• Aucun résultat trouvé

Effects of mesenchymal stem cell therapy, in association with pharmacologically active microcarriers releasing VEGF, in an ischaemic stroke model in the rat

N/A
N/A
Protected

Academic year: 2022

Partager "Effects of mesenchymal stem cell therapy, in association with pharmacologically active microcarriers releasing VEGF, in an ischaemic stroke model in the rat"

Copied!
12
0
0

Texte intégral

(1)

Effects of mesenchymal stem cell therapy, in association with pharmacologically active microcarriers releasing VEGF,

in an ischaemic stroke model in the rat

Marie-Sophie Quittet

a,b,c,d,

, Omar Touzani

a,b,c,d

, Laurence Sindji

e,f

, Jérôme Cayon

f,g

,

Fabien Fillesoye

a,b,c,d

, Jérôme Toutain

a,b,c,d

, Didier Divoux

a,b,c,d

, Léna Marteau

a,b,c,d

, Myriam Lecocq

a,b,c,d

, Simon Roussel

a,b,c,d

, Claudia N. Montero-Menei

e,f

, Myriam Bernaudin

a,b,c,d

aCNRS, UMR 6301 ISTCT, CERVOxy group, GIP CYCERON, Bd Henri Becquerel, BP5229, F-14074 Caen cedex, France

bUniversité de Caen Basse-Normandie, UMR 6301 ISTCT, CERVOxy group, GIP CYCERON, Bd Henri Becquerel, BP5229, F-14074 Caen cedex, France

cCEA, DSV/I2BM, UMR 6301 ISTCT, CERVOxy group, GIP CYCERON, Bd Henri Becquerel, BP5229, F-14074 Caen cedex, France

dNormandie Univ, F-14032 Caen cedex, France

eINSERM U1066, MINT ‘‘Bio-inspired Micro and Nanomedicine’’, F-49933 Angers, France

fLUNAM Université, F-49933 Angers, France

gPlateforme PACeM (Plateforme d’Analyse Cellulaire et Moléculaire), SFR ICAT4208, F-49933 Angers, France

a r t i c l e i n f o

Article history:

Received 1 August 2014

Received in revised form 28 November 2014 Accepted 19 December 2014

Available online 31 December 2014

Keywords:

Stroke

Mesenchymal stem cells

Pharmacologically active microcarriers Angiogenesis

VEGF

a b s t r a c t

Few effective therapeutic interventions are available to limit brain damage and functional deficits after ischaemic stroke. Within this context, mesenchymal stem cell (MSC) therapy carries minimal risks while remaining efficacious through the secretion of trophic, protective, neurogenic and angiogenic factors. The limited survival rate of MSCs restricts their beneficial effects. The usefulness of a three-dimensional sup- port, such as a pharmacologically active microcarrier (PAM), on the survival of MSCs during hypoxia has been shown in vitro, especially when the PAMs were loaded with vascular endothelial growth factor (VEGF). In the present study, the effect of MSCs attached to laminin-PAMs (LM-PAMs), releasing VEGF or not, was evaluated in vivo in a model of transient stroke. The parameters assessed were infarct volume, functional recovery and endogenous cellular reactions. LM-PAMs induced the expression of neuronal markers by MSCs both in vitro and in vivo. Moreover, the prolonged release of VEGF increased angiogen- esis around the site of implantation of the LM-PAMs and facilitated the migration of immature neurons towards the ischaemic tissue. Nonetheless, MSCs/LM-PAMs–VEGF failed to improve sensorimotor func- tions. The use of LM-PAMs to convey MSCs and to deliver growth factors could be an effective strategy to repair the brain damage caused by a stroke.

Ó2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction

Stroke is a major cause of death and disabilities. The failure of many clinical trials designed to demonstrate neuroprotection, in which the acute phase of the pathology was targeted, has encour- aged the examination of therapeutic strategies which could be applied beyond the acute phase and in which it ought to be possi- ble to enhance post-injury brain repair[1]. Among these strategies, stem cell therapy has been the subject of several investigations[2].

Mesenchymal stem cells (MSCs) are readily extracted from bone marrow and thus are widely available to be employed as therapeu- tic agents in order to replace and/or repair injured brain tissue.

Studies have shown that MSCs attenuate neuronal loss and accel- erate functional recovery following stroke in animal models [3]

and patients [4]. These investigations underscore the safety of MSCs and their capacity to induce brain plasticity when adminis- tered in either the sub-acute or chronic stage of stroke. The thera- peutic capacities of MSCs are attributed principally to their paracrine actions as a source of angiogenic, antiapoptotic, neuro- genic and/or mitogenic factors and their ability to migrate into the damaged tissue[5]. Nevertheless, these advantageous actions of MSCs are likely to be restricted because of the hostile environ- ment that reigns within the ischaemic tissue, a milieu which ham- pers the viability, differentiation and integration of the grafted

http://dx.doi.org/10.1016/j.actbio.2014.12.017

1742-7061/Ó2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Corresponding author at: UMR 6301 ISTCT, CERVOxy group, GIP CYCERON, Bd Henri Becquerel, BP5229, F-14074 Caen cedex, France. Tel.: +33 2 31 47 01 51; fax:

+33 2 31 47 02 22.

E-mail address:[email protected](M.-S. Quittet).

Contents lists available atScienceDirect

Acta Biomaterialia

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / a c t a b i o m a t

(2)

cells into the host tissue[6]. For example, hypoxia, inflammation, paucity of beneficial cytokines and accumulation of deleterious molecules within the destructured ischaemic tissue are among the factors that might limit MSC viability and differentiation[7].

Among the strategies to increase the survival and/or differentiation rate of grafted cells is the use of a supportive scaffold.

Recently, pharmacologically active microcarriers (PAMs), which are biodegradable microspheres that are able to convey cells on their functionalized surfaces and offer a three-dimensional micro- environment, were employed in a number of neurological condi- tions, such as Parkinson’s disease and stroke[8,9]. To mimic the extracellular matrix and promote the engraftment of stem cells on the scaffold, many peptides derived from the extracellular matrix have been tested as a coating, such as laminin, which enhances neurite outgrowth and promotes the differentiation of MSCs into cells of a neuronal phenotype, both morphologically and functionally[10]. In addition, these carriers can be concomi- tantly loaded with growth factors that are released progressively in a sustained and controlled manner around the grafted stem cells. The efficacy of this concept was first demonstrated in a rat paradigm of Parkinson’s disease, with PC12 cells and PAMs releas- ing nerve growth factor (NGF) or glial cell-derived neurotrophic factor[11,12].

In order to enhance angiogenesis, vascular endothelial growth factor (VEGF) has been loaded into PAMs and engrafted in associa- tion with neural stem cells (NSC) in an ischaemic tissue[8]. NSCs combined with PAMs releasing VEGF promoted the recruitment of endothelial cells into the lesioned striatum. Nonetheless, the authors failed to examine the fate of the grafted stem cells, and their impact on endogenous cellular reactions as well as, impor- tantly, on the functional recovery of the treated rats. We recently reported that treatment with PAMs releasing VEGF enhances MSC proliferation and survival in vitro in an oxygen–glucose depri- vation model[13]. Altogether, these data suggest that the use of PAMs to release growth factors such as VEGF in a sustained manner could be considered as a novel approach to improving the survival of MSCs in ischaemic tissue. Therefore, the aims of the present study were, first, to examine whether the delivery of MSCs attached to laminin-coated PAMs (LM-PAMs) improves the sur- vival and differentiation of the transplanted cells and, conse- quently, their effects on brain damage and functional recovery in rats subjected to stroke, and secondly, to evaluate the effects of MSCs conveyed by LM-PAMs releasing VEGF in vitro on the fate of MSCs and in vivo on the endogenous cellular reactions (neuro- genesis, angiogenesis, glial reaction) that occur concomitantly with functional recovery at both the acute and chronic stages of stroke in the rat.

