HAL Id: hal-03315490
https://hal.archives-ouvertes.fr/hal-03315490
Submitted on 5 Aug 2021
HAL is a multi-disciplinary open access archive for the deposit and dissemination of sci- entific research documents, whether they are pub- lished or not. The documents may come from teaching and research institutions in France or abroad, or from public or private research centers.
L’archive ouverte pluridisciplinaire HAL, est destinée au dépôt et à la diffusion de documents scientifiques de niveau recherche, publiés ou non, émanant des établissements d’enseignement et de recherche français ou étrangers, des laboratoires publics ou privés.
Control of Hepatitis B Virus replication by innate response of HepaRG cells
Julie Lucifora, David Durantel, Barbara Testoni, Olivier Hantz, Massimo Levrero, Fabien Zoulim
To cite this version:
Julie Lucifora, David Durantel, Barbara Testoni, Olivier Hantz, Massimo Levrero, et al.. Control of Hepatitis B Virus replication by innate response of HepaRG cells. Hepatology, Wiley-Blackwell, 2010, 51 (1), pp.63-72. �10.1002/hep.23230�. �hal-03315490�
1 HEP-09-0579, revised version
1 2
Control of Hepatitis B Virus replication by innate response
3
of HepaRG cells
4 5 6
Julie Lucifora1,2, David Durantel1,2,3, Barbara Testoni4,5, Olivier Hantz1,2, Massimo 7
Levrero4,5 and Fabien Zoulim1,2,3,*. 8
9 10
1) INSERM, U871, 151 Cours Albert Thomas, 69003 Lyon, France;
11
2) Université Lyon 1, IFR62 Lyon Est, 69008 Lyon, France ; 12
3) Hospices Civils de Lyon, Hôtel Dieu Hospital, 69002 Lyon, France;
13
4) Department of internal Medecine and Laboratory of Gene Expression, Fondazione A.
14
Cesalpino, University of Rome La Sapienza, Rome, Italy 15
5) Laboratoire Associé INSERM, U785, Villejuif, France.
16 17
Short title : 18
19
HBV and the induction of the IFN pathway 20
21
Keywords : 22
23
antiviral state, baculovirus, hepatitis B Virus, Interferon 24
25
Contact information : 26
27
*Fabien Zoulim 28
Mailing address: INSERM, U871, 151 cours Albert Thomas, 69003 Lyon, France.
29
Phone: +33437497410. Fax: +33437497419. E-mail: fabien.zoulim@inserm.fr 30
31
List of abbreviations : 32
33
HBV (Hepatitis B Virus), IFN (interferon), ISG (interferon stimulated genes) 34
35
Financial support : 36
37
This work was supported by grants from the European Community (ViRgil LSHM-CT- 38
2004-503359), the French National Agency for Research against AIDS and viral 39
hepatitis (ANRS), and INSERM. J.L. was recipient from a PhD bursary from the ANRS.
40 41
Word count and figures number : 42
43
Abstract : 251 words 44
4990 words in text + reference 45
Figures : 7 + 1 supplementary file 46
47
No conflict of interest 48
2 Abstract
49
Background and aims : HBV is currently viewed as a stealth virus that does not 50
elicit innate immunity in vivo. This assumption has not yet been challenged in vitro 51
because of the lack of a relevant cell culture system. The HepaRG cell line, which is 52
physiologically closer to differentiated hepatocytes and permissive to HBV infection, has 53
opened new perspectives in this respect.
54
Methods : HBV baculoviruses were used to initiate an HBV replication in both 55
HepG2 and HepaRG cells. To monitor HBV replication, the synthesis of encapsidated 56
DNA, and secretion of HBsAg, was respectively analyzed by southern-blot and Elisa.
57
The induction of a type-I IFN response was monitored by targeted qRT-PCR, low 58
density arrays, and functional assays. The invalidation of type-I IFN response was 59
obtained by either antibody neutralisation or RNA interference.
60
Results : We demonstrate that HBV elicits a strong and specific innate antiviral 61
response that result in a non-cytopathic clearance of HBV DNA in HepaRG cells.
62
Challenge experiment showed that transduction with Bac-HBV-WT, but not with control 63
baculoviruses, leads to this antiviral response in HepaRG cells, whereas no antiviral 64
response is observed in HepG2 cells. Cellular gene expression analyses showed that 65
IFN- and other interferon stimulated genes were up-regulated in HepG2 and HepaRG 66
cells, but not in cells transduced by control baculoviruses. Interestingly, a rescue of viral 67
replication was observed when IFN- action was neutralized by antibodies or RNA 68
interference of type-I IFN receptor.
69
Conclusions : Our data suggest that a strong HBV replication is able to elicit a 70
type-I IFN response in HepaRG-infected cells.
71 72
3 Background and aims
73
HBV is currently viewed as a non-cytopatic virus and HBV-associated liver 74
damage is thought to be the consequence of a long lasting cytolytic immune response 75
against infected hepatocytes (1). The outcome of HBV infection, as well as the severity 76
of HBV-induced liver disease, varies widely from one patient to another. In around 90- 77
95% of adults, exposure to HBV leads to an acute infection which is rapidly cleared 78
without long-term consequences. The remaining 5-10% fail to control viral infection that 79
consequently evolves to chronicity. The latter predisposes patients to severe liver 80
disease, including cirrhosis and hepatocellular carcinoma (2).
