[PDF] Top 20 Obesity promotes the expansion of metastasis-initiating cells in breast cancer
Has 10000 "Obesity promotes the expansion of metastasis-initiating cells in breast cancer" found on our website. Below are the top 20 most common "Obesity promotes the expansion of metastasis-initiating cells in breast cancer".
Obesity promotes the expansion of metastasis-initiating cells in breast cancer
... infiltration in the lungs of obese mice results in higher metastatic burden [ 13 ...While in our setting pri- mary tumor hypoxia could also be responsible for the generation ... Voir le document complet
11
Obesity promotes the expansion of metastasis-initiating cells in breast cancer
... ID Forward 5’-3’ Reverse 5’-3’. Esr1 TCCGGCACATGAGTAACAAA CCAGGAGCAGGTCATAGAGG[r] ... Voir le document complet
5
TGFBI modulates tumour hypoxia and promotes breast cancer metastasis
... high cells and contain a mixture of cell types [6] ...bers of ALDH high cells and express lower levels of Ald- h1a3 ...tumour cells derived from TGFBI-deficient mice have 37 ... Voir le document complet
13
TGFBI modulates tumour hypoxia and promotes breast cancer metastasis
... C(3)TAg cells wt or ko for TGFBI were analysed by FACS using the AldeFluor ...C(3)TAg cells wt or ko for TGFBI were injected into NSG mice via tail ...qPCR in MDA-MB-453 cells infected ... Voir le document complet
9
Breast cancer stem cells with tumor- versus metastasis-initiating capacities are modulated by TGFBR1 inhibition
... ACKNOWLEDGMENTS The authors are grateful to ...providing the Noggin, ...contribution in the lab, and Dr. Hans-Anton Lehr for organizing the collection of hu- man ...to the ... Voir le document complet
9
The matricellular protein CYR61 promotes breast cancer lung metastasis by facilitating tumor cell extravasation and suppressing anoikis
... slower in a scratch wound ...slower in a transwell migration assay. Control cells were treated with a non-specific ...quantification, the numbers of migrated cells in each ... Voir le document complet
8
ICOS is associated with poor prognosis in breast cancer as it promotes the amplification of immunosuppressive CD4+T cells by plasmacytoid dendritic cells
... increases the secretion of IL-2 in TA-CD4 + T cells/pDC co-cultures but only slightly reduces the secretion of IFNγ and the proliferation of Tconvs, and does not ... Voir le document complet
4
The matricellular protein CYR61 promotes breast cancer lung metastasis by facilitating tumor cell extravasation and suppressing anoikis
... SUM159 cells and obtained consistent results (Supplementary Figure S4B and ...used the inducible shRNA knockdown system to further confirm that the effect of CYR61 on facilitating lung ... Voir le document complet
16
Aberrant Glycosylation Promotes Lung Cancer Metastasis through Adhesion to Galectins in the Metastatic Niche
... abundance of clinical and experimental evidence has suggested a role for interleukin 6 (IL-6) in cancer metastasis (19, 21, ...variety of ECM molecules such as laminins and versican ... Voir le document complet
28
ADAM8 expression in invasive breast cancer promotes tumor dissemination and metastasis
... Abstract The transmembrane metalloprotease-disintegrin ADAM 8 mediates cell adhesion and shedding of ligands, receptors and extracellular matrix ...expressed in breast tumors and derived ... Voir le document complet
18
Breast cancer stem cells with tumor- versus metastasis-initiating capacities are modulated by TGFBR1 inhibition
... Inventory of Supplemental Information Supplemental Figure 1. Metastatic stem cells vs tumor-initiating ...Characterization of CSC. Related to Figure 2. Supplemental Figure 3. Inhibition ... Voir le document complet
9
Asthma-related inflammation promotes lung metastasis of breast cancer cells through CCL11–CCR3 pathway
... ). In the lower well of the Boyden chamber assay, Bovine serum albumin (BSA) 1% diluted in DMEM (Life Technologies, Gent, Belgium) supplemented with 1% FBS was used as ...diluted ... Voir le document complet
9
Treating cancer stem cells and cancer metastasis using glucose-coated gold nanoparticles
... effect of different starvation times on pharmacokinetics of nanoparticle uptake In previous tests, the starvation time was set constant at 2 hours to check whether deprivation of ... Voir le document complet
14
Adipocyte/breast cancer cell crosstalk in obesity interferes with the anti-proliferative efficacy of tamoxifen
... risk of recurrence and mortality in obese patients could be related to a lesser efficacy of anti-cancer treatments probably due to plasma adipokine variations linked to over- ...obese ... Voir le document complet
15
The metastasis-associated protein S100A4 promotes the inflammatory response of mononuclear cells via the TLR4 signalling pathway in rheumatoid arthritis
... fulfilled the 1987 ACR criteria for the classi- fication of ...given in supplementary Table S1, available at Rheumatology Online. The study was approved by the Ethical Board ... Voir le document complet
7
The role of histone variant H2A.Z in the regulation of gene expression in breast cancer cells
... MDA-MB231 cells were transfected with a scrambled control siRNA ( ÿ ), with ...cultured in phenol red-free DMEM containing 10% FBS-T for 72 h before ...cross-linking. The culture medium was removed, ... Voir le document complet
125
BORIS promotes chromatin regulatory interactions in treatment-resistant cancer cells
... using the Fastqc tool (v.0.11.5) and samples were aligned to the human genome (build hg19, ...and the parameters ‘– alignIntronMax 1–alignEndsType EndToEnd–outFilterMultimapNmax 1–out- ... Voir le document complet
35
Transactivation of vimentin by beta-catenin in human breast cancer cells
... to the overlap between β-catenin redistribution, enhanced β-catenin/TCF activity, and vimentin expression, the human vimentin promoter was found to be directly activated by β-catenin/ TCF-4 ...induction ... Voir le document complet
13
Dysfunctional endothelial cells directly stimulate cancer inflammation and metastasis
... target cancer cells and inhibited the proliferation and invasion of cancer cells, dysfunctional ECs induced more profound pro-inflammatory signaling during all time points ... Voir le document complet
20
DU145 human prostate cancer cells express functional receptor activator of NFkappaB: new insights in the prostate cancer bone metastasis process.
... through the activation of ERK 1/2 and STAT3 signal transduction ...Discussion The present study was designed to better characterize the involvement of the RANKL-RANK axis ... Voir le document complet
52
Sujets connexes