2. Material and methods

2.1. Animals

All experiments were carried out on male Sprague–Dawley rats (CERJ, France) weighing 300–350 g. The animal investigations were performed in accordance with European Directive 86/609/EU. The project was also approved by the regional committee on animal ethics (CENOMEXA 1211-04). Rats were maintained in conven- tional housing, with access to food and water ad libitum, and kept in a 12/12 h day/night cycle at 22°C. To evaluate the impact of unfilled LM-PAM on the fate of MSCs in vivo (study 1), 73 animals were used, of which 49 were included for analysis (13.7% died immediately following the reperfusion because of cerebral haem- orrhage, 6.8% died during the second anaesthesia at 24 h post- occlusion and 13.7% were excluded due to the inefficiency of the occlusion). To analyse the effect of the MSCs/LM-PAMs releasing

VEGF on functional recovery (study 2), 60 animals were used, of which 35 were included for analysis (13.3% died during the occlu- sion or at the reperfusion, 11.7% died during the first 24 h because of haemorrhagic transformation or malignant infarction and 18.3%

were excluded due to the inefficiency of the occlusion). The mor- tality rate was not different among groups after the administration of the treatment (in study 1 the mortality rate was nil and in study 2 the log rank was 0.1). The experimental procedures are summa- rized inFig. 1. In all studies, the experiments were performed ran- domly and the data were analysed in a blind manner.

2.2. Middle cerebral artery occlusion (MCAo)

Rats were anaesthetized with isoflurane (2–2.5%) in a mixture of O2/N2O (30%/70%). A transient focal cerebral ischaemia was induced by intraluminal occlusion of the middle cerebral artery as described by Chuquet and colleagues[14]. Briefly, a nylon fila- ment (0.18 mm diameter) with a distal cylinder (0.38 mm diame- ter) was introduced into the lumen of the right external carotid artery and then gently advanced into the internal carotid artery up to the origin of the MCA. The success of the MCAo (reduction of signal > 60%) was verified by a laser Doppler probe positioned on the skull above the centre of the MCA area. One hour following the occlusion, the rat was reanaesthetized and the reperfusion was performed by removing the nylon thread. Throughout the proce- dure, the body temperature was maintained at 37.5°C, using a feedback-controlled heating pad connected to a rectal probe. An analgesic treatment (buprenorphine 5 mg kg1i.m.) associated with a rehydration (8 ml injection of saline i.p.) was delivered every day for 3 days after the induction of ischaemia.

2.3. PAM formulation

Poly(lactic-co-glycolic acid) (PLGA) microspheres of an average diameter of 60

l

m were prepared by an emulsion solvent extrac- tion–evaporation process, as previously described[13]. Formula- tion details are described in Supplementary 1. Four batches of PAMs were employed for MSCs/LM-PAMs studies and two batches for the MSCs/LM-PAMs–VEGF in vivo evaluation. The impact of MSCs gene expression on PAMs was assessed using two batches of PAMs.

2.4. LM-PAM characterization and VEGF release profile

The yield of encapsulated VEGF within the LM-PAMs was deter- mined by the measurement of the entrapped proteins based on the ELISA kit for VEGF (R&D Systems, France). LM-PAMs–VEGF (5 mg) was dissolved in 1 ml of acetone for 1 h, the entrapped protein was separated by centrifugation (300 g.min1) and the acetone was removed. This step was repeated and the pellet resuspended in phosphate-buffered saline (PBS). Controls performed with unloaded LM-PAMs were negative in the ELISA assay. Only LM- PAMs containing VEGF with a loading efficiency of at least 80%

were considered acceptable.

The in vitro release profile of VEGF from LM-PAMs was deter- mined from experiments (n= 3) by adding 250

l

l of PBS buffer, pH 7.4, containing 1% w/v bovine serum albumin (BSA), to 2.5 mg of microspheres into tubes. The tubes were incubated in a shaking water bath (37°C, 125 rpm). At specified time intervals, the tubes were centrifuged for 5 min at 3000 rpm and 250

l

l of the superna- tant was collected for analysis and replaced by fresh buffer. The ratio of cumulative release (as a percentage) was calculated based on the total amount of protein obtained from the encapsulation yield. The released VEGF from LM-PAMs at different time points was checked for bioactivity in a proliferation assay (alamarBlueÒ

(3)

assay, BIOSOURCE) with human umbilical vein endothelial cells (HUVECs), as previously described[13](Supplementary 2).

2.5. Cell culture and adhesion to LM-PAMs

To prepare MSCs, three Sprague–Dawley rats were euthanized and the femoral and tibial bone marrow was extracted. The bone marrow was placed in a modification of Eagle’s minimal essential medium (

a

-MEM; Eurobio-AbCys, Courtaboeuf), supplemented with 2 mM of glutamine (Sigma), 1% of streptomycin and penicillin (Sigma) and 20% of foetal calf serum (FCS; Eurobio-AbCys, Courtab- oeuf), for 24–48 h prior to being placed in the same medium con- taining 10% FCS, as previously described[15]. The cells were then incubated at 37°C in air enriched by CO2(5%).

After 3–4 passages, MSCs were placed in contact with previ- ously hydrated LM-PAMs for 4 h. MSCs were collected and 3105cells were mixed with 0.75 mg of LM-PAMs in

a

-MEM sup- plemented with 3% FCS. For in vitro studies, at the end of this con- tact period, the medium was withdrawn and replaced with

a

-MEM supplemented with 2 mM of glutamine. Thereafter, the cell/LM- PAM complexes were incubated in 5% CO2at 37°C.

In study 1, implanted stem cells were prelabelled by bromode- oxyuridine (BrdU) to allow their follow-up. The BrdU (10

l

M, Sigma) was introduced into the medium daily 3 days before the administration of MSCs, as previously described[16].

2.6. Administration of MSCs/LM-PAMs

To avoid the side effect of an early administration of VEGF, the administration of MSCs/LM-PAMs with or without VEGF was per- formed at 24 h after MCAo. The anaesthetized rats were placed in a stereotaxic head-holder and a sagittal scalp incision was per- formed. A 1 mm burr hole was drilled 3 mm lateral to the bregma.

The MSCs/LM-PAMs (3105cells and 0.75 PAMs in 8

l

l of the vehicle solution of sodium carboxymethyl cellulose–Tween 80–Mannitol (0.125, 0.125 and 0.5%, respectively), diluted 1/8 in

PBS) were infused into the striatum (6 mm depth) over 8 min via a dental needle (30G) connected to a Hamilton syringe. The stria- tum is always affected by the ischaemic lesion in this model [24]. Four groups were used in each study: vehicle, MSCs, MSCs/

LM-PAMs and LM-PAMs (study 1), and vehicle, MSCs, MSCs/LM- PAMs and MSCs/LM-PAMs–VEGF (study 2). Animals were ran- domly assigned to each group following the behavioural test per- formed before MCAo.

2.7. Magnetic resonance imaging (MRI) quantification of brain damage At days 2 and 22 following MCAo, each animal was anaesthe- tized and completed an MRI examination (7T, PharmaScanÒ, Bru- ker BioSpin, Ettlingen, Germany). T2 imaging was performed with a RARE sequence (RARE factor of 8; TR/TE = 5000/16.25 ms;

NEX = 2; 20 contiguous slices; acquisition time = 4 min; resolu- tion = 0.150.150.75 mm3). Images were analysed by in-house macros based on ImageJ software (http://imagej.nih.gov/ij/).