81
The intracellular innate antiviral response to infection constitutes an early 82
defense mechanism that aims at stopping replication in already infected cells, as well as 83
limiting the spreading of infection to neighboring cells. This response takes place very 84
early after infection of cells and plays an important stimulatory role for the subsequent 85
development of innate and adaptive immune responses. In many cases, cells mounting 86
this response produce type-I (IFN-, (and type-III; i.e. IFN-) interferons which are 87
cytokines with pleiotropic functions that mediate both direct and indirect antiviral effect 88
(3-5). The direct antiviral effect of type-I IFNs is exerted by a variety of effectors that are 89
expressed by genes whose transcription is directly stimulated by IFNs, i.e. IFN- 90
stimulated genes (ISGs). The production of type-I IFNs can be triggered by virus 91
components and/or replication through cellular sensors that detect the presence of viral 92
RNA, DNA or proteins (4). The indirect antiviral effect of type-I IFNs is due to their 93
stimulatory effect on different cells of the innate and adaptive immune response.
94
Using experimentally-infected chimpanzees, microarray analyses suggested that 95
HBV, early in infection, does not modulate host cellular gene transcription and would 96
neither induce innate antiviral response in hepatocytes nor intrahepatic innate immune 97
responses (6). Following this study, HBV was qualified as a “stealth virus” (7). However 98
4 a study from the same group showed that HBV could be cleared from the livers of 99
infected animals before any detectable adaptive immune response (8), thus suggesting 100
that innate immunity, i.e. antiviral response at level of infected cells and innate response 101
via specialized cells of immune system (e.g. NK, NKT), could play an important role.
102
This was eventually demonstrated by a study on two HBV-seronegative blood donors 103
who became HBV DNA positive and were carefully and immediately monitored after the 104
onset of infection. In both patients, NK and NT cells were activated before maximal HBV 105
DNA elevation whereas HBV-specific T cell responses were maximal later when HBV 106
DNA was already declining, thus demonstrating that the innate immune system was 107
able to sense HBV infection (9).
108
The study of antiviral response in HBV-infected cells was hampered by the 109
difficulty to grow the virus in cell culture systems. Only freshly prepared primary human 110
hepatocytes (PHH) and differentiated HepaRG cells can support a complete HBV life 111
cycle, including early events of infection (10, 11). HepaRG cells are liver bi-potent 112
progenitor cells that are able to differentiate into both biliary and hepatocyte-like cells 113
(12). However, the overall replication level in these cells is rather low with less than 20%
114
of cells infected, which complicates the study of host/pathogen interaction (13). One 115
could hypothesize that the low level of replication might be the consequence of an IFN 116
response. In this case, the virus would be able to trigger a host antiviral response and 117
would be capable to disarm it in only a low percentage of cells. This low percentage of 118
infected cells is an obstacle for studying the potential ability of HBV to elicit an IFN 119
response. Indeed, in other viral models, when a low multiplicity of infection is used, 120
which is likely the case with HBV, it has been documented that an IFN response may 121
occur in only a low percentage (< 30%) of infected cells (14), thus complicating its 122
analysis. Moreover, some viruses are particularly efficient to counteract this IFN 123
response and may therefore render the analysis of IFN response more difficult (15). In 124
5 this respect, HBV was shown to be very efficient to inhibit IFN signaling pathway (16- 125
19). Another technical obstacle for studying the potential ability of HBV to elicit an IFN 126
response is that an inoculation time of 16 hours is requested to initiate a strong infection 127
of hepatocytes in vitro (20). This is not compatible with the very early post-infection 128
analysis that would be likely necessary to detect a potentially weak and transient IFN 129
response. To gain data in cell culture system on the potential ability of HBV to elicit and 130
then disarm an IFN response, it appears necessary to initiate a timely controlled and 131
high HBV replication in a large number of cells.
132
One possibility to initiate a timely controlled and high intracellular HBV replication 133
in vitro is to use a recombinant baculovirus carrying full HBV genome to efficiently 134
transduce hepatic cells. This approach led to higher HBV replication levels compared to 135
either transfection of cells or stable cell lines such as HepG2.2.15 (21). In a previous 136
study, we have improved this system by generating a new HBV recombinant 137
baculovirus in which the synthesis of pregenomic RNA was driven by a strong 138
mammalian promoter. The initiation of a complete HBV DNA replication cycle, followed 139
by the production of infectious particles was evidenced in transduced-HepG2 cells (22).
140
However, HepG2 cells are not ideal for studying IFN response as they are transformed 141
and therefore impaired for many cellular pathways.
142
The goal of this study was to determine whether HBV could elicit an type-I IFN 143
response in the non-transformed/non-neoplastic HepaRG cells that are functional for 144
type-I IFN signalling pathway (23), and whether this IFN production could be 145
responsible for the control of HBV replication in this cell line.
146
6 Experimental procedures
147
Cell culture 148
HepG2 (ATCC) cells and HepaRG cells (11) were maintained in William’s medium 149
(Invitrogen) supplemented with 10 % fetal calf serum (Perbio), penicillin/streptomycin 50 150
U/mL (Invitrogen), glutaMax (Invitrogen) 2mM, insulin bovine 5 µg/mL and 5 x 10-5 M 151
hydrocortisone hemisuccinate (Roche Diagnostics, Boehringer Mannheim) at 37°C in 152
humidified incubators at 5% CO2. To obtain differentiation of HepaRG, cells were 153
maintained for two weeks in standard medium, then for at least two more weeks in 154
medium supplemented with 1,8 % of DMSO (cell culture grade, Sigma).
