DNA Damage Response

Condensin II-depleted cells were defective in DBA repair by homologous recombination [80]. PTIP: More BRCT domains than molecular functions Pax2 Transactivation domain interaction protein (PTIP) is a six-BRCT domain containing protein that has roles in transcription and the DNA damage response. The PTIP knockout mouse provided the first hint that PTIP might be involved in the DNA damage response [81]. PTIP-/- embryos died at E9.5, and MEFs derived from PTIP-/- embryos failed to proliferate, recapitulating a phenotype similar to that seen for other DNA damage response proteins involved in DNA synthesis. Interestingly, PTIP-/- embryos exhibited increased TUNEL staining, however rather than the pyknotic morphology typically observed in apoptotic cells, TUNEL positive PTIP-/- cells had a diffuse morphology, possibly indicating the presence of fragmented chromosomes [81]. The C-terminal tandem BRCT domains of PTIP were found to be a phosphopeptide binding module, with a preference for hydrophobic amino acids in the +3 position [15]. PTIP was found to form IRIF, although the BRCT domains required for foci formation remains controversial. Two studies found that the phosphopeptide binding C-terminal BRCT domains are necessary for foci formation [15, 82], however, a recent study found the central BRCT domains are necessary for foci formation, and not the phosphopeptide binding BRCT domains [83]. PTIP was also found to interact with 53BP1 in a phospho-dependent manner [15], and this interaction likely requires the last four BRCT domains of PTIP [84]. The requirement for four BRCT domains for phosphopeptide binding is a novel, however, it may be that the middle two BRCT domains stabilize the interaction with 53BP1, as it is a non-optimal phospholigand for the last two PTIP BRCT domains.

The main actors of the DNA damage response and S- phase checkpoint are also conserved in plants, although many intermediaries of the phosphorylation cascade are ap- parently missing ( 21 ). The Arabidopsis genome encodes one ATM and one ATR kinase; mutants deficient for these pro- teins are viable although double mutants are completely sterile ( 22 ). Like in other eukaryotes, ATM appears to be predominantly involved in double-strand break perception whereas ATR senses replication stress and induces G2 cell cycle arrest after DNA damage ( 22 , 23 ). Both ATM and ATR can activate the SOG1 transcription factor, the func- tional homologue of p53, which in turn stimulates the ex- pression of DNA repair genes ( 24 ). Activation of ATM or ATR by DNA damage also causes programmed induction of endoreduplication (several rounds of DNA replication without mitosis, ( 25 )), cell cycle arrest via activation of the WEE1 protein kinase which inhibit CDK (Cyclin Depen- dent Kinase) /Cyclin complexes ( 26 ) and in some instances programmed cell death ( 27 ). The plant DDR and more specifically the replication stress response is thus beginning to be well described ( 28 ). Nevertheless, the relationships be- tween DNA replication proteins such as Pol ⑀ and DDR re- main to be fully elucidated. In addition, very little is known regarding the contribution of accessory sub-units to this in- terconnection since null mutants are lethal and no partial loss of function mutant has been isolated.

109 The DNA damage response (DDR) takes place in a chromatin context. Increasing amount of studies have suggested that chromatin regulation mechanisms coordinate DDR. This thesis contributes to our understanding on how chromatin modifiers are involved in DDR pathways. In particular, it focuses on the NuA4 histone acetyltransferase (HAT) complex, from recruitment mechanism to its subsequent actions in DDR. The results presented in Chapter 1, 2 and 3 unveil NuA4 involvement in several aspects of DDR. NuA4 is recruited by a DNA damage sensor complex to the break site and subsequently spreads along with resection (Chapter 1). After recruitment, NuA4 has two types of substrates: nucleosomes and other DDR factors. NuA4 acetylates nucleosomes to favor resection (Chapter 2) and also acetylates many non-histone substrates to fine-tune the DDR process (Chapter 1, 2 and 3). Two of the non-histone substrates are investigated in more details in this thesis. The ssDNA binding protein complex RPA is acetylated by NuA4 to regulate RPA dynamics during resection (Chapter 1). NuA4-dependent acetylation of key resection factor Sae2 affects Sae2 protein abundance, potentially through modulating Sae2 degradation (Chapter 3). Besides its functional involvement in early DSB processing, NuA4 is also physically present at the recombination donor structure, potentially assisting the proceeding and completion of HR repair. Efficient HR repair requires the collaboration between NuA4 and another important HAT complex SAGA. Interestingly, this collaboration is also conserved in human cells (Chapter 2), underlining its functional importance.