Abnormal areas were delineated by a semi-automatic technique according to Letourneur and colleagues[17]. At day 2, the volume of infarction was corrected for oedema as previously described [18], and at day 22, brain damage was expressed as tissue atrophy according to Leconte et al.[18].

2.8. Behavioural tests

To evaluate the functional recovery, the rats underwent a bat- tery of behavioural tests in both the acute and chronic stages of infarction according to the protocol shown inFig. 1.

2.8.1. Neurological score

The neurological score was performed as previously described [15]. For each item, a score of 0 (major deficit), 1 (minor deficit) or 2 (no deficit) was given. Spontaneous walking, circling towards the paretic side and resistance against a lateral push were evalu- ated, as well as the flexion of each limb and body rotation when

A

B

NSLP MCAo

Striatal injecon Euthanasia

IHC

d7 d14

MRI d0 d1 d2

MRI

d22 d28

Vehicle

MSCs

MSCs/LM-PAMs

LM-PAMs

Adhesive Adhesive Adhesive

Corner

NS LP

NS LP

NS LP

Corner

BWT BWT

MCAo

Striatal injecon

Adhesive Adhesive Adhesive

Euthanasia IHC

d7 d14

MRI d0

Corner BWT

NSLP

NS LP

NS LP

NS LP

Corner

d1 d2 MRI

d22 d28

BWT

Vehicle

MSCs

MSCs/LM-PAMs

MSCs/LM-PAMs-VEGF

d-7 d-7

Fig. 1.Experimental protocols. (A) Experimental protocol of the study designed to examine the effects of the association of MSCs and LM-PAMs on functional recovery and the fate of the MSCs (study 1). (B) Experimental protocol of the study designed to examine the effects of the association of MSCs and LM-PAMs filled with VEGF on functional recovery and endogenous cellular reactions. BWT: beam walking test; NS: neurological score; LP: limb-placing test; MRI: magnetic resonance imagery; MCAo: middle cerebral artery occlusion; IHC: Immunohistochemistry.

(4)

the experimenter suspended the rat by the tail sequentially by each hand. A maximal score of 28 indicated normal sensorimotor response[19].

2.8.2. Limb-placing test

The limb-placing test was performed according to De Ryck and co-workers[20]. Vision, touch, proprioception and stimulation of the vibrissae were examined for each side, as described in Supplementary 3. A score of 0 (major deficit), 1 (minor deficit) or 2 (no deficit) was applied for each item. The maximal score obtained by a normal rat was 24[19].

2.8.3. Corner test

The corner test was performed as described by Schallert and collaborators[21]to evaluate the sensorimotor and postural asym- metries. The rat was placed in a corner composed of two vertical boards (3048 cm) fixed on a horizontal surface with an open angle of 30°. The criteria of rearing and returning in ipsilateral or contralateral directions were noted. The test was repeated 10 times, with an inter-trial interval of 2 min.

2.8.4. Beam walking test

The test was performed according to Schallert and collaborators [22], and is described inSupplementary 4.

2.8.5. Adhesive removal test

The adhesive removal test was described by Schallert and col- leagues [21]. This test assesses the somatosensory neglect and motor coordination of the rat by placing a 11 cm square of adhe- sive tape with equal pressure on the hairless plantar surface of each forepaw. The animal was placed in a transparent Plexiglas box (202532 cm) and the time of contact and the time of removal of the tape for each side were noted within a maximal per- iod of 120 s[19].

2.9. Immunohistochemistry

Anesthetized rats were perfused transcardially with saline fol- lowed by 4% paraformaldehyde (Sigma) solution at day 28 after MCAo. The rats’ brains were removed and cut into 50

l

m thick sec- tions. For BrdU immunostaining, sections (2 or 3 per rat) from 4–6 rats in each group were incubated with the anti-BrdU antibody (monoclonal rat anti-BrdU, Abcam 1/200), combined with the neu- ronal marker NeuN (monoclonal mouse anti-NeuN, Chemicon 1/

2000), the astrocytic marker glial fibrillary acidic protein (polyclonal rabbit anti-GFAP, DAKO 1/5000) or the apoptotic marker caspase 3a (polyclonal rabbit anti-caspase 3, Cell Signaling 1/250). Pictures

were performed on slices containing the PAM, i.e. between0.26 and0.80 mm of the bregma in reference to the Paxinos rat atlas.

To evaluate the effect of MSCs combined with LM-PAMs–VEGF on neurogenesis and angiogenesis, sections were incubated with the marker of immature neurons doublecortin (DCX; polyclonal rabbit anti-DCX, Abcam 1/1000), the endothelial marker rat endo- thelial cell antigen (RECA-1; monoclonal mouse anti-RECA-1, AbD Serotec 1/100) and the proliferation marker Ki67 (rabbit polyclonal anti-Ki67 antibody, Abcam 1/200). The sections were incubated overnight with the primary antibody in PBS with BSA (1%) and Tri- ton X-100 (0.1%) at 4°C. Next, sections were incubated for 2 h with the appropriate secondary antibodies (Alexa FluorÒ555, 488, 1/

200) and the nuclear marker Hoechst 33342 (Sigma Aldrich 1/

500) at room temperature. The DCX-labelled slices, and especially all sections containing PAMs, were analysed by three different observers. The labelling was scored as follows: 0: no labelling; 1:

light labelling; 2: moderate labelling; 3: dense labelling. With respect to the Ki67/RECA-1 double labelling, pictures were acquired using a confocal microscope (Olympus FV1000) after exploration in thez-plane of the coextinction of the RECA-1 and Ki67 labelling. Positive cells were expressed as a percentage of Ki67-positive cells for all sections containing PAMs.

2.10. Reverse transcription and real-time quantitative polymerase chain reaction (RT-qPCR)

The expressions of DCX, TUBB3, GFAP, VEGF-A, TGFb1, NGF and BDNF were assessed by RT-qPCR, as described inSupplementary 3 andTable 1.

2.11. Statistical analyses

The JMPÒsoftware (SAS Institute, Cary, NC, USA) and StatView SE (SAS Institute Inc, Cary, NC, USA) were used for all statistical analyses. The data were expressed as mean ± SD, or as median ± interquartile range when appropriate. The infarct volume and the impact of PAM on MSC outcome were analysed by a one- way analysis of variance (ANOVA), followed by a post hoc Fisher’s protected least significant difference (PLSD) test. Behavioural per- formances were analysed by ANOVA, or a repeated ANOVA when necessary (neurological score, limb-placing test). The quantifica- tion of the immunohistological staining was analysed by the Krus- kal–Wallis test, followed by a post hoc Mann–Whitney test when more than two groups were compared, or by the Mann–Whitney test when two groups were compared. Differences were considered as significant atp< 0.05.

Table 1

Primer sequences used for RT-PCR.