155 156
Baculovirus and transduction of Mammalian cells 157
Baculoviral constructions (Bac-HBV-WT, Bac-HBV-YPDD, Bac-βGal, Bac-GFP) as well 158
as stock production, titration, and concentration were performed as described previously 159
(22). All the recombinant HBV baculoviruses contain a 1.1x unit-length HBV genome 160
(genotype D, serotype ayw, accession number in GenBank : V01460) and enables the 161
synthesis of pgRNA under the control of chicken β-actin promoter. Baculoviral 162
transduction of mammalian cells has also been performed as previously described (22).
163 164
Analysis of viral DNA 165
Purification of HBV DNA from intracellular core particles and analysis/quantification by 166
southern blotting with radioactive probe were performed as previously described (24, 167
25).
168 169
Analysis of gene expression by qRT-PCR 170
Total RNA was extracted from cells with the “NucleoSpin RNA II” kit according to 171
manufacturer’s instructions (Macherey-Nagel). IFNβ genes expression was analyzed by 172
7 qRT-PCR with the “SYBR GreenER Two-Step qRT-PCR Kit for iCycler” according to the 173
manufacturer’s instructions (Invitrogen). Primers used for the qPCR step are the 174
following : IFNβFR: 5’GCCGCATTGACCATGTATGAGA3’ and IFNβRV : 175
5’GAGATCTTCAGTTTCGGAGGTAAC3’.
176 177
Analysis of secreted type I interferon 178
Three millions Huh7.5 cells, that are deficient for RIG-induced type-I IFN production 179
(26), were transfected with 10 g of pISRE-Luc vector (Stratagene) in a 10 cm diameter 180
dish using “Fugene6 tranfection reagent” according to manufacturer’s instructions 181
(Roche). pISRE-Luc plasmid expresses luciferase under type-I IFN inductible promoter.
182
After 16h of incubation with transfection mixture, cells were trypsinized are re-seeded in 183
96 wells plate at around 3.104 cells /well in a volume of 100 L. Six hours later, 100 L 184
of clarified (13.000g , 5 min) supernatants, that were collected from transduced cells, 185
was added to wells. After 24 h incubation at 37°C, cells of each well were washed with 186
PBS and lysed before luciferase activity was monitored using the Renilla Luciferase 187
Assay System (Promega).
188 189
Analysis of the IFN response by AB Low Density Arrays 190
Total RNA was extracted from cells with the “NucleoSpin RNA II” kit according to 191
manufacturer’s instructions (Macherey-Nagel) and retro-transcribed with the Invitrogen 192
Superscript kit using random examers as template. 200ng of cDNA were loaded in 193
double on the Low Density Arrays (Applied Bioystem) customized with 95 ISGs probes 194
and 18s probe as a control. The LDAs were run on a AB 7900HT and real time PCR 195
data were collected and analyzed through the SDS 2.2 program (Applied Biosystem).
196 197
Neutralization of IFNβ 198
8 Neutralization of IFNβ produced in supernatant from cells was performed using a 199
neutralisazing anti-IFNβ antibody (ab9662, Abcam) with a final concentration of 0,5 200
ng/mL.
201 202
Construction of HepaRGshIFNR1 cell line 203
Five different lentivirus enabling the expression of 5 different short-hairpin RNAs 204
(shRNA-1: GCCAAGAUUCAGGAAAUUAUU ; shRNA-2:
205
CCUUAGUGAUUCAUUCCAUAU ; shRNA-3: CGACAUCAUAGAUGACAACUU ; 206
shRNA-4: GCUCUCCCGUUUGUCAUUUAU ; shRNA-5:
207
GUUGACUCAUUUACACCAUUU) directed against the ifnr1 gene (that codes IFN 208
receptor 1) were obtained as viral stocks from Sigma. HepaRG cells were seeded at 209
1.105 cells in 24 wells plate and transduced with the 5 lentivirus (m.o.i. of 5 for each 210
virus). After 16h of incubation at 37°C with transduction mixture, medium containing 211
viruses was replace by fresh medium containing 20 g/mL of puromycin (Invivogen) to 212
select for stably transduced cells. Resistant cells were expanded in presence of 40 213
g/mL of puromycin until the constitution of a frozen stock of cells. The inhibition of the 214
expression of IFNR1 mRNA was checked by RT-PCR using the following primers 215
IFNRI-FR: 5’AGTGTTATGTGGGCTTTGGATGGTTTAAGC3’ and IFNRI-RV : 216
5’TCTGGCTTTCACACAATATACAGTCAGTGG3’.
217 218
9 Results
219
Kinetic of HBV replication in HepaRG cells after transduction with Bac-HBV.
220
As the efficiency of transduction was even in both HepG2 and HepaRG cell lines, a 221
direct comparison of the kinetic of HBV replication after transduction with Bac-HBV-WT 222
was possible. Both proliferating and differentiated HepaRG as well as HepG2 cells were 223
transduced at an m.o.i. of 100 pfu/cell with Bac-HBV-WT. Intracellular encapsidated 224
viral DNA was isolated at various time points post-transduction (p.t.) and analyzed by 225
Southern Blot. HBV DNA was detectable very rapidly after transduction in both HepG2 226
and HepaRG cells (fig. 1). Although the amount of HBV intracellular encapsidated DNA 227
was comparable at day 1 p.t. in both cell lines, kinetics of HBV replication were quite 228
different, as its level decreased slowly in HepG2 cells after 12 days, whereas a rapid 229
and sharp decrease was observed in both proliferating and differentiated HepaRG cells 230
to become nearly undetectable at day 12 p.t. This difference in kinetics could not be 231
attributed to differences in kinetics of clearance of the baculovirus template (data not 232
shown), neither to differential cell death. The fast and non-cytolytic elimination of 233
intracellular encapsidated DNA in HepaRG cells suggested that an antiviral response 234
involving specific cellular factors could be involved.
