DNA Damage Response
14-3-3 Proteins, FHA Domains and BRCT Domains in the DNA Damage Response
... Condensin II-depleted cells were defective in DBA repair by homologous recombination [80]. PTIP: More BRCT domains than molecular functions Pax2 Transactivation domain interaction protein (PTIP) is a six-BRCT domain ...
20
Role of the Polymerase ϵ sub-unit DPB2 in DNA replication, cell cycle regulation and DNA damage response in Arabidopsis
... the DNA damage response and S- phase checkpoint are also conserved in plants, although many intermediaries of the phosphorylation cascade are ap- parently missing ( 21 ...after DNA ...
17
Role of NuA4 histone acetyltransferase complex in DNA damage response pathways
... The DNA damage response (DDR) takes place in a chromatin ...a DNA damage sensor complex to the break site and subsequently spreads along with resection (Chapter ...
182
Comparison of the DNA damage response in BEAS-2B and A549 cells exposed to titanium dioxide nanoparticles
... of DNA damage response has been criticised because these cells are hypotriploid and they have an increased oxidative stress response (23) due to a mutation in the gene encoding Kelch-like ...
35
DNA damage response upon environmental contaminants: an exhausting work for genomic integrity
... ED DNA damage response: an expensive energetic system DDR is fined-tuned by energetic metabolism to maintain genomic ...and DNA damage checkpoints are the surveillance molecular ...
15
A Chromatin-Dependent Role of the Fragile X Mental Retardation Protein FMRP in the DNA Damage Response
... their response to replication stress, we subjected FMRP KO MEFs to additional sources of replication stress agents including hydroxyurea (HU) and UV ...γH2A.X response to increasing concentrations of APH ...
27
Evaluating DNA damage response (DDR) activation in human prostate cancer
... “DNA damage foci” are hallmarks of DDR activation 8; 22 ...to DNA damage foci, while H2AX is a histone that becomes phosphorylated at sites of DNA damage (named p- H2AX when ...
150
Cell-cycle-dependent transcriptional and translational DNA-damage response of 2 ribonucleotide reductase genes in S. cerevisiae
... damage, cells exhibited induction of RNR1, RNR2 and RNR3 mRNA in α-factor arrested G1 187... cells with northern blot measurements (14, 15), leading to the conclusion that RNR gene 1[r] ...
27
Uropathogenic E. coli induces DNA damage in the bladder
... of DNA, producing DNA interstrand cross- links [ 18 – 20 ...toxic DNA lesions initiate a DNA damage response, by phosphory- lating replication protein A (pRPA) and ...
19
The cytolethal distending toxin effects on Mammalian cells: a DNA damage perspective.
... 2. DNA Damage-Related Cellular Outcomes of CDT Intoxication Since the discovery of CDT, the cellular response to CDT intoxication has been better and better ...some DNA damaging agents, such ...
25
Cell-Based Biosensor to Report DNA Damage in Micro- and Nanosystems
... the DNA damage response has been extensively studied in these cells, and they express wild-type p53 ...foreign DNA can demonstrate a wide variation in recombinant gene ...a DNA ...
9
Chromatin Dynamics upon DNA Damage
... yeast, DNA-damaged induced nuclear microtubule filaments (DIMs) form in response to endogenous or exogenous DNA damage ...Rad9 DNA damage response mediator and the Kar3 ...
22
Sperm DNA damage and assisted reproductive technologies: reasons to be cautious!
... Routine spermatozoa evaluation is behind what would be necessary! Although there is a wide consensus on the fact that ART success is largely dependent on gamete quality, the cri- teria that are commonly used to evaluate ...
4
Uncovering signatures of DNA methylation in ancient plant remains from patterns of post-mortem DNA damage
... than DNA methylation to C → T ...of DNA methylation ...accurate DNA methylation estimates in mammals, we anticipate that ancient genomes characterized at a minimal sequencing depth of 20–25× may be ...
10
PARP-1 Activation Directs FUS to DNA Damage Sites to Form PARG-Reversible Compartments Enriched in Damaged DNA
... at DNA damage sites to recruit DNA repair fac- ...damaged DNA, the RNA-binding protein FUS is one of the most abundant, raising the issue about its involvement in DNA ...at DNA ...
20
Capturing Auxin Response Factors Syntax Using DNA Binding Models
... Oligonucleotide DNA sequence (5’->3’) ER8 C/NC GCAAACTTATGTCTCTCATGTGACCGACCACCGCATC ER8 C/C GCAAACTTATGTCTCTCATGTGACCGACaACCGCATC ER8 WC/WC GCAAACgggTGTCatTCATGTGAatGACaACCGCATC ER8 mC/NC ...
36
Damage response of sandwich plates subject to dynamic loads
... The analytical predictions for the central deflection of the plate when subjected to low velocity impact loads are within 5% error for the fully-plastic, isotropic facesheet and 1[r] ...
94
DNA lesions proximity modulates damage tolerance pathways in Escherichia coli
... of DNA lesions may occur naturally and quite frequently during a genotoxic stress, and allows cells to modulate their DNA damage re- sponse by favoring ...SOS response that favors TLS by ...
10
Low-energy electron-induced DNA damage : product analysis and mechanistic studies of damage in short oligonucleotides
... My project focuses on simple systems, in which small DNA components nucleosides (dThd), nucleotides (pT, Tp, pTp), oligonucleotides {TT and TTT) and modified oligo[r] ...
127
Oxidative DNA damage and repair in the radioresistant archaeon Thermococcus gammatolerans
... The DNA damage analysis reported here shows the presence of an elevated amount of oxidized bases in basal conditions that may require a su fficient amount of DNA repair ...several DNA repair ...
15