement dans les années 60. Puis, il est rapidement démontré que la différentiation des cellules épithéliales induit une perte de la polarité des cellules de type épithélial, une modification de la morphologie et l’acquisition d’un phénotype migratoire au cours de l’embryogenèse (433). Peu après, une équipe démontre que le processus inverse MET est possible, ce qui traduit la réversibilité du phénomène (434), (435). Par la suite, le mécanisme d’EMT est également décrit dans le processus de cicatrisation des tissus (436), (437) et comme mécanisme majeur de la dissémination métastatique dans les cancers (438), (439). Il est communément admis que les cellules tumorales qui forment la tumeur primaire possèdent initialement un phénotype épithélial. Ce n’est que lorsque la tumeur croît et que les nutriments et l’oxygène commencent à manquer au cœur de la tumeur que quelques cellules effectuent l’EMT et acquièrent des capacités migratoires et invasives pour quitter la tumeur primaire. Cette étape est associée à une dédifférenciation des cellules qui abandonnent leur phénotype éphitélial au profit d’un phénotype mésenchymateux, suite à une perte de polarisation de la cellule et à l’acquisition d’une morphologie sarcomatoïde (440). Ces modifications sont sous l’influence de facteurs de croissance (441) et de facteurs de contrôle du cycle cellulaire (442). Plus récemment, d’autres voies de signalisation impliquées dans l’EMT ont été identifiées comme des hyperméthylations de novo sur l’ADN ou faisant intervenir des miRNA (443), (444). Enfin, l’émergence du concept de cellules tumorales à caractère souche fait aussi l’objet d’une grande attention dans l’étude du phénomène de l’EMT (445). Pour parvenir à se différencier, la cellule tumorale doit effectuer des modifications intrinsèques lui permettant d’acquérir ces nouvelles propriétés (446).
En savoir plus

171 En savoir plus

en
                                                                    fr

en fr LXRs (Liver X Receptors) involvement during prostate cancer metastatic dissemination Rôle des récepteurs aux oxystérols LXRs (Liver X Receptors) dans la dissémination métastatique du cancer de la prostate

Liver X Receptors activation in prostate constrains cancer growth and metastasis progression.... Une partie de ces travaux a fait l’objet d’articles en cours de soumission : Alioui A, [r]

449 En savoir plus

en
                                                                    fr

en fr The involvement of the RNA binding protein Staufen 1 in tumoral development and progression Le rôle de la protéine de liaison à l'ARN Staufen 1 dans le développement et la progression tumorale

88 d’entre elle peut être associée à un gain ou une perte de fonction qui impactera le devenir des ARNm qui sont sous son contrôle. De plus, les RBP interviennent aussi bien dans le maintien homéostatique d’une cellule en condition normale que celui d’une cellule en condition de stress. Enfin, les RBP constitueraient des cibles thérapeutiques de choix dont l’expression et l’activité pourraient potentiellement être modulées par des drogues. Par exemple, des travaux récents ont montré que le pyrvinium pamoate permettait d’inhiber l’accumulation de HuR dans le cytoplasme. De plus, sa combinaison avec d’autres molécules anti-cancéreuses (cisplatine, doxorubicine, etc) potentialisait l’effet cytotoxique de ces dernières et permettait une diminution de la prolifération des cellules cancéreuses de l’urothélium, le sous-type de cancer de la vessie le plus fréquent (412). Egalement, la surexpression de la RBP Musashi-1 favorise la prolifération tumorale et la résisitance de différents types de cellules cancéreuses. Une étude a permis de mettre en évidence l’intérêt de la molécule (-)-gossypol qui inhibe les effets de la surexpression de Musashi-1 (413). Plusieurs autres stratégies thérapeutiques utilisant des oligonucléotides qui présentent des modifications chimiques sont également prometteuses. Par exemple, certaines études proposent de synthétiser des oliginucléotides s’hybridant au niveau de sites d’épissages et permettant de les masquer. En conséquence, les RBP et les snRNA seraient incapables de s’hybrider et de recruter l’ensemble du splicéosome. De ce fait, il serait possible d’inhiber une isoforme pro-oncogènique. Une autre proposition est la synthèse d’oligonucléotides dont l’hybridation permettrait de recruter une RBP de la famille des RNAse H et de cliver de façon spécifique un ARN revue (414)).
En savoir plus