235 236
Establishment of an antiviral state in Bac-HBV-transduced HepaRG.
237
To characterize this antiviral state, cells were transduced twice (at day 0 and day 3) with 238
Bac-HBV-WT. As previously shown the amount of HBV intracellular encapsidated DNA 239
was increased by a second transduction in HepG2 cells (21), whereas it remained 240
unchanged in HepaRG cells (fig. 2). This result strongly suggests that HepaRG cells 241
were able to mount a sustained antiviral response following the first transduction with 242
Bac-HBV-WT.
243
10 To determine whether this antiviral response in HepaRG cells was due to the transgene 244
expression (i.e. synthesis of pgRNA, mRNA, and proteins) and replication of HBV 245
genome, or was induced by the baculovirus vector itself, HepG2 or HepaRG cells were 246
first mock-transduced (inoculation with medium only) or transduced with two different 247
control baculoviruses, containing either the -galactosidase gene (Bac-Gal) or an HBV 248
genome carrying a mutation in the catalytic domain of the polymerase (Bac-HBV- 249
YPDD). The latter baculovirus enables the production of HBV proteins without genome 250
replication (22). Three days after the first transduction, a second transduction was 251
performed with Bac-HBV-WT. In HepG2 cells, HBV intracellular encapsidated DNA was 252
detectable in all experimental conditions (fig. 3A, upper panel), suggesting that no (or 253
weak) antiviral response was induced in these cells after the first transduction. The 254
apparent differences in signal intensity between mock and Bac-Gal (or Bac-HBV- 255
YPDD) for HepG2 in the shown figure was neither significant nor reproducible. What 256
was highly reproducible is the presence of signal in all three conditions. In contrast, 257
HBV intracellular encapsidated DNA was always detectable in HepaRG cells that were 258
first mock-transduced or transduced with Bac-Gal, but never in those first transduced 259
by Bac-HBV-YPDD (fig. 3A, bottom panel; see also fig7B). The results reproducibly 260
obtained by southern blot analysis, were independently confirmed by the analysis of 261
HBsAg secretion in the same conditions (fig. 3B). HBsAg was never detected in the 262
supernatant of HepaRG cells that were first transduced with Bac-HBV-YPDD, 263
suggesting a strong IFN-induced degradation of mRNA encoding HBsAg. Altogether 264
those results demonstrates that the antiviral response observed in HepaRG following 265
transduction is mediated by HBV itself and is independent of the baculovirus vector.
266
Moreover, as no reverse transcription step can occur with Bac-HBV-YPDD, this result 267
also indicates that the establishment of an HBV-mediated antiviral state was 268
11 independent of HBV DNA replication, but was rather due to HBV protein or RNA 269
synthesis.
270 271
HBV elicits IFN- production that subsequently induces ISGs expression in both 272
HepG2 and HepaRG cells.
273
As production of type-I interferons, in particular IFN-, is one of the first cellular 274
antiviral defense (4), we first tested whether the ifn- gene was activated in HepG2 and 275
HepaRG cells (proliferating or differentiated). Cells were transduced with Bac-Gal or 276
Bac-HBV-WT and qRT-PCR performed 24 and 48h p.t. The amount of mRNA encoding 277
IFN was strongly increased in cells transduced with Bac-HBV-WT (either HepG2 or 278
HepaRG cells), but not in those transduced with the control baculovirus (Bac-Gal) (fig.
279
4A). This indicates that HBV, and not the vector, is responsible for the induction of IFN- 280
expression in both HepG2 and HepaRG cells. Using a functional assay, we also 281
demonstrated that biologically active type-I interferons were produced in the 282
supernatant of Bac-HBV-WT transduced cells (fig. 4B).
283
Genes activated by type-I IFNs are well known, and their expression represents a 284
signature of the IFN pathway (4). To determine whether the pattern of induction after 285
transduction with Bac-HBV-WT was similar to that already described, HepG2 and 286
HepaRG (proliferating or differentiated) cells were transduced with Bac-Gal or Bac- 287
HBV-WT. Expression of 96 ISGs was evaluated by qRT-PCR analyses. Only selected 288
ISGs are shown in fig. 4C; the results for the whole set of genes is shown in the 289
supplementary file. The control baculovirus did not induce significant changes in the 290
pattern of expression of the genes, thus confirming that the vector is not responsible for 291
the observed IFN response. In contrast, many of the analyzed genes were 292
overexpressed in HepG2, as well as in proliferative and differentiated HepaRG cells 24 293
and 48h after transduction with Bac-HBV-WT.
294
12 Many of the overexpressed genes, including viperin, mx1, isg15, oas1, isg56, have 295
antiviral properties and may be candidate genes responsible for the inhibition of HBV 296
replication in HepaRG. However, these genes were also activated in HepG2 cells in 297
which the replication of HBV was not inhibited as compared to that observed in 298
HepaRG, suggesting that the IFN signaling in these cells do not translate into antiviral 299
effect and confirming the partially non functional IFN pathway I this cell line (27, 28).
300
One gene, i.e. CXCL9, was only upregulated in HepaRG cells, thus representing a 301
signature for this line, whereas three genes representated a signature for HepG2 cells.
302
So far no correlation between the pattern of gene activation (or repression) and the 303
antiviral response has been evidenced.