Gene Full name NM accession Sequences

ACTB b-Actin NM_031144 F = 50TGCAGAAGGAGATTACTGCC 30

R = 50GTAACAGTCCGCCTAGAAGC 30

DCX Doublecortin NM_053379 F = 50TGAAAGGGAATCCATCTGCC 30

R = 50TCGACTTAGGTGTTGAGAGC 30

TUBB3 Tubulin,b3 class III NM_139254 F = 50GAGTGAAGTCAGCATGAGGG 30

R = 50AGTAGACACTGATGCGTTCC 30

GFAP Glial fibrillary acidic protein NM_017009 F = 50CTTACTACCAACAGTGCCCG 30

R = 50TTCCTCTCCAGATCCACACG 30

VEGF-A Vascular endothelial growth factor A NM_031836 F = 50CAACTTCTGGGCTCTTCTCT 30

R = 50CTCACCCGTCCATGAGC 30

TGFb1 Transforming growth factor,b1 NM_021578 F = 50CAACTGTGGAGCAACACG 30

R = 50CCTGTATTCCGTCTCCTTGG 30

NGF Nerve growth factor NM_001277055 F = 50ACCTCTTCGGACACTCTGG 30

R = 50GTGGCTGTGGTCTTATCTCC 30

BDNF Brain-derived neurotrophic factor NM_001270634 F = 50GTGACAGTATTAGCGAGTGG 30

R = 50CATACGATTGGGTAGTTCGG 30

(5)

3. Results

3.1. LM-PAMs–VEGF characterization and VEGF release profile The volume of the microspheres was a bell-shaped and uniform distribution curve (mean diameter = 62 ± 5

l

m) for each of the for- mulations performed, and a homogeneous distribution of laminin on the surface of the PAMs was observed (Fig. 2A). The encapsula- tion yield of VEGF was 85 ± 23%. The cumulative release profile showed a burst of 12% at 1 week and 21% of the encapsulated VEGF was released after 3 weeks (Fig. 2B). The in vitro proliferative assay shown that VEGF collected from each sample of the kinetic release assay (diluted to 4 ng ml1) was able to stimulate the proliferation

of HUVEC for a period of 5 days in a manner similar to that of recombinant VEGF at 4 ng ml1(data not shown). The cumulative release curve of bioactive VEGF as a function of time is superim- posable with that of the curve of VEGF, measured by ELISA (Fig. 2B). All the proteins released were therefore bioactive.

3.2. LM-PAMs effects on MSCs outcome after MCAo 3.2.1. MRI quantification of brain damage

In accordance with our working hypothesis, none of the treat- ments (MSCs, MSCs/LM-PAMs, LM-PAMs) administered 24 h after the MCAo modified the size of the lesion in comparison to the vehi- cle (ANOVAp> 0.05 at days 2 and 22;Fig. 3A).

Fig. 2.Laminin-coated PAMs and the release profile of LM-PAMs–VEGF. (A) The effective coating of PAMs with LM was attested by the positive staining with the anti-laminin antibody (scale bar = 100lm). (B) After 21 days, about 21% of the encapsulated VEGF was released, as observed by ELISA. The released VEGF was in a bioactive conformation, as observed with an in vitro bioassay. The results presented were obtained fromn= 3 experiments and expressed as the mean percentage of VEGF cumulatively released ±SD.

BrdU+/NeuN+cells

*

BrdU+/GFAP+cells

A C

D

1.10

1.00

0.90 0.05

0.00

MSCs MSCs/LM-PAMs BrdU/NeuN

BrdU/GFAP

MSCs/LM-PAMs Vehicle MSCs

B

MSCs MSCs/LM-PAMs

*

* *

*

*

*

*

*

*

* *

*

* *

*

* *

0.00 0.20 0.40 0.60 0.80 1.00 1.20 1.40

LM-PAMs

MSCs MSCs/LM-PAMs 0.95

1.05 1.15

0.00 0.20 0.40 0.60 0.80 1.00 1.20 1.40

Fig. 3.Outcome of MSCs after MCAo with or without LM-PAMs at 28 days. (A) Representative MRI images, obtained 22 days following the occlusion, in the vehicle, MSCs, MSCs/LM-PAMs and LM-PAMs groups. (B) Representative images of BrdU (green) and NeuN (red) double-labelling (upper panels) and BrdU (red) and GFAP (green) double- labelling (lower panels) in the presence of MSCs alone or MSCs attached to LM-PAMs (scale bars = 25lm). The images were taken at the periphery of the lesion. The LM-PAMs are indicated by asterisks. (C) Proportion of BrdU-positive cells expressing the NeuN marker and (D) the proportion of BrdU-positive cells expressing GFAP marker (mean ± SD; MSCsn= 6; MSCs/LM-PAMsn= 4).Statistically different from MSCs alone (Mann–Whitney test,p< 0.05).

(6)

3.2.2. Outcome of MSCs associated with LM-PAMs after MCAo The influence of LM-PAMs on the phenotype of MSCs was assessed by analysing the expressions of GFAP and NeuN by MSCs previously labelled with BrdU.

As shown inFig. 3(B and C), the expression of the neuronal mar- ker NeuN by the BrdU-positive cells was increased when the cells were attached onto LM-PAMs (Mann–Whitney test,p= 0.04). The expression of NeuN was 12% greater in MSCs conveyed by LM- PAMs compared to MSCs alone. In contrast, double-labelled BrdU/GFAP-positive cells were 3-fold less abundant when MSCs were implanted with LM-PAMs compared with MSCs alone (Fig. 3D; Mann–Whitney test,p= 0.08). These results indicate that LM-PAMs increased the differentiation of MSCs into a neuronal- like phenotype 28 days after their administration.

No significant difference was found in the double-labelled BrdU/caspase 3a-positive cells between the two groups (MSCs/

LM-PAMs compared to MSCs alone), which might imply that LM-

PAMs fail to modify the survival of the MSCs survival, at least at 28 days (data not shown).

3.2.3. Behavioural analyses

No significant effect was observed with either neurological per- formance or sensorimotor function (Fig. 4). Since the graft of MSCs on LM-PAMs increases the expression of the neuronal marker at the expense of that of the glial marker in the ischaemic tissue but without any significant effect on functional recovery, we ana- lysed if prolonged release of the neurogenic and angiogenic growth factor VEGF-A could improve the efficiency of treatment in vivo.

3.3. MSCs/LM-PAMs–VEGF: effects on functional recovery and endogenous cellular reactions after MCAo

3.3.1. MRI quantification of brain damage

When the treatments (MSCs, MSCs/LM-PAMs and MSCs/LM- PAMs–VEGF) were administered 24 h after the MCAo, none had a

A B

0 20 40 60 80 100 120 140

contra ipsi contra ipsi

time to contact time to remove

Adhesive removal test (seconds)

Vehicle MSCs MSCs/LM-PAMs LM-PAMs

0 15 20 25 30 35

D0 D1 D2 D3 D4 D5 D7 D9 D11

Vehicle MSCs MSCs/LM-PAMs LM-PAMs

Neurologicalscore

Fig. 4.Study 1: effect of the treatments on functional recovery. (A) The neurological score (median ± 1 interquartile) and (B) the adhesive removal test during the second week (mean ± SD; vehiclen= 13; MSCsn= 9; MSCs/LM-PAMsn= 11; LM-PAMsn= 14).

F 0

0 0 0 0 0 0 0

A B

Vehicle MSCs

MSCs/LM-PAMs

Vehicle MSCs MSCs/LM-PAMs-VEGF

MSCs/LM-PAMs MSCs/LM-PAMs-VEGF

Vehicle MSCs

Infarctvolume (mm3)

MSCs/LM-PAMs MSCs/LM-PAMs-VEGF 50

150 200 250 300 350 400

0

MSCs/LM-PAMs-VEGF MSCs MSCs/LM-PAMs

Vehicle

0 30 40

20

10

Hemisphericatrophy(%)

Fig. 5.Infarct evolution between day 2 and day 22 in study 2. (A) Representative MRI and infarct volume at day 2 (vehiclen= 12; MSCsn= 5; MSCs/LM-PAMsn= 8; MSCs/

LM-PAMs–VEGFn= 10). The box defines the interquartile range (IQR), the solid horizontal line is the median and the whiskers represent the first and fourth quartiles. No outliers were discarded. (B) Representative MRI (T2, RARE) and atrophy at day 22 (vehiclen= 11; MSCsn= 5; MSCs/LM-PAMsn= 8; MSCs/LM-PAMs–VEGFn= 6) (median ± 1 interquartile).

(7)

significant effect, compared to vehicle, on the infarct volume as measured by MRI on days 2 and 22 (ANOVA,p> 0.05;Fig. 5A and B).

