Mobile app
Ramping Up Customer-Centric Modular Design Projects: Mobile App Development for Pandemic Relief
... To briefly illustrate the proposed framework, it was chosen to focus on an example of urgent needs requiring an agile development process. The current COVID-19 pandemic outbreak is perfectly consistent with these ...
17
Virtual navigation tested on a mobile app is predictive of real-world wayfinding navigation performance
... on mobile devices can predict navigation errors in the real ...our mobile app ‘Sea Hero Quest’ with their performance at similar tasks in a real-world environ- ...
16
2019 — Detection of spam review on mobile app stores, evaluation of helpfulness of user reviews and extraction of quality aspects using machine learning techniques
... mobile OR software OR apps OR app OR application OR market OR ecosystem OR AppStore OR store AND data OR online OR review OR user OR text OR comment OR vocabulary OR rating OR opinion OR[r] ...
225
A Recommender System of Buggy App Checkers for App Store Moderators
... of mobile app checkers for application ...enables app store moderators to make informed decisions on which checkers to enable based on quantitative measurements of their ...of app checkers ...
17
Pl@ntNet app in the era of deep learning
... the mobile app at that time (using on hand-crafted visual features) compared to the results returned today (using the architecture described in section ...
7
Parallel Speech Collection for Under-resourced Language Studies Using the Lig-Aikuma Mobile Device App
... the app in order to facilitate the collection of parallel speech data in line with the requirements of the French-German ANR/DFG BULB (Breaking the Unwritten Language Barrier) ...resulting app, called ...
7
Mobile data and computation offloading in mobile cloud computing
... Since mobile cloud computing can augment the computational ability of mobile devices, mobile devices can execute sophisticated ...of mobile cloud computing, mobile devices only execute ...
197
A Mobile Application Offloading Algorithm for Mobile Cloud Computing
... Abstract—In mobile cloud computing, offloading mobile ap- plications to close remote servers appears as a straightforward solution to overcome mobile terminals processor and battery ...tolerant ...
8
Mobile Device and App Use in Pharmacy: A Multi-University Study
... students and faculty using on their mobile devices when answering drug questions.. What barriers prohibit pharmacy students.[r] ...
23
ADAM30 Downregulates APP-Linked Defects Through Cathepsin D Activation in Alzheimer's Disease
... hADAM30 WT -hAPP Sw,Ind -Cre mice ( Fig. 5 a). As observed in cell lines, a decrease in APP catabolites was also observed in primary cultures of adult neurons expressing ADAM30 WT ( Fig. 5 b). We then extended our ...
16
Les déterminants de l'attitude envers le marketing mobile et de l'intérêt pour une application mobile marchande
... De plus , la plus relation entre l ' attitude envers la publicité / promotion des ventes mobiles et l'intérêt pour une application mobile marchande , fut la plus forte rel[r] ...
207
Presenilin-mediated cleavage of APP regulates synaptotagmin-7 and presynaptic plasticity
... the PS1floxed mice together. APP gene was genotyped using the following primers: 1: AACGCAGGGAGGAGTCAGGG, 2: TGCATGTCAGTCTAATGGAGGC, and 3: ATCTGCC CTTATCCAGTGAAATGAACC. Cloning C1ql2 promoter and generation of ...
15
La téléphonie mobile au Burundi
... Pays de l’Afrique de l’Est, frontalier avec le Rwanda au Nord, la Tanzanie à l’Est, la République Démocratique du Congo à l’Ouest et au Sud, le Burundi est l’un des plus petits (8,5 millions d’habitants) et l’un des plus ...
7
Une comparaison de l’apprentissage par projet (APP) par rapport à l'apprentissage normatif pour les activités de laboratoire en Électronique Industrielle
... This literature review provides a summary of the research that has been published to date regarding teaching laboratory classes using PBL. The Université de Sherbrooke onlin[r] ...
213
Regulation de la nadph oxydase phagocytaire par la pat1 « protein interacting with app tail 1
... 5. Fonctions connues de la PAT1 et son effet sur le « processing » de l’APP PAT1 interagit avec la partie C-terminale de l’Amyloïd precursor protein (APP) et cette interaction a des conséquences sur le transport ...
162
Venise, ville mobile
... C’est la ville où tu habite, où tu vas en vacances à la plage (le Lido) et c’est aussi une ville qui produit beaucoup (à Marghera). ECOLE NATIONALE SUPERIEURE D'ARCHITECTURE DE TO[r] ...
65
Efficacité de la formation par Apprentissages par Problèmes (APP) pour l'acquisition des compétences scientifiques et techniques en Cursus Master Ingénierie
... en APP est fondée sur divers critères de l’efficacité (exemples : gain d’apprentissage, transfert des ...en APP est efficace sur l’acquisition des compétences ...
21
Constrained sets : the effects of multi-layered environments in learning app inventor
... that people make. Sweller (1988) then took the idea of a limited amount of working memory and applied it to an educational context, stating that learners have more trouble acquiring schemas if the learning task demands ...
76
Mobile Note Taking: Investigating the Efficacy of Mobile Text Entry
... Fig. 5. Recognizer version: (a) stated preference according to experimental group; (b) awareness of error. A two factor ANOVA showed that, for mobile use, the combination of experimental group and condition ...
14
Mon mobile, mon marché. Usages du téléphone mobile et performances économiques dans le secteur informel dakarois.
... Note : les données en gras représentent les valeurs significativement supérieures à la proportion de l’échantillon global de la variable considérée. Celles en italique représentent les valeurs significativement ...
31