304 305
Inhibition of type-I IFN pathway results in enhanced HBV replication in HepaRG 306
cells.
307
The next step was to inhibit the IFN pathway in HepaRG cells to determine whether 308
HBV replication could be enhanced. First, proliferating HepaRG cells were transduced 309
with Bac-HBV-WT and immediately treated with a neutralizing anti-IFN antibody.
310
Intracellular encapsidated viral DNA was isolated at various time points post- 311
transduction (p.t.) and analyzed by Southern Blot. Results showed that neutralization of 312
IFN- clearly increased amount of intracellular encapsidated HBV DNA in proliferating 313
HepaRG (fig. 5), thus confirming the crucial role of IFN- in mediating the observed 314
antiviral response in this cell line. It is worth noting that neutralizing anti-IFN-β antibody 315
did not significantly improve HBV replication in HepG2 cells, as shown in figure 5B that 316
present the fold increase of DNA produced with anti-IFN- treatment compared to non- 317
treated conditions. This result suggest that the IFN- produced by HepG2 cells upon 318
Bac-HBV transduction, which is functional as shown in figure 4B, does not seem to 319
trigger an antiviral response in HepG2.
320
13 To further demonstrate the role of type-I IFN in inhibiting HBV replication in HepaRG 321
cells, we invalidated the expression of the ifnar1 gene, which codes for subunit 1 of the 322
type-I IFN receptor, using short hairpin RNA strategy. The down regulation of the gene 323
in the resulting cell line, i.e. HepaRGshIFNR1, was verified by RT-PCR (fig. 6A). This 324
down regulation of the expression of type-I IFN receptor is expected to be associated 325
with an inhibition of the amplification of the IFN pathway. To confirm that we significantly 326
invalidated type-I IFN pathway, the expression of ISGs was analyzed by qRT-PCR. We 327
showed that a poly-IC stimulation did not increase the expression of ifn-, oas1 and 328
isg56 genes (fig. 6B). Moreover the levels of mRNA encoding IFN, 2OAS or ISG56 329
were decreased by up to 80 % in HepaRGshIFNR1 after transduction with Bac-HBV- 330
WT compared to parental cell line (fig. 6C).
331
If type-I IFN pathway is crucial for the control of HBV replication, its inhibition should 332
result in an increased HBV replication. Both HepaRG and HepaRGshINFR1 were 333
transduced with Bac-HBV-WT and encapsidated HBV DNA extracted at different time 334
post transduction. The amount of intracellular encapsidated HBV DNA was increased in 335
HepaRGshINFR1 cells, thus demonstrating an inverse correlation between IFN- and 336
ISGs expression, and HBV replication (fig. 7A). The inhibition of the antiviral state in 337
HepaRGshINFR1 cells was further evidenced by a double transduction experiment, as 338
done previously (fig. 2). Indeed when two transductions with Bac-HBV-WT were 339
performed at three days of interval, this rate of HBV replication was significantly 340
increased in HepaRGshIFNR1 cells as opposed to HepaRG cells (fig. 7A). It is also 341
worth noting that no additional significant increase in HBV DNA accumulation in 342
HepaRGshIFNR1 cells was observed after IFN- neutralization (fig 5B). This inhibition 343
of the antiviral state in HepaRGshINFR1 was confirmed by successive transductions of 344
cells with different baculovirus as previously described. Indeed, we showed that, as 345
opposed to wild type HepaRG cells, HBV intracellular encapsidated DNA could be 346
14 detected in HepaRGshIFNR1 cells in all conditions and especially when cells were first 347
transduced with Bac-HBV-YPDD (fig. 7B). Taken together, these results emphasize a 348
clear correlation between the production of IFN-β, inhibition of intracellular HBV 349
accumulation, and installation of an antiviral state in HBV-transduced HepaRG cells.
350 351
15 Discussion
352
The belief that HBV may be a “stealth virus”, i.e. not detected by innate immune 353
defences, comes from a longitudinal analysis of the activation of cellular genes 354
performed on liver biopsies of three experimentally-infected chimpanzees. No data in 355
human are available to confirm or challenge this result. In chimpanzees, the expression 356
of cellular genes, including those of antiviral cytokines such as IFN/, remained 357
apparently unchanged within the liver during the lag phase of infection (6). However, 358
these data should be interpreted with caution, as chimpanzees may not be a completely 359
relevant models and moreover one cannot exclude that the inability to detect variation in 360
gene expression may come from the technology used, the stringency of cut off, as well 361
as the timing of the analysis (i.e. the first gene profiling was performed two weeks after 362
the inoculation). The later point is crucial as IFN response to viral infection often takes 363
place very rapidly after infection and can be negatively regulated by the virus. Many 364
studies have shown that HBV, when actively replicating, is able to inhibit IFN signaling 365
pathway (16-19). This capacity to inhibit IFN signaling pathway, in particular in the 366
context of exogenous IFN exposure, may explain at least partially why chronically 367
infected patients do not respond efficiently to IFN- treatment.
368
There are other indirect evidences that innate immunity, i.e. antiviral response at level of 369
infected cells and innate response via specialized cells of immune system (e.g. NK, 370
NKT), may play an important role to control HBV infection to some extent. A study 371
showed that HBV clearance could be initiated in the liver of infected chimpanzees 372
before the onset of adaptive immune response (8). In addition, several studies on HBV 373
transgenic mice showed that in animal deficient for type-I IFN receptor, PKR or IRF1, 374
HBV replicates at higher levels than in controls mice (29-31). These observations 375
strongly suggest that type-I IFN response contributes to the control of HBV replication in 376
mice. Finally, recent data suggest that the lack of intrahepatic gene induction may be a 377
16 peculiar feature of the chimpanzee model since an early induction of both innate and 378
adaptative response was observed in two patients with acute HBV infection (9).