3.3.2. Behavioural analyses

All the groups displayed similar neurological deficits at day 1 following the occlusion (one-way ANOVA, no group effect, p= 0.18; Fig. 6). The treatments (MSCs, MSCs/LM-PAMs and MSCs/LM-PAMs–VEGF) failed to modify the evolution of the neuro- logical score in comparison to the vehicle-treated rats (repeated ANOVA,p> 0.05;Fig. 6A).

In the limb-placing test, the performance in the different groups did not differ at day 1 and no further significant difference was observed during the evaluation period. No effect was observed in

the corner test, beam walking test (data not shown) or adhesive removal test. In the latter, the time to remove the adhesive tended to be less in the MSCs/LM-PAMs-treated group (ANOVAp= 0.69 and p= 0.13 in the ipsi- and contralateral side, respectively;

Fig. 6B).

3.3.3. Endogenous cellular reactions

The expression of a marker of immature neurons, DCX, was assessed in the subventricular zone (SVZ) and in the peri-infarct area. The DCX labelling was denser in the MSCs/LM-PAMs–VEGF group compared to the other groups (Kruskal–Wallis test p= 0.05; Fig. 7A–D). Moreover, the extension of DCX-positive cells from the periventricular zone to the site of engraftment of 0

15 20 25 30 35

D0 D1 D2 D3 D4 D5 D7 D9 D11

Vehicle MSCs MSCs/LM-PAMs MSCs/LM-PAMs-VEGF

A B

0 20 40 60 80 100 120 140

contra ipsi contra ipsi time to contact time to remove

Adhesive removal test (seconds)

Vehicle MSCs MSCs/LM-PAMs MSCs/LM-PAMs-VEGF

Neurological score (units)

Fig. 6.Study 2: effect of the treatments on functional recovery. (A) The neurological score (median ± 1 interquartile) and (B) the adhesive removal test during the second week (mean ± SD; vehiclen= 10; MSCsn= 5; MSCs/LM-PAMsn= 7; MSCs/LM-PAMs–VEGFn= 4).

MSCs/LM-PAM-sVEGF Infarct area

Site of LM-PAM emplacement

A

D

0 1 2 3

Density of labelling (score units)

*

Vehicle MSCs MSCs/LM-PAMs

C

MSCs/LM-PAMs MSCs/LM-PAMs-VEGF

MSCs/LM-PAMs MSCs/LM-PAMs-VEGF

*

* B

Fig. 7.Effect of MSCs/LM-PAMs–VEGF treatment on DCX expression in the SVZ 28 days after the administration of the treatments. (A) Scheme representing coronal section at the level of the caudate–putamen, i.e. between0.26 and0.80 mm from the bregma, showing the tissue lesion as well as the site of LM-PAM implantation. (B) Representative images of DCX in the SVZ and the adjacent peri-infarct zone delineated by the dashed line and asterisk (scale bar = 200lm). (C) Representative images of DCX expression in the SVZ (scale bar = 500lm) and (D) the density of labelling in the same tissues as shown in (C) (mean ± SD; Kruskal–Wallis test followed by Mann–Whitney test,p< 0.05).

(8)

the LM-PAMs appeared to be greater in the MSCs/LM-PAMs–VEGF group compared to the other groups (Fig. 7B).

RECA-1 labelling, a marker of vascularization, was observed in both LM-PAMs groups (MSCs/LM-PAMs and MSCs/LM-PAMs–

VEGF) at the site of administration (Fig. 8A). However, the RECA- 1 labelling was denser in the MSCs/LM-PAMs–VEGF group when compared to the MSCs/LM-PAMs group, which might indicate that VEGF, delivered by PAMs, assists in the vascularization of the ischaemic tissue. The vascular network was less unstructured with the MSCs/LM-PAMs–VEGF in comparison to the MSCs/LM-PAMs treatment (Fig. 8B). To assess angiogenesis, a Ki67/RECA-1 dou- ble-labelling was performed in the MSCs/LM-PAMs and MSCs/

LM-PAMs–VEGF groups. As illustrated in Fig. 8C and D, an increased number of Ki67/RECA-1-positive cells were observed when VEGF was released by LM-PAMs compared with LM-PAMs not releasing VEGF (Mann–Whitney test,p= 0.02).

3.4. LM-PAMs–VEGF: effects on MSCs outcome

We examined whether LM-PAMs or LM-PAMs–VEGF could influence the profile of expression of neuronal markers and trophic factors by MSCs. As presented inFig. 9A and in accordance with Delcroix and colleagues[9], the MSCs adhered strongly to the sur-

face of the LM-PAMs. The LM-PAMs did not significantly modify the level of DCX mRNA expression by the MSCs (one-way ANOVA, p= 0.13), although a slight increase was observed (Fig. 9B). The LM-PAMs promoted the expression of TUBB3, a neuronal marker, by MSCs in comparison to the same quantity of MSCs alone (8.60 ± 4.10-fold, one-way ANOVA followed by Fisher’s PLSD, p= 0.01;Fig. 9B). The adjunction of VEGF to the LM-PAMs had no additional effect on the expression of this marker (8.00 ± 4.50-fold compared to MSCs alone, ANOVA followed by Fisher’s PLSD, p= 0.02).

Interestingly, the expressions of VEGF-A, TGFb1 and BDNF were increased by MSCs adhering to the LM-PAMs (one-way ANOVA fol- lowed by Fisher’s PLSD,p< 0.05) in comparison to MSCs alone at the same density. The addition of VEGF to LM-PAMs had no addi- tional effect (Fig. 9B). The presence of LM-PAMs with or without VEGF failed to modify the expression of the NGF gene by MSCs (data not shown).

4. Discussion

The use of MSCs is a hopeful strategy for repairing damaged brain tissue in stroke patients, as well as in a number of other pathologies of the central nervous system. The use of MSCs in regenerative therapy for stroke patients has been the object of

D

C

MSCs/LM-PAMs MSCs/LM-PAMs-VEGF

*

*

* *

**

* * ***

*

*

* *

RECA-1 − around the site of administration

MSCs/LM-PAMs MSCs/LM-PAMs-VEGF

RECA-1/Ki67 − at the site of LM -PAM emplacement

B

MSCs/LM-PAMs MSCs/LM-PAMs-VEGF

RECA-1 − at the site of LM-PAM emplacement

Site of LM-PAM emplacement

A

E

MSCs/LM-PAMs MSCs/LM-PAMs-VEGF 80

70 60 50 40 30 20 10 0 Ki67+/RECA-1+cells(% double labelled)

*

Fig. 8.Vascular changes with MSCs/LM-PAMs with or without VEGF. (A) Scheme representing coronal section at the level of the caudate–putamen (i.e. between0.26 and 0.80 from the bregma) showing the tissue lesion as well as the site of LM-PAM implantation. (B) RECA-1 labelling inside LM-PAMs with or without VEGF (scale bar = 100lm). (C) Organization of vessels around the LM-PAMs (noted by asterisks) engraftment site (dashed lines) (scale bar = 100lm). (D) Representative images of Ki67+/ RECA-1+double-labelling obtained with confocal microscope (scale bar = 50lm) and (E) percentage of Ki67+/RECA-1+cells with respect to the total Ki67+cells detected in by RECA-1 in the focus (n= 5). The box defines the IQR, the solid horizontal line is the median and the whiskers represent the first and fourth quartiles. No outliers were discarded.Statistically different from MSCs/LM-PAMs (Mann–Whitney test,p< 0.05).

(9)

numerous preclinical studies [3]. Moreover, preliminary clinical investigations have shown that the treatment of stroke patients by MSCs is safe and efficient[4]. The therapeutic capacities of MSCs have been attributed mainly to their paracrine effects and modifi- cations of immunological function[23]. However, the efficacy of treatment by MSCs may be limited by their low survival rate after administration in ischaemic tissue[6].