4 In the human respiratory tract, based on their size, NPs are predicted to mainly deposit in the alveoli (22). Alveolar effects are frequently studied using the A549 cell line, derived from a human adenocarcinoma of the alveolar basal epithelium. However, the use of A549 cells in studies of DNA damage response has been criticised because these cells are hypotriploid and they have an increased oxidative stress response (23) due to a mutation in the gene encoding Kelch-like ECH-associated protein 1 (KEAP1). KEAP1 encodes a cytoplasmic protein that sequesters Nuclear factor (erythroid-derived 2)-like 2 (NRF2) in the cytoplasmic compartment. When not tethered by KEAP1, NRF2 locates to the cell nucleus where it promotes the expression of genes encoding redox regulation proteins. Since the accepted paradigm for particle-induced genotoxicity is oxidative stress, the A549 response to NPs may therefore differ from that of other cell types.

AC CE PT ED DNA damage response: an expensive energetic system DDR is fined-tuned by energetic metabolism to maintain genomic integrity. For this purpose, metabolic and DNA damage checkpoints are the surveillance molecular mechanisms, which induce the coordination of DNA repair with bioenergetics to limit the survival and proliferation of damaged cells and metabolic collapse. The DNA damage checkpoints, characterized in the 90’s, include DNA damage sensors, signalling transducers and effectors [1], in order to stop cell cycle to perform repair. The metabolic checkpoints, initially identified in 1974 have been recently revived. They are multiple and specific of the cell type and the environmental context (like AMPK or p53). They sense nutrient depletion and adapt metabolic reactions to the cellular needs, in relationship with cell cycle. The coupling DDR/metabolism is barely described in toxicology but literature is growing and open new doors for discovery.

To confirm that FMRP KO MEFs are defective in their response to replication stress, we subjected FMRP KO MEFs to additional sources of replication stress agents including hydroxyurea (HU) and UV irradiation. In both cases, FMRP KO MEFs failed to show a time-dependent increase of the γH2A.X level as compared to wild type MEFs (10-fold induction at 60 min post-treatment) (Fig. 1C, compare lanes 1–4 with 5–8 of the upper and lower panels). Importantly, FMRP KO MEFs reconstituted with a FLAG-HA epitope- tagged, wild type FMRP (Flag-HA-FMRP), conferred a more robust γH2A.X response to increasing concentrations of APH compared with the Flag-HA vector alone (Fig. 1D and Fig. S1D) (12-fold induction in Flag-HA-FMRP cells as compared to 4-fold induction in Flag-HA only cells). This was not a MEF-cell-specific effect since reduction of FMRP in HeLa cells by RNAi also resulted in a compromised induction of γH2AX in response to replication stress (Fig. 1E). In addition to H2A.X phosphorylation regulation, loss of FMRP also affected another ATR-dependent, replication response-specific phosphorylation event, phosphorylation of BRCA1 at Ser-1423 (Tibbetts et al., 2000) (Fig. S1E, F). Consistent with the potential role of FMRP in the replication stress response, FMRP RNAi knockdown HeLa cells reconstituted with Flag-HA vector alone, but not tagged wild type FMRP (Flag- HA-FMRP) were more sensitive to replication stress in the clonogenic survival assay (Fig. S2A, B), and FMRP KO MEFs were also more sensitive to replication stress compared to wild type MEFs (Fig. S2C). These findings are in line with previous reports describing a pro-survival role of FMRP (Jeon et al., 2012; Jeon et al., 2011; Liu et al., 2012). Taken together, the above findings link FMRP to replication stress-induced DNA damage response and indicate that FMRP may be part of the ATR-dependent signaling pathway.