379
In vitro data are needed to gain insight in the mechanism by which HBV may induce an 380
innate response which in turn may control viral replication. Transformed hepatic cell 381
lines (i.e. HepG2 and Huh7) have limited interest as they do not have fully functional 382
IFN pathways (27, 28), in contrast to PHH and HepaRG that are non-cancerous, 383
permissive to some extend to HBV infection (10, 11), and functional for IFN signalling 384
(23). The latter may explain the relatively low replication rate in these cells (i.e. less than 385
20% of cells infected) (10, 32). This low level of replication, that might result from a 386
cellular antiviral response, complicates the study of host/pathogen interaction.
387
To gain insight on the potential ability of HBV to elicit then disarm an IFN response, it 388
appeared necessary to initiate a high HBV replication in a large number of cells. In this 389
study, we present evidence that a strong initial HBV infection can induce a type-I IFN 390
response, which results in the establishment of an antiviral state that is not overcome by 391
the virus in the non-transformed/non-neoplastic HepaRG cell line. To study this antiviral 392
response, we have used recombinant baculoviruses carrying the HBV genome that are 393
able to transduce high percentage of cells and trigger high initial rate of HBV replication.
394
The comparison of the kinetics of HBV replication after cell transduction showed, that in 395
contrast to that observed in HepG2, the presence of intracellular HBV DNA in both 396
proliferating and differentiated HepaRG was transient.
397
The mechanism of clearance of encapsidated HBV DNA in HepaRG was non-cytolytic 398
and correlated with the production of IFN- and subsequent activation of ISGs. In 399
HepG2 cells, despite the production of IFN- and activation of ISGs, the amount of 400
intracellular HBV DNA remained stable during time, thus confirming that type-I IFN 401
pathway is not fully functional in this transformed hepatoblastoma-derived cell line, as 402
previously suggested (27, 28, 33). Importantly, we have shown that the establishment of 403
17 the antiviral state in HepaRG was mainly due to the expression of HBV proteins and/or 404
transcripts, as an HBV mutant with a non-functional polymerase was yet able to induce 405
the antiviral state.
406
The inverse correlation between the activation of type-I IFN pathway and inhibition of 407
HBV replication in HepaRG was definitely demonstrated by experiment in which the 408
action of IFN- was directly neutralized by antibodies and by experiment with 409
engineered HepaRG in which the type-I IFN receptor was down regulated by RNA 410
interference. In both case the rate of HBV replication was greatly increased after 411
transduction. These HepaRGshIFNR1 cells may represent a unique model to study 412
HBV biology and the effect of persistent HBV replication on cell physiology.
413
Our data demonstrate that, in HepaRG cells, a strong HBV expression and replication 414
induce a potent IFN response that in return restricts infection. It seems that in this model 415
the virus is not able to disarm/counteract the IFN response, despite the demonstrated 416
capacity of some HBV proteins to do so in different experimental conditions (16, 18, 34- 417
36). Further investigations are necessary to determine which viral determinant is 418
responsible for the induction of IFN response in this model and how the virus may 419
overcome it to induce a persistent infection.
420 421
Acknowledgements 422
We would like to thank Dr Isabelle E. Vincent for her advice and critical review of the 423
manuscript.
424 425
18 References
426 427
1. Seeger C, Mason B, Zoulim F: Hepadnaviruses. In: Knipe DM, Howley PM, eds. Fields 428
Virology. Volume 2. 5 ed. Philadelphia, USA: Lippincott Williams and Wilkins, 2006; 2977- 429
3029.
430
2. Lavanchy D. Worldwide epidemiology of HBV infection, disease burden, and vaccine 431
prevention. J Clin Virol 2005;34 Suppl 1:S1-3.
432
3. Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev 2001;14:778-809, table 433
of contents.
434
4. Randall RE, Goodbourn S. Interferons and viruses: an interplay between induction, 435
signalling, antiviral responses and virus countermeasures. J Gen Virol 2008;89:1-47.
436
5. Uze G, Monneron D. IL-28 and IL-29: newcomers to the interferon family. Biochimie 437
2007;89:729-734.
438
6. Wieland S, Thimme R, Purcell RH, Chisari FV. Genomic analysis of the host response to 439
hepatitis B virus infection. Proc Natl Acad Sci U S A 2004;101:6669-6674.
440
7. Wieland SF, Chisari FV. Stealth and cunning: hepatitis B and hepatitis C viruses. J Virol 441
2005;79:9369-9380.
442
8. Guidotti LG, Rochford R, Chung J, Shapiro M, Purcell R, Chisari FV. Viral clearance 443
without destruction of infected cells during acute HBV infection. Science 1999;284:825-829.
444
9. Fisicaro P, Valdatta C, Boni C, Massari M, Mori C, Zerbini A, Orlandini A, et al. Early 445
kinetics of innate and adaptive immune responses during hepatitis B virus infection. Gut 446
2009;58:974-982.
447
10. Gripon P, Diot C, Theze N, Fourel I, Loreal O, Brechot C, Guguen-Guillouzo C.
448
Hepatitis B virus infection of adult human hepatocytes cultured in the presence of dimethyl 449
sulfoxide. J Virol 1988;62:4136-4143.