The administration of stem cells with coated tridimensional biopolymer-like microparticles promotes the differentiation and/

or survival of the cells so prepared[24,25]. Devices that deliver a growth factor avoid the rapid degradation of cells in vivo and allow a sustained release of the growth factor chosen, clearly enhancing cell engraftment[8,26]. Therefore, to sustain the neuronal differen- tiation of MSCs, their survival and/or their paracrine function, we developed a tissue engineering approach which combines MSCs adhered onto PLGA microcarriers, LM-PAMs, designed to deliver VEGF to the ischaemic tissue. For the first time, the effectiveness of microcarriers delivering a growth factor with MSCs in a sus- tained manner was analysed in a long-term study of the infarct volume, functional recovery and endogenous cellular reactions within the context and constraints of an animal model of stroke.

As expected, when the treatment was administered a long time after the stroke, namely, 24 h after the occlusion, we failed to detect any effect of the treatments on the lesion size. However, we have demonstrated that MSCs, transplanted 24 h after stroke, express markers of mature neurons (NeuN) – an effect which increased when MSCs were attached to the LM-PAMs prior to their administration. Of note, although BrdU can reduce prolifer-

ation of cells, perturb their differentiation and alter their senes- cence [27], we believe that it is among the best tools in our study for identifying and following up MSCs in vivo. Indeed, to avoid rejection of the cells and mimic clinical conditions, we used MSCs cells from rats of the same strain, making it impossible to use species-specific markers such as anti-HNA[8]. The rats used in our study were limited to males in order to avoid any con- founding effects of sexual hormones on infarct volume [28], which render the identification of MSCs by the chromosome Y impossible. In addition, as explained by Harting et al. [29], the use of a vector for MSCs identification might be sensitive to

‘‘epigenic silencing’’. Finally, to our knowledge, the very few stud- ies that have tracked MSCs in vivo for a long period[30,31], as in our study, also used BrdU prelabelling cells.

These in vivo effects showing that LM-PAMs increase neuronal marker expression by MSCs were also found in vitro at the mRNA level, 24 h after their attachment to the LM-PAMs.

The results thus concord with previous in vitro reports which showed that a subpopulation of human MSCs may differentiate into neuronal-like cells following a four-step protocol based on a combination of growth factors and that this differentiation is potentiated by a laminin substrate[9]. No effect of LM-PAMs on the survival of MSCs was observed 28 days after implantation, although one cannot exclude that increased survival may have occurred at earlier time points, as already reported in an ex vivo and in vivo model of global ischaemia with fibronectin-coated PAMs[25]. One might assume thus that laminin in PAMs stimu- lated neuronal differentiation but not MSC survival.

0 2 4 6 8 10 12 14

DCX TUBB3 VEGF-A TGFβ1 BDNF

Relave gene expression level

MSCs 24h MSCs/LM-PAMs 24h MSCs/LM-PAMs-VEGF 24h

A

B

**

*

* **

Neuronal markers Trophic factors

PAM PAM

PAM

Fig. 9.Effect of LM-PAMs, with or without VEGF, on MSCs. (A) MSCs adhered onto LM-PAMs surface after 4 h of contact with LM-PAMs (scale bar = 50lm). (B) Effect of microcarriers on the differentiation neural gene Tuj1 (TUBB3) in the MSCs and a marker of immature neuron, DCX expression, and on MSCs’ VEGF-A, BDNF and TGFb1 expression. Results are normalized with the gene reference and expressed as relative expression compared to the MSC 24 h group (mean ± SD; ANOVA followed by Fisher’s PLSD test;p< 0.05,⁄⁄p< 0.001). MSCs 24 hn= 3; MSCs/LM-PAMs 24 hn= 7; MSCs/LM-PAMs–VEGF 24 hn= 7 in all conditions excepted for DCX MSCs/LM-PAMs–VEGFn= 5.

(10)

Nevertheless, this effect on neuronal differentiation was dis- sociated from a significant improvement in functional recovery regardless of the form of treatment applied. These findings fail to replicate previous studies in which an improvement in func- tional recovery by MSCs was shown [3]. This discrepancy might be related to the various origins of the cells (different tissue ori- gin, different in vitro culture conditions and different species), the time window of cell administration, the functional recovery assessment or the amount of cells applied. Thus, we cannot exclude the possibility that MSCs from different species or tis- sues, or the administration of a greater number of MSCs after MCAo, may result in enhanced functional recovery. In addition, we cannot exclude a potential later effect of the therapy which would be observed after the first month following the treatment.

In the rats treated with MSCs/LM-PAMs, the shorter time to remove the adhesive from the ipsi- and contralateral sides and the increased expression of neuronal markers by MSCs together encourage further studies on the usefulness of LM-PAMs as a biomimetic support in models of focal cerebral ischaemia and, eventually, in stroke itself.

Another important point to be considered for the implanta- tion of MSCs in an injured organ is the formation of a competent vasculature. It is obligatory that, during the repair of ischaemic tissue, there be an appropriate angiogenesis. The recruitment of endothelial cells in the brain depends, notably, on the VEGF- A gradient [32]. Accordingly, and in order to better understand the formation of a restructured vasculature around the site of implantation of MSCs, we investigated the actions of LM-PAMs loaded with the angiogenic factor VEGF-A, which is known to be a neurogenic factor [33] and to favour the survival of MSCs [13]. When MSCs were attached to the LM-PAMs–VEGF, we showed that the proliferation of endothelial cells at the site of implantation, as assessed by double-labelling with Ki67 and RECA-1, is increased compared to the MSCs/LM-PAMs group.

Moreover, with the MSCs/LM-PAMs–VEGF, we observed a more structured vasculature than that seen in the MSCs/LM-PAMs group. These results are in accordance with those of Bible and colleagues [8], who found that the encapsulation of VEGF-A in microcarriers associated with human NSCs promotes the recruit- ment of host endothelial cells into the lesion cavity. Our results are also in line with those of Gutiérrez-Fernández and colleagues [34], who found that the administration of MSCs increases VEGF expression along with vascular density in the peri-infarct zone 14 days after the induction of stroke. Interest in combining MSCs with VEGF has been further strengthened by the report that MSCs-mediated VEGF gene transfer in rats is active in the treat- ment of ischaemic heart disease [35].

Other than angiogenesis, MSCs have been shown to induce neu- rogenesis within the context of ischaemia[3]. In addition to being one of the archetypical angiogenic factors, VEGF-A is also recog- nized for its neurogenic properties[36]. Based on these features, we hypothesized that the use of LM-PAMs loaded with VEGF-A would increase peri-lesional neurogenesis. We observed that the MSCs/LM-PAMs–VEGF treatment evidenced the labelling of imma- ture neurons in the SVZ, with a sprouting directed towards the ischaemic core, unlike MSCs/LM-PAMs alone. We observed in the in vitro studies that LM-PAMs increase the expression of BDNF mRNA by the MSCs. BDNF is widely recognized to be a neurotro- phic factor that plays a key role in the survival of nascent neurons, migration and synaptic plasticity [37]. The BDNF produced by MSCs may reinforce the migration of immature neurons from the SVZ towards the ischaemic lesion. We showed that the expression of TGFb1 mRNA by the MSCs is likewise increased in the presence of LM-PAMs. The beneficial role of TGFb1 in neuronal survival, inflammatory reactions and neurogenesis[38] suggests that this factor is an additional, advantageous paracrine factor secreted by

the MSCs in brain tissue suffering from local hypoxia. Interestingly, Yoo and colleagues [39] have shown that MSC-secreted TGF-b plays a crucial role in the ability of MSCs to attenuate the severity of immune reactions in the ischaemic brain. Since our first goal was to improve the beneficial effects of MSCs, we focused on the impact of combinatorial strategies: MSCs conveyed by LM-PAMs or by LM-PAMs releasing VEGF, compared to MSCs alone. However, we cannot exclude that LM-PAMs–VEGF might have a beneficial effect by themselves, although Bible and colleagues[8] did not report any effect of PAMs–VEGF not combined with cells in their study.