4.0 Discussion Nuclear structures termed “DNA damage foci” are hallmarks of DDR activation 8; 22 . For example, 53BP1 is a nuclear protein that relocalizes to DNA damage foci, while H2AX is a histone that becomes phosphorylated at sites of DNA damage (named p- H2AX when phosphorylated). To preserve genome integrity, cells need to protect themselves against DSBs, which are the most lethal type of DNA damage. Once cells detect DNA breaks, the DDR is initiated which is essential to stop the proliferation of cells with genomic instability, and therefore, prevent cancer progression. DDR will lead to temporary cell cycle arrest and DNA repair, apoptosis, or senescence preventing cells with accumulated mutations to replicate and progress into cancer. Importantly, this cellular response determines how normal and cancer cells react to DNA damaging agents used for cancer therapy (radiation therapy and chemotherapy). The DDR, a central tumor suppression mechanism in mammals acts as a barrier against cancer progression. There is available data indicating that the DDR machinery is commonly activated in major types of human melanocytic nevi and precursor dysplastic and adenomatous lesions in the lung, breast, colon, urinary bladder and prostate 4; 23; 24; 25; 26; 27 . It has been suggested that abnormal cell cycle progression via over-expression of cyclin E, Cdc25A, and E2F1 produces “DNA replication stress” that leads to activation of the DNA damage response, including ATM activation and phosphorylation of its downstream targets, p53 Ser15 (p53pSer15), H2AX, and Chk2

damage, cells exhibited induction of RNR1, RNR2 and RNR3 mRNA in α-factor arrested G1 187... cells with northern blot measurements (14, 15), leading to the conclusion that RNR gene 1[r]

The pks pathogenicity island, composed of clbA-S genes, encodes a polyketide- non-ribo- somal -peptide (PK-NRP) biosynthesis machinery [ 14 ]. Colibactin is first synthesised as an inactive prodrug by ClbN followed by the sequential interventions of multiple Clb enzymes. The ClbP peptidase subsequently cleaves the C14-Asparagine (C14-Asn) motif thereby releas- ing the mature, active form of colibactin with its twin warheads ( Fig 1A ) [ 15 – 17 ]. The geno- toxin alkylates adenine residues on both strands of DNA, producing DNA interstrand cross- links [ 18 – 20 ]. These highly toxic DNA lesions initiate a DNA damage response, by phosphory- lating replication protein A (pRPA) and phosphorylating the H2AX histone variant (pH2AX) ( Fig 1B ) [ 14 , 18 ]. Incomplete repair of this DNA damage can result in gene mutations [ 21 ]. E. coli strains carrying pks island have been shown to promote colon carcinogenesis in different mouse models [ 22 – 24 ]. In epidemiological studies, pks+ E. coli strains are more prevalent in the gut microbiota of patients with colorectal cancer and a distinct mutational signature in human cancer genomes, predominantly colorectal tumours, was recently associated with coli- bactin genotoxic activity, further implicating an involvement of colibactin-producing E. coli in tumorigenesis [ 22 , 23 , 25 , 26 ]. This mutational signature has also been identified in tumours of the urinary tract [ 26 ].

2. DNA Damage-Related Cellular Outcomes of CDT Intoxication Since the discovery of CDT, the cellular response to CDT intoxication has been better and better characterized. CDT induces a cell cycle arrest (at the G2/M transition and, depending on the cell type, at the G1/S transition), accompanied by a cellular distention and, eventually, cell death [49–52]. These CDT effects showed similarities with those exerted by some DNA damaging agents, such as ionizing radiation (IR) and etoposide, activating similar pathways [50,52,53]. In light of this observation, the apparent sequence homology between CdtB and the endonuclease/exonuclease/phosphatase family encouraged researchers to compare more precisely, among these proteins, CdtB with a well-known nuclease: deoxyribonuclease I (DNase I) [44,54]. As most of the DNase I residues essential for enzymatic activity are strikingly conserved in the different CdtB homologues, potential sites involved in the CdtB nuclease activity have been determined. The corresponding mutants failed to induce any distension, cell death or cell cycle arrest, showing that the CdtB catalytic activity is responsible for the observed cellular effects and that CdtB has a functional homology with DNase I [44,54]. Finally, the CdtB nuclease activity has been demonstrated in vitro by incubating a super-coiled plasmid DNA with the whole CDT holotoxin or with CdtB alone (see below). We reintroduce here the important concepts to study the DNA damage response pathway activation and relate them with the observations made after CDT treatment.