450
11. Gripon P, Rumin S, Urban S, Le Seyec J, Glaise D, Cannie I, Guyomard C, et al.
451
Infection of a human hepatoma cell line by hepatitis B virus. Proc Natl Acad Sci U S A 452
2002;99:15655-15660.
453
12. Parent R, Marion MJ, Furio L, Trepo C, Petit MA. Origin and characterization of a 454
human bipotent liver progenitor cell line. Gastroenterology 2004;126:1147-1156.
455
13. Hantz O, Parent R, Durantel D, Gripon P, Guguen Guillouzo C, Zoulim F. Persistence of 456
the Hepatitis B Virus Covalently Closed Circular DNA in HepaRG human hepatocyte-like cells.
457
Journal of General Virology 2009;90:127-135.
458
14. Apostolou E, Thanos D. Virus Infection Induces NF-kappaB-dependent 459
interchromosomal associations mediating monoallelic IFN-beta gene expression. Cell 460
2008;134:85-96.
461
15. Mossman KL, Macgregor PF, Rozmus JJ, Goryachev AB, Edwards AM, Smiley JR.
462
Herpes simplex virus triggers and then disarms a host antiviral response. J Virol 2001;75:750- 463
758.
464
16. Fernandez M, Quiroga JA, Carreno V. Hepatitis B virus downregulates the human 465
interferon-inducible MxA promoter through direct interaction of precore/core proteins. J Gen 466
Virol 2003;84:2073-2082.
467
17. Rosmorduc O, Sirma H, Soussan P, Gordien E, Lebon P, Horisberger M, Brechot C, et al.
468
Inhibition of interferon-inducible MxA protein expression by hepatitis B virus capsid protein. J 469
Gen Virol 1999;80 ( Pt 5):1253-1262.
470
18. Christen V, Duong F, Bernsmeier C, Sun D, Nassal M, Heim MH. Inhibition of alpha 471
interferon signaling by hepatitis B virus. J Virol 2007;81:159-165.
472
19. Guan SH, Lu M, Grunewald P, Roggendorf M, Gerken G, Schlaak JF. Interferon-alpha 473
response in chronic hepatitis B-transfected HepG2.2.15 cells is partially restored by lamivudine 474
treatment. World J Gastroenterol 2007;13:228-235.
475
19 20. Pugh JC, Summers JW. Infection and uptake of duck hepatitis B virus by duck 476
hepatocytes maintained in the presence of dimethyl sulfoxide. Virology 1989;172:564-572.
477
21. Delaney WEt, Isom HC. Hepatitis B virus replication in human HepG2 cells mediated by 478
hepatitis B virus recombinant baculovirus. Hepatology 1998;28:1134-1146.
479
22. Lucifora J, Durantel D, Belloni L, Barraud L, Villet S, Vincent IE, Margeridon-Thermet 480
S, et al. Initiation of hepatitis B virus genome replication and production of infectious virus 481
following delivery in HepG2 cells by novel recombinant baculovirus vector. J Gen Virol 482
2008;89:1819-1828.
483
23. Maire M, Parent R, Morand AL, Alotte C, Trepo C, Durantel D, Petit MA.
484
Characterization of the double-stranded RNA responses in human liver progenitor cells.
485
Biochem Biophys Res Commun 2008;368:556-562.
486
24. Summers J, Smith PM, Horwich AL. Hepadnavirus envelope proteins regulate covalently 487
closed circular DNA amplification. J Virol 1990;64:2819-2824.
488
25. Seigneres B, Pichoud C, Martin P, Furman P, Trepo C, Zoulim F. Inhibitory activity of 489
dioxolane purine analogs on wild-type and lamivudine-resistant mutants of hepadnaviruses.
490
Hepatology 2002;36:710-722.
491
26. Blight KJ, McKeating JA, Rice CM. Highly permissive cell lines for subgenomic and 492
genomic hepatitis C virus RNA replication. J Virol 2002;76:13001-13014.
493
27. Keskinen P, Nyqvist M, Sareneva T, Pirhonen J, Melen K, Julkunen I. Impaired antiviral 494
response in human hepatoma cells. Virology 1999;263:364-375.
495
28. Melen K, Keskinen P, Lehtonen A, Julkunen I. Interferon-induced gene expression and 496
signaling in human hepatoma cell lines. J Hepatol 2000;33:764-772.
497
29. McClary H, Koch R, Chisari FV, Guidotti LG. Relative sensitivity of hepatitis B virus 498
and other hepatotropic viruses to the antiviral effects of cytokines. J Virol 2000;74:2255-2264.
499
30. Guidotti LG, Morris A, Mendez H, Koch R, Silverman RH, Williams BR, Chisari FV.
500
Interferon-regulated pathways that control hepatitis B virus replication in transgenic mice. J 501
Virol 2002;76:2617-2621.
502
31. Isogawa M, Robek MD, Furuichi Y, Chisari FV. Toll-like receptor signaling inhibits 503
hepatitis B virus replication in vivo. J Virol 2005;79:7269-7272.
504
32. Untergasser A, Zedler U, Langenkamp A, Hosel M, Quasdorff M, Esser K, Dienes HP, et 505
al. Dendritic cells take up viral antigens but do not support the early steps of hepatitis B virus 506
infection. Hepatology 2006;43:539-547.
507
33. Doyle SE, Schreckhise H, Khuu-Duong K, Henderson K, Rosler R, Storey H, Yao L, et 508
al. Interleukin-29 uses a type 1 interferon-like program to promote antiviral responses in human 509
hepatocytes. Hepatology 2006;44:896-906.