While our initial studies on endogenous neurogenesis and angiogenesis hold promise, the association of MSCs with LM- PAMs–VEGF failed to be sufficient to induce meaningful effects on functional recovery, at least as defined by our measures of sensorimotor function. We have accentuated the possibility of delivering LM-PAMs–VEGF to the ischaemic striatum without side-effects despite the important mass of LM-PAMs engrafted.

In a previous study, the efficacy of VEGF released by LM-PAMs on the survival of MSCs after hypoxia/reoxygenation was demon- strated [13]; however, in vivo, the released VEGF is forcibly decreased due to the slower degradation rate of the microcarri- ers. The implantation of MSCs associated with microcarriers releasing a more important quantity of VEGF and without side- effects within the context of stroke is a challenge for the future.

To this end, PLGA–P188–PLGA, for which we have recently reported the capacity to deliver 70% of the total TGF-b3 loaded, appears to be a solid candidate[40].

Finally, although the size of the PAM might be a limitation of the treatment, translating it to stroke patients should not be impossible once the approach has been validated in different experimental models of brain ischaemia and in different animal species. Although intracerebral administration of PAMs may carry some risks, such surgical approach is already performed for the implantation of MSCs in stroke patients or electrodes in deep brain structure in patients with Parkinson’s disease or central post- stroke patients [41–43]. Moreover, since this approach targets the sub-acute stage of stroke to enhance repair/regeneration, the timing of administration would not be a major constraint, unlike in acute therapies such as thrombolysis.

5. Conclusion

The association of drug delivery systems with biodegradable microcarriers is a unique tool for supporting stem cells and repre- sents a cogent strategy for cell therapy in stroke. There are sub- stantial arguments that the delivery of a specific growth factor and/or the coating substrate may enhance cell survival and differ- entiation. Even though the efficacy of LM-PAMs holds promise for the facilitation of the differentiation of MSCs into those of a neuro- nal phenotype as well as for promoting the secretion of neurotro- phic factors, this efficacy is insufficient, at least under the conditions developed in this study, since we were unable to mean- ingfully enhance functional recovery after a massive cerebral ischaemia in the rat. In 2007, biodegradable microparticles deliver- ing two different molecules were demonstrated to be an effective approach to enhancing the development of an immune response [44]. Since the LM-PAMs could encapsulate more than one growth factor, according to the literature and the results obtained in vitro, the encapsulation of VEGF-A in association with BDNF could be a route to further ameliorate regeneration (angiogenesis, synapto- genesis and neurogenesis) within the ischaemic volume, the func- tional outcome of administered MSCs and, concomitantly, to further intensify the rate and importance of the functional recov- ery in focal cerebral ischaemia.

(11)

6. Disclosure

The authors confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influ- enced its outcome.

Acknowledgements

This work was supported by CNRS, the Ministère de l’Enseigne- ment Supérieure et de la Recherche, the Universities of Caen Basse- Normandie and Angers, Interreg IV A-2 mers seas zeeëns TC2N (Trans-Channel Neuroscience Network) ‘‘Investing in your future’’

crossborder cooperation programme 2007-2013 part financed by the European Union (European Regional Development Fund), and the Conseil Régional de Basse-Normandie. The authors wish to thank Dr. E.T. MacKenzie for critically reviewing the manuscript and the microscopic platform CMABio and the site smart.servier.fr for their image bank, which was used for the graphical abstract illustration.

Appendix A. Figures with essential color discrimination

Certain figures in this article, particularly Figs. 2, 3, 7 and 8 are difficult to interpret in black and white. The full color images can be found in the on-line version, athttp://dx.doi.org/10.1016/j.act- bio.2014.12.017.

Appendix B. Supplementary data

Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.actbio.2014.12.

017.

References

[1]Stone L, Grande A, Low W. Neural repair and neuroprotection with stem cells in ischemic stroke. Brain Sci 2013;3:599–614.

[2]Hess D, Borlongan C. Stem cells and neurological diseases. Cell Prolif 2008;41:94–114.

[3]Hao L, Zou Z, Tian H, Zhang Y, Zhou H, Liu L. Stem cell-based therapies for ischemic stroke. Biomed Res Int 2014;2014:468748.

[4]Lee JS, Hong JM, Moon GJ, Lee PH, Ahn YH, Bang OY. A long-term follow-up study of intravenous autologous mesenchymal stem cell transplantation in patients with ischemic stroke. Stem Cells 2010;28:1099–106.

[5]Munoz J, Stoutenger B, Robinson A, Spees J, Prockop D. Human stem/progenitor cells from bone marrow promote neurogenesis of endogenous neural stem cells in the hippocampus of mice. Proc Natl Acad Sci USA 2005;102:18171–6.

[6]Song H, Song B-W, Cha M-J, Choi I-G, Hwang K-C. Modification of mesenchymal stem cells for cardiac regeneration. Expert Opin Biol Ther 2010;10:309–19.

[7]Toma C, Pittenger MF, Cahill KS, Byrne BJ, Kessler PD. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 2002;105:93–8.

[8]Bible E, Qutachi O, Chau DYS, Alexander MR, Shakesheff KM, Modo M. Neo- vascularization of the stroke cavity by implantation of human neural stem cells on VEGF-releasing PLGA microparticles. Biomaterials 2012;33:7435–46.

[9]Delcroix GJR, Garbayo E, Sindji L, Thomas O, Vanpouille-Box C, Schiller PC, et al.

The therapeutic potential of human multipotent mesenchymal stromal cells combined with pharmacologically active microcarriers transplanted in hemi- parkinsonian rats. Biomaterials 2011;32:1560–73.

[10]Ho M, Yu D, Davidsion MC, Silva GA. Comparison of standard surface chemistries for culturing mesenchymal stem cells prior to neural differentiation. Biomaterials 2006;27:4333–9.

[11]Tatard VM, Venier-Julienne MC, Benoit JP, Menei P, Montero-Menei CN. In vivo evaluation of pharmacologically active microcarriers releasing nerve growth factor and conveying PC12 cells. Cell Transplant 2004;13:573–83.

[12]Tatard VM, Sindji L, Branton J, Aubert-Pouëssel A, Colleau J, Benoit JP, et al.

Pharmacologically active microcarriers releasing glial cell line-derived neurotrophic factor: survival and differentiation of embryonic dopaminergic neurons after grafting in hemiparkinsonian rats. Biomaterials 2007;28:1978–88.

[13]Penna C, Perrelli M-G, Karam J-P, Angotti C, Muscari C, Montero-Menei CN, et al. Pharmacologically active microcarriers influence VEGF-A effects on mesenchymal stem cell survival. J Cell Mol Med 2013;17:192–204.

[14]Chuquet J, Benchenane K, Toutain J, MacKenzie ET, Roussel S, Touzani O.

Selective blockade of endothelin-B receptors exacerbates ischemic brain damage in the rat. Stroke 2002;33:3019–25.

[15]Esneault E, Pacary E, Eddi D, Freret T, Tixier E, Toutain J, et al. Combined therapeutic strategy using erythropoietin and mesenchymal stem cells potentiates neurogenesis after transient focal cerebral ischemia in rats. J Cereb Blood Flow Metab 2008;28:1552–63.

[16]Khalili MA, Anvari M, Hekmati-Moghadam SH, Sadeghian-Nodoushan F, Fesahat F, Miresmaeili SM. Therapeutic benefit of intravenous transplantation of mesenchymal stem cells after experimental subarachnoid hemorrhage in rats. J Stroke Cerebrovasc Dis 2012;21:445–51.