172 En savoir plus

Dissémination locale du cancer de la prostate - Un chemin pavé de gras

Dissémination locale du cancer de la prostate - Un chemin pavé de gras

par les adipocytes. In vitro, l’effet de l’obésité est totalement aboli par des anticorps bloquants dirigés contre ces deux protéines. Ces résultats ont été confirmés in vivo. En effet, l’injection en intra-prostatique de cellules tumo- rales n’exprimant plus CCR3 inhibe très fortement la progression tumorale, sur- tout chez les souris obèses, préservant le TAPP d’une infiltration tumorale. Enfin, chez les patients, l’expression de CCR3 (régulée par l’obésité) est cor- rélée à l’apparition de tumeurs agres- sives présentant une extension locale, et est associée à une résistance au traitement chirurgical et à une rechute biologique plus précoce [9] . Ce travail confirme ainsi que l’infiltration des cellules cancéreuses prostatiques dans le TAPP environnant est sous le contrôle le rôle du TAPP. En effet, il est connu que
En savoir plus

3 En savoir plus

Rôle de TLR7 dans la progression tumorale dans le cancer du poumon

Rôle de TLR7 dans la progression tumorale dans le cancer du poumon

112 Figure 4: Metastatic gene signature associated to high TLR7 expression in a cohort of adenocarcinoma NSCLC patients Kaplan-Meier survival curve for overall survival (OS) for the 144 adenocarcinoma patients divided in two groups according to the stratification of TLR7 expression. Optimal cutoff of 82% was previously determined (1). Patients are now divided into TLR7 hi group (>82% expression of TLR7) and TLR7 low (<5% TLR7 expression). P value was determined by log- rank test (A). Gene expression analysis was performed in 12 adenocarcinoma patients including 6 with no TLR7 expression (TLR7 - ) and 6 with 100% TLR7 expression in tumor cells (TLR7 + ), by Nanostring technology. Volcano plot comparison of differentially expressed genes between TLR7 + and TLR7 - patients (n=6 patients per group). Genes are arranged along dimensions of biological and statistical significance. The horizontal dimension is the variation of gene expression (log2 (ratio)) between the 2 groups, and the vertical axis represents the p value. In red are represented genes that are over-or under-expressed in TLR7 + patients, with a fold-change superior to 2 (11 genes among 770 studied) (B). Hierarchical clustering of the 11 differentially expressed genes in TLR7 + compared to TLR7 - patients. Individual patients are oriented in columns and expression level for each gene is oriented in rows. Red, green and black colours of the heat-map represent the expression levels that are greater than, equal to, or less than the mean expression levels, respectively, in all samples (C). Box plot representation
En savoir plus

218 En savoir plus

Rôle des hospicells dans la progression et la dissémination tumorale ovarienne : implication particulière des macrophages

Rôle des hospicells dans la progression et la dissémination tumorale ovarienne : implication particulière des macrophages