We chose to create the sensor in the NIH-3T3 cell line as it is a commonly used fibroblast cell line that is simple to culture, the DNA damage response has been extensively studied in these cells, and they express wild-type p53 protein. 48,49 We created a plasmid containing the full-length (667 base-pairs) p21 promoter upstream of TurboRFP (Figure S1 in the Supporting Information). Upon stable transfection we single- cell cloned the mixed population of cells to achieve a clonal population. Clones that stably incorporate foreign DNA can demonstrate a wide variation in recombinant gene expression. The reason for this can be the positional e ffects, in which di fferent regions of the chromosome modulate transgene expression. In order to minimize this heterogeneity and to achieve more consistent performance we used an approach that was previously used for cell-based toxicity assay development, namely, selecting the highest producing clone. 34,47 We examined the clones for RFP induction and for the percentage of positive cells, setting the threshold for determining positive cells from the brightest auto fluorescence signal from untransfected NIH-3T3 cells. The screening of the clones for RFP induction was performed using flow cytometry after exposure of the cells to methylmethanesulfonate (MMS) as a genotoxic agent. MMS is a DNA alkylating agent that causes random single- and double-strand DNA breaks. It is a well- characterized DNA damaging agent that induces the transitory delay of DNA replication. Its ease of use and its rapid uptake by cells made it a reagent of choice for selection and character- ization of the DNA-damage reporter clone. Cells were exposed to MMS (1 mM) for 4 h and analyzed 24 h later using FC.

More recently, it has been shown that molecular motors play an important role in DSBs mobil- ity [93–95]. For example, in fly in human genomes, heterochromatin constitutes about 30% of the genome [97], and “safe” repair of heterochromatic DSBs by homologous recombination relies on the relocalization of repair foci to the nuclear periphery. During this process, nuclear actin filaments form at repair sites to drive heterochromatin DSBs at the periphery and disas- semble after relocalization [93]. Actin filaments act in concert with Smc5/6, Arp2/3, Arp2/3 activators Scar and Wash, nuclear myosins Myo1A, Myo1B, and MyoV. Interestingly, in U2OS cells, ARP2/3-mediated actin polymerization enhances DSBs motion during homologous recombination, increasing the clustering of repair foci [94]. In budding yeast, DNA-damaged induced nuclear microtubule filaments (DIMs) form in response to endogenous or exogenous DNA damage [95]. These DIM filaments, formed at repair sites, reach the nuclear periphery to dive irreparable DSBs and disassemble after relocalization. Such DSBs motion is mediated by the Rad9 DNA damage response mediator and the Kar3 kinesin motor. Another model impli- cating microtubules has been proposed by Lawrimore et al. to explain the global increased mobility observed in yeast in response to DNA damage: in their model, microtubules would be responsible for a global chromatin shake-up that would be essential for global increase mobility on DSBs [98].

Routine spermatozoa evaluation is behind what would be necessary! Although there is a wide consensus on the fact that ART success is largely dependent on gamete quality, the cri- teria that are commonly used to evaluate gamete quality are of poor predictive value. Both gametes should be evaluated, although the two are not equal when it comes to their cell physiology. The female gamete is a metabol- ically active cell that possesses all the housekeeping sys- tems and molecules involved in its protection and repair, if necessary. On the contrary, the male gamete is a highly differentiated cell, transcriptionally silent, conse- quently unable to elicit any kind of stress defense response that would normally induce “protective” gene expression. In addition, mature spermatozoa have lost most, if not all, of the protective activities that are usually associated with the cytosolic compartment of

Previous work has shown that signatures that could inform about gene expression, such as nucleosome positioning along genes and their phasing across cells, could be obtained from the sequencing data underlying ancient mammal genomes ( Hanghøj et al., 2016 ). Whether such signatures could also be collected in plants remains unknown and will require further research. Future work should also focus on improving the methodology proposed here, following what recently done for mammals where statistical models, such as the one implemented in the DamMet package ( Hanghøj et al., 2019 ), have been developed to account for the contribution of other factors than DNA methylation to C → T mis-incorporations. This should reduce the impact of sequencing errors and non-reference variants present in the individual sequenced, and thus improve the accuracy of DNA methylation inference. Extending DamMet to tri- nucleotide contexts will, however, be challenging as the number of underlying genotypes could become rapidly intractable and machine learning approaches may prove more powerful to disentangle nucleotide mis-incorporations pertaining to post-mortem deamination reactions affecting methylated C residues from those resulting from all other processes contributing to sequencing errors. Once the methodology will have been refined, and following the amount of sequence data that were found necessary for retrieving accurate DNA methylation estimates in mammals, we anticipate that ancient genomes characterized at a minimal sequencing depth of 20–25× may be used for in depth studies on ancient plant methylomes. Interestingly, such datasets have already started to be produced in plants (e.g., Mascher et al., 2016 : Sample JK3014, average read depth 20×).