[17]Letourneur A, Roussel S, Toutain J, Bernaudin M, Touzani O. Impact of genetic and renovascular chronic arterial hypertension on the acute spatiotemporal evolution of the ischemic penumbra: a sequential study with MRI in the rat. J Cereb Blood Flow Metab 2011;31:504–13.

[18]Leconte C, Tixier E, Freret T, Toutain J, Saulnier R, Boulouard M, et al. Delayed hypoxic postconditioning protects against cerebral ischemia in the mouse.

Stroke 2009;40:3349–55.

[19]Freret T, Valable S, Chazalviel L, Saulnier R, MacKenzie ET, Petit E, et al. Delayed administration of deferoxamine reduces brain damage and promotes functional recovery after transient focal cerebral ischemia in the rat. Eur J Neurosci 2006;23:1757–65.

[20] De Ryck M, Van Reempts J, Borgers M, Wauquier A, Janssen P. Photochemical stroke model: flunarizine prevents sensorimotor deficits after neocortical infarcts in rats. Stroke 1989;20:1383–90.

[21]Schallert T, Upchurch M, Lobaugh N. Tactile extinction: distinguishing between sensorimotor and motor asymmetries in rats with unilateral nigrostriatal damage. Pharmacol Biochem Behav 1982;16:455–62.

[22]Schallert T, Woodlee MT, Fleming SM. Disentangling multiple types of recovery from brain injury. Stuttgart: Medpharm Scientific Publishers; 2002.

[23]Paul G, Anisimov SV. The secretome of mesenchymal stem cells: potential implications for neuroregeneration. Biochimie 2013;95:2246–56.

[24]Bible E, Chau DYS, Alexander MR, Price J, Shakesheff KM, Modo M. The support of neural stem cells transplanted into stroke-induced brain cavities by PLGA particles. Biomaterials 2009;30:2985–94.

[25]Garbayo E, Raval AP, Curtis KM, Della-Morte D, Gomez LA, D’Ippolito G, et al.

Neuroprotective properties of marrow-isolated adult multilineage-inducible cells in rat hippocampus following global cerebral ischemia are enhanced when complexed to biomimetic microcarriers. J Neurochem 2011;119:972–88.

[26]Rhim T, Lee DY, Lee M. Drug delivery systems for the treatment of ischemic stroke. Pharm Res 2013;30:2429–44.

[27]Burns TC, Ortiz-González XR, Gutiérrez-Pérez M, Keene CD, Sharda R, Demorest ZL, et al. Thymidine analogs are transferred from prelabeled donor to host cells in the central nervous system after transplantation: a word of caution. Stem Cells 2006;24:1121–7.

[28]Hurn PD, Brass LM. Estrogen and stroke: a balanced analysis. Stroke 2003;34:338–41.

[29]Harting MT, Jimenez F, Cox CS. Isolation of mesenchymal stem cells (MSCs) from green fluorescent protein positive (GFP+) transgenic rodents: the grass is not always green(er). Stem Cells Dev 2009;18:127–35.

[30] Jing X, Yang L, Duan X, Xie B, Chen W, Li Z, et al. In vivo MR imaging tracking of magnetic iron oxide nanoparticle labeled, engineered, autologous bone marrow mesenchymal stem cells following intra-articular injection. Joint Bone Spine 2008;75:432–8.

[31]Bi X, Deng Y, Gan D, Wang Y. Salvianolic acid B promotes survival of transplanted mesenchymal stem cells in spinal cord-injured rats. Acta Pharmacol Sin 2008;29:169–76.

[32]Ruhrberg C, Gerhardt H, Golding M, Watson R, Ioannidou S, Fujisawa H, et al.

Spatially restricted patterning cues provided by heparin-binding VEGF-A control blood vessel branching morphogenesis. Genes Dev 2002:2684–98.

[33]Mackenzie F, Ruhrberg C. Diverse roles for VEGF-A in the nervous system.

Development 2012;139:1371–80.

[34]Gutiérrez-Fernández M, Rodríguez-Frutos B, Álvarez-Grech J, Vallejo- Cremades MT, Expósito-Alcaide M, Merino J, et al. Functional recovery after hematic administration of allogenic mesenchymal stem cells in acute ischemic stroke in rats. Neuroscience 2011;175:394–405.

[35]Gao F, He T, Wang H, Yu S, Yi D. A promising strategy for the treatment of ischemic heart disease: mesenchymal stem cell-mediated vascular endothelial growth factor gene transfer in rats. Can J Cardiol 2007;23:891–8.

[36]Rosenstein JM, Krum JM, Ruhrberg C. VEGF in the nervous system.

Organogenesis 2010;6:107–14.

[37]Wu D. Neuroprotection in experimental stroke with targeted neurotrophins.

NeuroRx 2005;2:120–8.

[38]Krieglstein K, Strelau J, Schober A, Sullivan A, Unsicker K. TGF-beta and the regulation of neuron survival and death. J Physiol Paris 2002;96:25–30.

[39]Yoo SW, Chang DY, Lee HS, Kim GH, Park JS, Ryu BY, et al. Immune following suppression mesenchymal stem cell transplantation in the ischemic brain is mediated by TGF-b. Neurobiol Dis 2013;58:249–57.

[40] Morille M, Van-Thanh T, Garric X, Cayon J, Coudane J, Noël D, et al. New PLGA–

P188–PLGA matrix enhances TGF-b3 release from pharmacologically active microcarriers and promotes chondrogenesis of mesenchymal stem cells. J Control Release 2013;170:99–110.

(12)

[41]Suárez-Monteagudo C, Hernández-Ramírez P, Alvarez-González L, García- Maeso I, de la Cuétara-Bernal K, Castillo-Díaz L, et al. Autologous bone marrow stem cell neurotransplantation in stroke patients. An open study. Restor Neurol Neurosci 2009;27:151–61.

[42]Nizard J, Raoul S. Invasive stimulation therapies for the treatment of refractory pain. Discov Med 2012;14:2012.

[43]Goodman R, Kim B. Operative techniques and morbidity with subthalamic nucleus deep brain stimulation in 100 consecutive patients with advanced Parkinson’s disease. J Neurol Neurosurg Psychiatry 2006;77:12–7.

[44]Zhang X, Dahle C, Baman N, Rich N, Weiner G, Salem A. Potent antigen-specific immune responses stimulated by codelivery of CpG ODN and antigens in degradable microparticles. J Immunother 2007;30:469–78.

Références

Documents relatifs

In the Arctic tundra, snow is believed to protect lemmings from mammalian predators during winter. We hypothesised that 1) snow quality (depth and hardness)

Multipotent marrow stromal cells (MSCs) raise great interest for brain cell therapy due to their ease of isolation from bone marrow, their immunomodulatory and tissue repair

They may serve as a support for stem cells and may be used as cell carriers providing a controlled delivery of active protein such as the angiogenic factor, vascular

Data are% variation with respect to mean value of MSCs kept under standard conditions for 3-days (MSC-3-N). In normoxia only free-VEGF-A pre-treatment induced a significant increase

We concluded that (1) osteogenic differentiation can be initiated on pure PCL-based electrospun scaffolds without specific culture conditions; (2) fiber alignment modified

Therefore, space managers at CNES, scientists conceiving instruments and more generally the community of Earth scientists must come to terms with the novelty of handling

Human Mesenchymal Stem Cells (hMSCs) appear as promising candidates for cell- substrate interaction studies for bone tissue engineering applications, as they can be harvested from

l’utilisation d’un remède autre que le médicament, le mélange de miel et citron était le remède le plus utilisé, ce remède était efficace dans 75% des cas, le