de culture est retiré 12 heures après transfection et les surnageants viraux sont récupérés toutes les 12 heures pendant 60 heures dans le but de transduire les cellules OVCAR-3 ou les Hospicells. Inhibition de l’expression de la Sphingosine kinase 1 (SphK) par l’expression stable d’un shRNA Différentes séquences codant pour des shRNA dirigés contre l’ARNm codant la sphingosine kinase 1 ont été évaluées par transfection pour leur efficacité à inhiber l’expression de la sphingosine kinase dans des cellules la surexprimant comme les MSCs ou les Hospicells. Une séquence a été sélectionnée : 5’CGCGTCCCCGCGTCATGCATCTGTTCTACGTTCAAGAGACGTAGAACAG ATGCATGACGCTTTTTGGAAAT3’. Une séquence « scramble » (dirigée contre aucune séquence connue) a été conçue comme contrôle négatif : 5’CGCGUCCCCUUCUCCGAACGUGUCACGUU UCAAGAGAACGAGACACGUUCGGAGAAUUUUUGGAAAUCGAUAC. Les séquences d’ADN correspondant à ces shRNA ont été clonées dans un vecteur d’expression pLVTHM codant pour la Green Fluorescent Protien (GFP) permettant de sélectionner les cellules transduites. Pour produire les lentivirus, les cellules HEK 293T sont transfectées avec 20 µg de vecteur d’intérêt pLVTHM + shRNA SphK1 ou scramble, 10 µg de pCMV delta R8-74 (gagpol) et 6 µg de pMD2G (env) (Tronolab). Le milieu de culture est changé 12 heures après transfection. Le surnageant de 36 heures post transfection est filtré à 0,45 µm et utilisé pour transduire des Hospicells. Les Hospicells sont analysées 48 heures après pour l’expression de la GFP par cytométrie en flux et l’inhibition effective de la sphingosine kinase 1 par dosage de son activité
En savoir plus

253 En savoir plus

Implication de la thrombospondine-1 dans l'invasion et la dissémination métastatique des cancers du sein

Implication de la thrombospondine-1 dans l'invasion et la dissémination métastatique des cancers du sein

117 tumeurs 4T1mTGFβ par l’hôte. Il est donc impossible d’exclure que ce facteur puisse jouer un rôle sur l’angiogenèse et la normalisation vasculaire dans notre modèle. La TEM est un mécanisme de plus en plus corrélé à l’acquisition d’un phénotype agressif des cancers du sein ( Bonnomet et al., 2012 ) et à la résistance aux drogues ( Huang et al., 2015 ). Cependant, plusieurs études remettent en question ce modèle et la nécessité de la TEM pour la dissémination métastatique ( Diepenbruck and Christofori, 2016, Chui, 2013, Fischer et al., 2015 ). Nos modèles montrent que la TEM n’est pas un prérequis pour la dissémination métastatique dans la mesure où des conditions normoxiques se sont montrées suffisantes pour empêcher la dissémination de cellules agressives. Ce mécanisme n’est donc potentiellement pas aussi crucial pour la dissémination métastatique mais semble clairement corrélé avec la résistance aux drogues. Par ailleurs, des données précliniques montrent que la réponse à l’hypoxie peut activer le processus de TEM et à terme augmenter la résistance et l’agressivité de plusieurs types de cancer ( Gilkes and Semenza, 2013, Doktorova et al., 2015 ). Une hypothèse intéressante serait que, dans les stades de tumorigenèse tardifs ou lors d’une exposition prolongée à l’hypoxie, les cellules tumorales mammaires puissent s’adapter en devenant indépendantes de l’oxygène et/ou en basculant vers un phénotype plus agressif. Une expérience intéressante pour tester cette hypothèse serait de greffer des mélanges de cellules 4T1mCD36/mTGFβ et d’examiner si la normalisation de la vascularisation induite par un environnement peu anti-antiangiogénique (mCD36) permet d’empêcher les cellules mTGFβ d’acquérir un phénotype agressif.
En savoir plus

142 En savoir plus

Évaluation du rôle de la protéine BAG-1 dans le cancer ovarien

Évaluation du rôle de la protéine BAG-1 dans le cancer ovarien

Bref, en ce qui concerne cette lignée cellulaire de cancer ovarien (SKOV3), !'isoforme BAG-lS semble être impliqué dans la régulation de l'apoptose selon un mécanisme différ[r]

118 En savoir plus

Show all 10000 documents...

Sujets connexes