*Correspondence: lavrik@niboch.nsc.ru (O.I.L.), david.pastre@univ-evry.fr (D.P.) https://doi.org/10.1016/j.celrep.2019.04.031 SUMMARY PARP-1 synthesizes long poly(ADP-ribose) chains (PAR) at DNA damage sites to recruit DNA repair fac- tors. Among proteins relocated on damaged DNA, the RNA-binding protein FUS is one of the most abundant, raising the issue about its involvement in DNA repair. Here, we reconstituted the PARP-1/ PAR/DNA system in vitro and analyzed at the sin- gle-molecule level the role of FUS. We demonstrate successively the dissociation of FUS from mRNA, its recruitment at DNA damage sites through its bind- ing to PAR, and the assembly of damaged DNA-rich compartments. PARG, an enzyme family that hydro- lyzes PAR, is sufficient to dissociate damaged DNA- rich compartments in vitro and initiates the nucleocy- toplasmic shuttling of FUS in cells. We anticipate that, consistent with previous models, FUS facilitates DNA repair through the transient compartmentaliza- tion of DNA damage sites. The nucleocytoplasmic shuttling of FUS after the PARG-mediated compart- ment dissociation may participate in the formation of cytoplasmic FUS aggregates.

700 Oligonucleotide DNA sequence (5’->3’) ER8 C/NC GCAAACTTATGTCTCTCATGTGACCGACCACCGCATC ER8 C/C GCAAACTTATGTCTCTCATGTGACCGACaACCGCATC ER8 WC/WC GCAAACgggTGTCatTCATGTGAatGACaACCGCATC ER8 mC/NC GCAAACTTATGTCTCTCATGTGACCGttCACCGCATC ER8 mC/mNC GCAAACTTATaaCTCTCATGTGACCGttCACCGCATC

The analytical predictions for the central deflection of the plate when subjected to low velocity impact loads are within 5% error for the fully-plastic, isotropic facesheet and 1[r]

Additive effects of lesions proximity and SOS induction We also show that the increase in TLS is independent of SOS activation or of any modulation of genetic factors. Such a constraint due to the proximity of DNA lesions may occur naturally and quite frequently during a genotoxic stress, and allows cells to modulate their DNA damage re- sponse by favoring TLS. Strong genotoxic stresses are also known for inducing the SOS response that favors TLS by increasing the expression of specialized polymerases. By in- troducing one or two lesions in a lexA deficient strain where the SOS system is constitutively induced, we show that the two mechanisms are indeed additive (Figure 6 B): the SOS induction leads to a ∼5-fold increase in the use of the TLS pathway, and the proximity of the DNA lesions leads to an additional ∼2-fold increase in the use of TLS. Overall,

My project focuses on simple systems, in which small DNA components nucleosides (dThd), nucleotides (pT, Tp, pTp), oligonucleotides {TT and TTT) and modified oligo[r]

TGAM_1653 and TGAM_1277 Are Slightly Upregu- lated after Heavy Radiation Exposure. Data extracted from proteomic results indicated the presence at low levels of BER enzymes TGAM_1653 and TGAM_1277 in nonirradiated and irradiated cells. No di fference between these two conditions was noted in terms of protein abundance, but the sensitivity of the MS shotgun approach is not su fficient to detect moderate variations. The expression of the corresponding genes was con firmed by RT-PCR. For TGAM_1277, the main difference appeared 2 h after a 5.0 kGy irradiation, with an increase of the relative expression from 0.03 (T0) to 0.09. TGAM_1653 basal mRNA levels were higher than those of TGAM_1277, but the regulation of the transcription of this gene was less sensitive to irradiation. The expression of BER enzymes before exposure to ionizing radiation is not surprising since extremophiles need constitutive protective mechanisms to deal with their harsh growth conditions. The DNA damage analysis reported here shows the presence of an elevated amount of oxidized bases in basal conditions that may require a su fficient amount of DNA repair enzymes. The weak or absent upregulation of several DNA repair genes after exposure to genotoxic stress has already been observed in other archaea. Pyrococcus f uriosus subjected to 2.5 kGy 60 Co γ-rays did not show changes in mRNA levels for BER glycosylases but presented a moderate upregulation of radA (DNA repair by homologous recombination) and of a DNA repair gene cluster possibly involved in translesion synthesis. 42 UV irradiation of hyperthermophilic Sulfolobus archaea did not lead to overexpression of DNA repair genes, including BER genes. 43