510
34. Whitten TM, Quets AT, Schloemer RH. Identification of the hepatitis B virus factor that 511
inhibits expression of the beta interferon gene. J Virol 1991;65:4699-4704.
512
35. Foster GR, Ackrill AM, Goldin RD, Kerr IM, Thomas HC, Stark GR. Expression of the 513
terminal protein region of hepatitis B virus inhibits cellular responses to interferons alpha and 514
gamma and double-stranded RNA. Proc Natl Acad Sci U S A 1991;88:2888-2892.
515
36. Wu M, Xu Y, Lin S, Zhang X, Xiang L, Yuan Z. Hepatitis B virus polymerase inhibits 516
the interferon-inducible MyD88 promoter by blocking nuclear translocation of Stat1. J Gen Virol 517
2007;88:3260-3269.
518 519 520
20 Figures legends
521 522
Figure 1 : Kinetic of HBV replication in different cell line after transduction with an 523
HBV recombinant baculovirus (Bac-HBV-WT). Cells were transduced at an m.o.i. of 524
100 pfu/cell with Bac-HBV-WT. Encapsidated DNA was extracted at different times 525
post-transduction and analyzed by Southern Blot. HepaRGp = proliferative HepaRG 526
cells, HepaRGd = differenciated HepaRG cells.
527 528
Figure 2 : Transduction with HBV recombinant baculoviruses leads to an antiviral 529
state in HepaRG cells but not in HepG2 cells. HepG2 and HepaRG cells were 530
transduced once or twice (days 0 and 3) at an m.o.i. of 100 pfu/cell with Bac-HBV-WT.
531
Encapsidated DNA were extracted at different times post-transduction and analyzed by 532
Southern Blot. Graph represents quantification of the autoradiogram.
533 534
Figure 3 : The Antiviral state is due to HBV. HepG2 and HepaRG cells were first 535
transduced at an m.o.i. of 100 pfu/cell either with Bac-HBV-YPDD, Bac-Bgal or with 536
medium. Three days later, cells were transduced a second time at an m.o.i. of 100 537
pfu/cell with Bac-HBV-WT. Encapsidated DNA were extracted and analyzed by 538
Southern Blot (A), and HBsAg dosed by Elisa (B) at different times post-transduction.
539 540
Figure 4 : Transduction with HBV recombinant baculovirus activates the IFN 541
pathway in both HepG2 and HepaRG cells. Cells were transduced at an m.o.i. of 100 542
pfu/cell with Bac-HBV-WT or with Bac-βGal. Twenty four and 48h after, (A) total RNA 543
were extracted, and IFN expression analyzed by qRT-PCR and (C) ISG expression 544
was analyzed by qRT-PCR using AB LDA technology customized with 95 ISG and 18s 545
probes. Only selected ISGs are shown (the whole set genes is shown in the 546
supplementary file). (B) supernatant from transduced cells was also tested for type I IFN 547
21 activity. All results are expressed in fold change compared to non transduced cells.
548
HepaRGp = proliferative HepaRG cells, HepaRGd = differenciated HepaRG cells.
549 550
Figure 5 : Neutralization of IFN-β in supernatant from cells enhances HBV 551
replication. HepaRG, HepG2, or HepaRGshIFNR1 (IFN receptor expression 552
invalidated by RNA interference) cells were transduced at an m.o.i. of 100 pfu/cell with 553
Bac-HBV-WT and immediately treated or not with a neutralizing anti-IFN-β antibody.
554
Treatment was repeated every 3 days when medium was changed. Encapsidated DNA 555
was extracted at different times post-transduction and analyzed by Southern Blot. (A) 556
Autoradiogram of Southern blot obtained with HepaRG cells. (B) Graph showing the 557
ratio between quantity of DNA detected with anti-IFN- treatment and quantity of DNA 558
detected without treatment.
559 560
Figure 6 : Down-regulation of IFN pathway in HepaRGshIFNR1. HepaRG cells and 561
HepaRGshIFNR1 cells were stimulated either by (A, B) polyIC at 10µg/mL or (C) by 562
transduction with Bac-HBV-WT at an m.o.i. of 100 pfu/mL. Cells were lysed (A, B) 8h 563
after stimulation by polyIC or (C) 24h after transduction. Total RNA were extracted and 564
gene expression analyzed by (A) RT-PCR or (B, C) qRT-PCR. Results of qRT-PCR 565
analyses are expressed compared to WT HepaRG cells.
566 567
Figure 7 : Down-regulation of IFN pathway in HepaRGshIFNR1 cells leads to 568
enhanced HBV replication and prevent the establishment of an HBV-mediated 569
antiviral state. HepaRG and HepaRGshIFNR1 cells were first transduced at an m.o.i.
570
of 100 pfu/cell with either (A) Bac-HBV-WT, (B) Bac-HBV-YPDD, Bac-gal or medium.
571
Three days later, cells were transduced or not a second time at an m.o.i. of 100 pfu/cell 572
22 with Bac-HBV-WT. Encapsidated DNA were extracted at different times post- 573
transduction and analyzed by Southern Blot.
574 575
Supplementary file : Transduction with HBV recombinant baculovirus activates the 576
IFN pathway in both HepG2 and HepaRG cells. Cells were transduced at an m.o.i. of 577
100 pfu/cell with Bac-HBV-WT or with Bac-βGal. Twenty four and 48h after, total RNA 578
were extracted and ISG expression was analyzed by qRT-PCR using AB LDA 579
technology customized with 95 ISG and 18s probes.
580 581
